Correction to: Scientific Reports https://doi.org/10.1038/s41598-024-65697-8, published online 22 July 2024
The original version of this Article contained errors in Table 2, where the R and P sequences for Target “Piscine orthoreovirus genotype 1, PRV-1”, and the P sequence for Target “Salmon alphavirus 1, 2, and 3, SAV” were incorrect. The correct and incorrect values appear below.
Incorrect:
Target | Sequence |
|---|---|
Piscine orthoreovirus genotype 1, PRV-1 | R: ACCTGCCATTTTCCCCTCTT P: CGCCGGTAGCTCC |
Salmon alphavirus 1, 2, and 3, SAV | P: TCGAAGTGGTGGCCAG |
Correct:
Target | Sequence |
|---|---|
Piscine orthoreovirus genotype 1, PRV-1 | R: TGAATCCGCTGCAGATGAGTA P: CGCCGGTAGCTCT |
Salmon alphavirus 1, 2, and 3, SAV | P: CTGGCCACCACTTCGA |
In addition, Reference 74 contained an error and was incorrectly stated as:
Keeling, S. E. et al. Development and validation of real-time PCR for the detection of Yersinia ruckeri: Yersinia ruckeri real-time PCR. J. Fish Dis. 35, 119–125. https://doi.org/10.1111/j.1365-2761.2011.01327.x (2012).
The correct reference is listed below:
Keeling, S.E. et al. Development and validation of a real-time PCR assay for the detection of Aeromonas salmonicida, J. Fish Dis., 36(5), 495–503. https://doi.org/10.1111/jfd.12014 (2013).
The original Article has been corrected.
Author information
Authors and Affiliations
Corresponding author
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Sørensen, J., Cuenca, A., Schmidt, J.G. et al. Correction: A novel high-throughput qPCR chip for solving co-infections in RAS farmed rainbow trout. Sci Rep 16, 3883 (2026). https://doi.org/10.1038/s41598-026-36370-z
Published:
Version of record:
DOI: https://doi.org/10.1038/s41598-026-36370-z
