Table 1 Sequences for primers used during reverse transcription and quantitation of RNA collected from infectious EBOV-treated and EBOV trVLP-treated Leydig cells and Sertoli cells
Primer target | Primer sequence (5’ to 3’) | PCR type | Tm (°C) |
|---|---|---|---|
Strand-specific vRNA | GGCCGTCATGGTGGCGAATGGTGAATGTCATATCGGGCCC | Reverse transcription | 62.5 |
Primer tag | GGCCGTCATGGTGGCGAAT | Real-time qPCR | 65.1 |
VP40 (reverse) | GATGGCGGCCGTAGTTGAG | Â | 62.4 |