The molecular dissection of TRIM25’s RNA-binding mechanism provides key insights into its antiviral activity

Álvarez, Lucía; Haubrich, Kevin; Iselin, Louisa; Gillioz, Laurent; Ruscica, Vincenzo; Lapouge, Karine; Augsten, Sandra; Huppertz, Ina; Choudhury, Nila Roy; Simon, Bernd; Masiewicz, Pawel; Lethier, Mathilde; Cusack, Stephen; Rittinger, Katrin; Gabel, Frank; Leitner, Alexander; Michlewski, Gracjan; Hentze, Matthias W.; Allain, Frédéric H. T.; Castello, Alfredo; Hennig, Janosch

doi:10.1038/s41467-024-52918-x

Download PDF

Article
Open access
Published: 01 October 2024

The molecular dissection of TRIM25’s RNA-binding mechanism provides key insights into its antiviral activity

Nature Communications volume 15, Article number: 8485 (2024) Cite this article

10k Accesses
14 Citations
97 Altmetric
Metrics details

Subjects

Abstract

TRIM25 is an RNA-binding ubiquitin E3 ligase with central but poorly understood roles in the innate immune response to RNA viruses. The link between TRIM25’s RNA binding and its role in innate immunity has not been established. Thus, we utilized a multitude of biophysical techniques to identify key RNA-binding residues of TRIM25 and developed an RNA-binding deficient mutant (TRIM25-m9). Using iCLIP2 in virus-infected and uninfected cells, we identified TRIM25’s RNA sequence and structure specificity, that it binds specifically to viral RNA, and that the interaction with RNA is critical for its antiviral activity.

TRIM25 predominately associates with anti-viral stress granules

Article Open access 15 May 2024

Mechanisms of length-dependent recognition of viral double-stranded RNA by RIG-I

Article Open access 18 April 2023

High-content, arrayed compound screens with rhinovirus, influenza A virus and herpes simplex virus infections

Article Open access 08 October 2022

Introduction

The innate immune system is the body’s first line of defence against viral infection. When viruses are detected by the host cell, signalling pathways are activated to induce type I interferon response and the production of inflammatory cytokines¹. Post-translational modifications regulate these signalling pathways, allowing a dynamic and specific host response to infection². Ubiquitination plays a particularly important role and multiple E3 ubiquitin ligases have been identified to be involved in the regulation of immunity^3,4,5,6. The Tripartite Motif (TRIM) family of E3 ligases is characterized by their domain architecture, consisting of an N-terminal RING domain, which is responsible for the E3-ligase activity, followed by one or two B-box domains, a coiled-coil (CC) dimerisation domain and a C-terminal region containing non-catalytic domains that recognise E3 ligase substrates and other targets, which are variable across TRIM proteins with TRIM25 featuring a PRY/SPRY domain (Fig. 1a) ^7,8,9. TRIM25 has been identified as a key player in triggering the innate immune response to RNA viruses. It has been shown that TRIM25 plays a role in the RIG-I signalling pathway, where it is proposed to ubiquitinate the RIG-I caspase activation and recruitment domains (CARDs), which are exposed upon recognition of viral 5′-triphosphate-blunt-end double-stranded RNA^10,11. However, there are other E3 ubiquitin ligases that can polyubiquitinate and activate RIG-I, such as RING finger protein leading to RIG-I activation (Riplet)¹², mex-3 RNA binding family member C (MEX3C)¹³ and TRIM4¹⁴. In addition, there are studies suggesting that only RIPLET and not TRIM25 is sufficient to ubiquitinate and activate RIG-I^15,16,17. Despite these inconsistencies, TRIM25’s involvement in antiviral activity is undisputed. Apart from the RIG-I pathway TRIM25 is required for activating the antiviral function of zinc-finger antiviral protein (ZAP)^18,19, which inhibits the replication of a wide-range of viruses by binding to viral mRNA, repressing its translation and promoting its degradation^{19,20,21,22,23}.

**Fig. 1: NMR and ITC analysis of RNA binding by TRIM25 PRY/SPRY domain.**

TRIM25 was identified as an RNA-binding protein (RBP) by several RNA interactome capture studies, which reported peptides that crosslink to RNA^24,25,26. Several studies could identify different regions of the protein, which harboured RNA-binding residues (located in the CC, PRY/SPRY domains, and the linker in between^25,27,28,29). TRIM25 has also been shown to interact with a wide variety of RNAs, including 3’-UTRs and exons of mRNAs^25,28, lincRNAs²⁸, miRNAs²⁸, viral RNAs and their corresponding ribonucleoproteins^30,31. Although no specific consensus motif for RNA binding was identified, G- and C-rich sequences were found to be overrepresented in the CLIP-seq data²⁸. In vitro assays showed no clear preference for single- or double-stranded RNA²⁹. The fact that different domains and regions of TRIM25 seem to be involved in RNA binding makes it difficult to identify specific sequences or conformational RNA motifs that TRIM25 prefers, and points towards a structurally intricate RNA-binding mechanism. Moreover, it was shown that TRIM25 required RNA binding for its E3-ligase function^28,29 and overall antiviral activity²⁹. However, the mutants employed in those studies still retained RNA-binding activity or were partially unfolded, as we demonstrate below. Thus, it remains poorly understood how TRIM25 binds RNA and how this affects its antiviral activity.

Here we combine biochemical, biophysical and cell biology approaches to characterise the TRIM25-RNA interaction and its role during antiviral activity. We have identified key residues in the PRY/SPRY and CC domains responsible for RNA binding. Furthermore, we developed a mutant, which retains the protein structure including an intact RING domain, responsible for E3-ligase activity, but completely lacks RNA-binding ability. Using iCLIP2³² with size matched inputs in virus-infected and uninfected cells, we could identify the host and viral RNA motifs that TRIM25 binds to and determined TRIM25’s RNA structure- and sequence specificity. In addition, we could confirm that RNA binding of TRIM25 is required for its antiviral activity as well as for its subcellular redistribution to the viral replication organelles (ROs) where it co-localises with viral RNA.

Results

TRIM25 PRY/SPRY domain binds to single- and double-stranded RNA

Previous work showed that the PRY/SPRY domain is responsible for TRIM25 RNA binding^25,28,29,33. Choudhury et al. identified a region in the PRY/SPRY domain encompassing residues 470–508 that bind to RNA by screening a series of deletion constructs²⁸. However, deletion of this region unfolds the PRY/SPRY domain and therefore it remained unclear whether impairment of RNA binding is due to removal of RNA-binding residues or unfolding of the domain (Supplementary Fig. 1a). To refine the RNA-binding interface of this domain at residue-level resolution, we performed NMR titrations with the reported RNA target of TRIM25, pre-let-7a-1@2³⁴ (hereafter referred to as pre-let-7, Supplementary Fig. 1b). NMR resonances of residues 439–630 of the PRY/SPRY were assigned based on a previously published assignment³⁵. Upon addition of pre-let-7, chemical shift perturbations (CSPs) are observed, which confirms binding (Fig. 1b). Specifically, we noticed strong CSPs clustered around two regions of the PRY/SPRY domain. The first of the two regions (region 1, aa. 456–513) is located at the C-terminus of the PRY motif, with residues H505 and K508 in the flexible loop connecting β-strands 3 and 4 exhibiting the strongest CSPs (Fig. 1c, d). This region is located close to the previously reported interaction site between the PRY/SPRY and CC domains³⁵. The second region (region 2, amino acids 567–605) consists of β-strands 10 and 11, close to the N-terminal helix α1, with residue K602 having the strongest CSPs (Fig. 1c, d). At this stage, we could not assess, whether the CSPs in this region were due to a direct RNA interaction or due to an allosteric effect.

The predicted structure of pre-let-7 consists of a stem-loop (Supplementary Fig. 1b). The formation of double-stranded regions indicative of a stem structure was confirmed by the presence of imino peaks detected in 1D-¹H and 2D-¹H/¹H-NOESY experiments (Supplementary Fig. 1c). Imino signals are only observable upon base pairing as the exchange of imino protons with solvent is too fast when unpaired. To obtain further insights into the RNA-binding mechanism of the PRY/SPRY, we designed shorter RNA constructs consisting of only the loop (pre-let-7-loop, single-stranded RNA) or stem of pre-let-7 (pre-let-7-stem) (Supplementary Fig. 1b). To ensure that the short stem was double-stranded, we fused the strands through a three-base long linker and confirmed its stem formation in solution by ¹H/¹H-NOESY NMR (Supplementary Fig. 1c). Pre-let-7-loop induced CSPs only for residues located in binding site 1, whereas titration of pre-let-7 stem affected only binding site 2 (Fig. 1d). To confirm that the binding sites are generally involved in RNA binding and are not specific for pre-let-7 RNA, the NMR titration experiments were repeated with other known RNA binders of TRIM25 (such as Lnczc3h7a³⁶, DENV³⁰ and an arbitrary 28-mer²⁹, see Supplementary Fig. 1b) with similar outcome (Supplementary Fig. 1d). Interestingly, these RNAs also consist of stem-loop structures confirmed by 1D-¹H and ¹H/¹H-NOESY experiments (Supplementary Fig. 1c). With Lnczc3h7a, nuclear Overhauser effect (NOE) cross-peaks are not visible due to the low sample concentration. Nevertheless, the presence of imino peaks in the diagonal and 1D experiments confirms base pairing. These results suggest that the PRY/SPRY domain interacts with RNA by two distinct binding sites with different structural specificities. The first binding site interacts with single-stranded RNA and the second with double-stranded RNA. The structural similarity between the RNAs reported to bind to TRIM25 suggests a preference for stem-loop structures^29,30,36.

The PRY/SPRY domain interacts with different stem-loop RNAs with a dissociation constant (K_D) in the low micromolar range (0.4–4 µM), as assessed by isothermal titration calorimetry (ITC, see Fig. 1e, Supplementary Fig. 1e and Supplementary Table 1). This is in the same range as canonical RNA-binding domains such as RNA recognition motifs (RRMs)³⁷. Our ITC data indicate that the PRY/SPRY domain preferentially binds to loops rich in A and G, as we could detect binding to pre-let-7-loop but not to the Lnczc3h7-loop, which has three U and is shorter (Supplementary Table 1 and Supplementary Fig. 1b). The N values obtained from our ITC experiments for PRY/SPRY binding to its target RNAs was consistently around 0.3, which implies a stoichiometry of approximately 1 RNA per 3 PRY/SPRY domains. Despite careful control of reactant concentrations in repeated experiments, the observed N values persisted, ruling out concentration-derived artifacts and supporting a complex binding mechanism.

To further characterise the RNA-binding site of the PRY/SPRY, we mutated the three residues exhibiting the largest CSPs in NMR titrations. We created a triple mutant, termed PRY/SPRY-m3, in which we mutated residues H505 and K508 from binding site 1 and residue K602 from binding site 2 to glutamic acids. Importantly, the ¹H,¹⁵N-HSQC spectrum of the PRY/SPRY-m3 confirmed that the mutated PRY/SPRY domain is properly folded (Supplementary Fig. 1f). ITC showed that the PRY/SPRY-m3 lost its ability to interact with RNA, further confirming the importance of these residues for RNA binding (Fig. 1f and Supplementary Table 1). The occurrence of these RNA-binding residues seems to be a unique feature for TRIM25 amongst human TRIM family members from group IV⁹ (i.e.,TRIM proteins carrying a PRY/SPRY domain) revealed by multiple sequence alignments. However, the RNA-binding residues are highly conserved in TRIM25 across different species (Supplementary Fig. 1g, h and Supplementary Table 2).

CC domain binds RNA

Having characterised RNA-binding activity of the PRY/SPRY domain, we followed up on previous work that has reported the CC domain of TRIM25 as RNA binder^25,28,38. The CC is not suitable for NMR studies due to its size and extended conformation, which causes slow molecular tumbling and NMR resonance line broadening beyond detection (Supplementary Fig. 2a). We therefore used ITC to test the putative RNA-binding capacity of the CC domain. We found that the CC interacts with pre-let-7 with low micromolar affinity (3.2 ± 0.7 µM) (Fig. 2a), in the same range as the PRY/SPRY domain and classical RNA-binding domains (e.g., RRMs). We performed ITC measurements with the other RNAs used in this study (Supplementary Figs. 1b and 2b). In contrast to the PRY/SPRY domain, the CC domain binds pre-let-7 or lnczc3h7a with equal affinities, but binds 10-fold weaker to the isolated loop sequence of both RNAs (Supplementary Table 1, and Supplementary Fig. 2b). Thus, we find that the CC domain is more promiscuous than the PRY/SPRY domain in its sequence preference.

**Fig. 2: ITC and CLIR-MS/MS analysis of RNA binding by TRIM25 CC domain.**

Since we were unable to map the RNA-binding interface on the CC by NMR, we relied on indirect information to design CC RNA-binding deficient mutants. Based on the CC-PRY/SPRY structure³⁵, we deduced the RNA-binding residues from amino acids that are surface-exposed, close to the CC:PRY/SPRY interface and are commonly found to interact with RNA, such as lysines, arginines and aromatic residues. We found two candidates for mutational analysis (K283 and K285, Fig. 2b) on the basic surface close to the PRY/SPRY binding site 1. Mutation of these two residues into alanines (CC-m2) had a minor effect on affinity towards pre-let-7. However, this reduced the binding enthalpy 10-fold (Fig. 2c and Supplementary Table 1), while retaining the ability to dimerize and to fold into a coiled coil (Supplementary Fig. 2c, d). These findings suggest that while both amino acids are involved in energetically favourable interactions with RNA, other residues must contribute to it.

Using CLIR-MS³⁹ (Fig. 2d) with an equimolar mixture of unlabelled and uniformly ¹³C,¹⁵N-labelled 85-nucleotide-long RNA incubated in HeLa nuclear extract, we detected UV-crosslinks between nucleotides and amino acids of the peptide GISTKPVYIPEVELNHK of TRIM25 (Fig. 2e). The MS/MS spectrum allowed the identification of the crosslinked residue, which was either tyrosine 323 (Y323) or the neighbouring isoleucine 324 (I324). The peptide crosslinks to one uridine (mass shift 324) and could be identified by “light” searches (based on the expected mass of the RNA-peptide adduct) and by “light-heavy” searches (considering the characteristic peak doublet resulting from the isotope labelling), ensuring the specificity for the differentially isotope labelled RNA (Fig. 2e). According to a crystal structure (PDB: 6FLN³⁵) this region is devoid of secondary structure (Fig. 2b). Comparative analysis of TRIM25 sequences from different species revealed that the specific region responsible for RNA binding, as identified by CLIR-MS, is well conserved (see Supplementary Table 2 and Supplementary Fig. 2e). However, this region is not conserved in other group IV TRIM protein CC domains⁹ (Supplementary Fig. 2f). It is noteworthy that this region overlaps with the surface that interacts with the PRY/SPRY domain identified by Koliopoulos et al. ³⁵ (Fig. 2b). To confirm that this region interacts with RNA, we mutated these four residues (K320, Y323, H331 and K332) to glutamic acids (CC-m4) and performed ITC experiments. These show that the CC-m4 has lost its RNA-binding activity (Fig. 2f), while still retaining its ability to fold into a coiled coil and dimerize (Supplementary Fig. 2c, d). We have thus identified the residues of the CC domain that are critical for RNA binding.

PRY/SPRY and CC domains bind to RNA cooperatively

As both domains, the CC and PRY/SPRY interact with RNA, we wanted to assess, whether they do so cooperatively. To test this, we performed ITC measurements of the CC-PRY/SPRY domain. The affinity of the CC-PRY/SPRY construct to pre-let-7 RNA is more than 30–50-fold higher than that of the isolated domains (Fig. 3a), which is a hallmark of chelating cooperativity, where multiple individually weaker binary interactions cooperate to form a stable multimeric complex^40,41. This cooperative effect can also be observed for binding to Lnczc3h7a RNA (Supplementary Table 1 and Supplementary Fig. 3a). It should be highlighted that the ITC binding curves for Lnzc3h7a and DENV-SL with CC-PRY/SPRY have a biphasic behaviour, in contrast to the monophasic curve observed for pre-let-7. This could be due to various factors such as conformational change of the RNA⁴².

**Fig. 3: CC and PRY/SPRY domains bind RNA cooperatively.**

We have previously shown that the interaction between the CC and PRY/SPRY domains in solution is rather transient, despite being present in the crystal structure of the CC-PRY/SPRY tandem domain construct (PDB: 6FLN ³⁵). Considering that the CC-PRY/SPRY interaction plays an important role in TRIM25’s E3 ligase activity and that the identified RNA binding residues are close to the CC:PRY/SPRY interaction site³⁵, we investigated whether RNA binding modifies the properties of this interaction in solution. To achieve this, we monitored the changes in ¹H,¹⁵N-HSQC NMR spectra of CC-PRY/SPRY upon addition of pre-let-7. In the absence of RNA, the spectrum is dominated by sharp, high-intensity peaks in the centre corresponding to the disordered L2 linker region (Fig. 3b). Other well-dispersed peaks overlap with the spectrum of the isolated PRY/SPRY domain but with reduced intensity (Supplementary Fig. 3b). This is consistent with the previously described weak and transient interaction between CC and PRY/SPRY in solution³⁵, resulting in an independent tumbling of the CC and PRY/SPRY connected by a flexible linker. Upon addition of pre-let-7 RNA, the PRY/SPRY peaks disappear completely, while the L2 linker peaks remain visible (Fig. 3b). This demonstrates that both domains tumble jointly in the RNA-bound state, which is compatible with two interaction models: i) RNA stabilizes the CC:PRY/SPRY interaction, or ii) RNA is sandwiched by both domains (Fig. 3c).

To further confirm that this conformational change was due to RNA binding, we used solution small-angle X-ray scattering (SAXS). A comparison of the SAXS curves of free TRIM25 CC-PRY/SPRY and bound to pre-let-7 shows a significant decrease in the radius of gyration upon addition of RNA (R_g = 6.83 ± 0.05 nm for the free protein compared to R_g = 5.7 ± 0.02 nm for the complex), which agrees with a more compact conformation than the free protein in which the PRY/SPRY domain is mostly detached from the CC domain in solution³⁵ (Fig. 3d and Supplementary Table 3). Similar effects were observed for the TRIM25-lnczc3h7a stem-loop complex (R_g = 5.8 ± 0.2 nm) at concentrations well above the K_D, confirming that this RNA stem-loop-induced conformation change is the general RNA-binding mechanism of TRIM25 (Supplementary Fig. 3c and Supplementary Table 3). The effect also occurs in SEC-SAXS with an excess of pre-let-7, clearly demonstrating that it is not an artefact caused by the scattering contribution of the free RNA or aggregation (Supplementary Fig. 3d). We conclude that RNA is bound cooperatively and that it enhances the interaction between both domains.

With the aim of generating a TRIM25 mutant with fully deficient RNA-binding activity, we combined the different mutations described in the previous sections (PRY/SPRY-m3, CC-m2 and CC-m4. Figure 3e), resulting in a mutant referred to as CC-PRY/SPRY-m9. ITC and NMR experiments showed that this combined mutant does not bind RNA, while still retaining a folded PRY/SPRY domain and its ability to dimerize via the coiled-coil domain (Fig. 3f and Supplementary Fig. 3e, f). Thus, with a full-length TRIM25-m9 RNA-binding deficient mutant, we established a powerful tool to test RNA binding by TRIM25 in cells and to understand the importance of RNA binding for TRIM25’s antiviral activity.

iCLIP2 reveals TRIM25’s RNA structure- and sequence specificity

To investigate the RNA-binding properties of TRIM25 within cells we used HEK293-TRIM25 knock-out (TRIM25 KO) cell lines¹⁷, which contain a flippase recognition target (FRT) site to allow stable integration of a gene of choice into the genome using the Flp-In recombinase¹⁷. TRIM25-WT, TRIM25-m3 (lacking the RNA-binding properties of the PRY/SPRY domain) and TRIM25-m9 (TRIM25 CC and PRY/SPRY domains RNA binding null) were integrated into the genome, resulting in stable expression at levels close to endogenous TRIM25 in WT cells (Supplementary Fig. 4a). Although TRIM25-m9 retains its E3-ligase activity, it is reduced compared to WT, confirming that RNA binding enhances ubiquitination activity (Supplementary Fig. 4b)^28,29. To understand the relationship between TRIM25’s RNA binding and its antiviral activity, we chose the alphavirus Sindbis (SINV) as model system. SINV is a pathogenic virus transmitted from mosquitoes to vertebrates that is broadly used as prototypal alphavirus. It was chosen for several reasons: firstly, TRIM25 RNA-binding activity is upregulated upon infection with SINV and, secondly, that overexpression of TRIM25 potently reduces SINV infection⁴³. In addition, there is no viral protein-dependent suppression of TRIM25 as it occurs with NS1 from influenza A virus³⁵.

To better understand TRIM25 specificity in cellulo, we applied iCLIP2⁴⁴ to SINV-infected (referred to hereafter as infected) and uninfected (mock) HA-FLAG-TRIM25 HEK293 cells, as described in Garcia-Moreno et al. ⁴⁵. We added a size-matched input (SMI)⁴⁶ to correct for background signal. Principal component analysis confirmed the high quality of the iCLIP2 data, showing separated clustering of samples based on sample type (SMI vs IP) and conditions (infected vs mock) (Supplementary Fig. 4c). Strikingly, iCLIP2 revealed that TRIM25 targets significantly more cellular genes and has more binding sites in them after SINV infection (Fig. 4a). In agreement with our biophysical data, TRIM25-m3 showed strong reduction in binding sites and targets, when compared to TRIM25 wild type (WT) protein. Almost no binding sites were observed for TRIM25-m9, suggesting that it also lacks RNA binding in cellulo. TRIM25 binding sites in cellular RNAs substantially differ in infected and mock cells, with only ~22% of overlapping targets (Fig. 4b), supporting that TRIM25 RNA-binding activity is regulated by virus infection. TRIM25-m3 binding sites barely overlapped with WT TRIM25, with only 100 (out of 990) being detected by both proteins. This suggests that while TRIM25-m3 is still able to interact with RNA to some extent, its specificity and affinity are substantially affected. The very few binding sites detected in TRIM25-m9 samples did not overlap with neither TRIM25-m3 nor TRIM25 WT (Fig. 4b), suggesting a full or near complete abolishment of its RNA-binding activity to cellular RNAs.

**Fig. 4: iCLIP2 analysis of TRIM25 reveals structural and sequence signatures in target RNAs.**

The iCLIP2 results show that TRIM25 interacts predominantly with mRNAs in both SINV-infected and uninfected (mock) conditions (Supplementary Fig. 4d). In uninfected cells, TRIM25 prefers 3’UTRs, followed by coding sequences (CDS), which is similar to a previous study²⁸. In SINV-infected cells, this binding preference is reversed, leading to higher binding in CDS than in 3’UTRs. It is important to note that the absolute number of binding sites mapping to the 3’UTR remains similar between the two conditions (Supplementary Fig. 4e). However, most of the new binding sites arising in the infected cells concentrate in CDSs, which changes the distribution across mRNA regions in the metanalysis. Interestingly, these new binding sites emerging in infected cells peak at the start and stop codon, which are key signatures for translational control. One potential explanation is the increased availability of these sequences in infected cells due to low ribosome occupancy as a consequence of the powerful translation initiation shut off occurring after phosphorylation of eIF2α⁴⁷. Interestingly, the TRIM25-m3 binding profile loses the peaks at the start and stop codons and 3’UTR, which indicates that the PRY/SPRY is necessary to define RNA-binding specificity also in infected cells. The very few reads detected in TRIM25-m9 samples were homogeneously distributed across the mRNAs, indicating that they are derived from experimental noise rather than from real TRIM25 binding sites (Fig. 4c).

Since many of the RNAs reported for TRIM25 consist of multiple stem-loops of similar size, we tested whether TRIM25 recognises specific structures by analysing the percentage of predicted base pairing around the crosslink site. Notably, we noticed a low incidence of base pairing at the crosslink site flanked by higher pairing probability in both mock and infected TRIM25-WT samples (Fig. 4d and Supplementary Fig. 4f). This implies that TRIM25 recognises stem-loop structures, with UV crosslinks preferentially in the loop region. To rule out that this is an artefact of iCLIP2, we extended the analysis to other RBPs, observing that base pairing distributions around the cross-link site are different for other proteins (Supplementary Fig. 4g).

To test whether TRIM25 recognises specific sequences within the stem-loop structure, we searched for enriched sequence motifs for TRIM25-WT within cellular RNAs in both mock and infected samples. We found two prominent classes (Fig. 4e), an AGAA motif (motif 1) and a UGG motif (motif 2). Detailed analysis of the occurrence of these motifs in the different datasets revealed that in the TRIM25-WT infected sample the AGAA motif typically precedes the crosslinking site, and the UGG motif appears after it. This preference is more pronounced in the infected than in the mock sample probably due to the increase in binding sites upon infection (2032 vs 1019) (Fig. 4f). Of note, these consensus motifs are present in the RNAs used in our biophysical investigation of TRIM25’s RNA-binding mechanism (pre-let-7, 28-mer, Lncz3h7a and DENV-SL, Supplementary Fig 4h). We designed a new RNA that was derived from the pre-let-7 but modified to stringently contain both motifs 1 and 2 across the loop region for validation. 1D-¹H and 2D-¹H/¹H-NOESY experiments confirm that this RNA forms base pairs (Supplementary Fig. 4i). The affinity observed for this RNA was lower than for pre-let-7 (180 nM vs 60 nM, Supplementary Table 1, and Supplementary Fig. 4j). This indicates that the inclusion of both motifs does not increase necessarily TRIM25 binding affinity. We also noticed that the shape of the isotherm changes becoming biphasic, as seen previously for other RNAs tested. As expected, the RNA-binding null m9 does not interact with this RNA (Supplementary Fig. 4k).

In addition to binding sites on cellular RNAs, we tested if TRIM25 also binds to the SINV RNA. iCLIP2 revealed several high-probability binding sites across the viral genome. SINV produces two positive sense RNAs, the genomic (g)RNA that encodes the non-structural proteins and is packaged into virions, and the subgenomic (sg)RNA that encodes for the structural proteins. The sgRNA overlaps with the last third of the gRNA and is expressed to a higher level. This explains why the peaks mapping to the sgRNA region are higher in magnitude than those mapping to the first two thirds of the gRNA. Despite this, several binding sites were significantly enriched over the background signal at gRNA and sgRNA regions (Fig. 4g and Supplementary Table 5), suggesting that TRIM25 engages with both viral transcripts. To determine whether these are bona fide TRIM25 binding sites in the SINV genome, we searched for the structure and sequence features that are enriched in the cellular mRNAs (Fig. 4h). To analyse the structural features, we used experimentally determined structural information previously generated by SHAPE reactivity data for the SINV genome⁴⁸. SHAPE reactivity is closely related to nucleotide flexibility, with unconstrained nucleotides showing higher SHAPE reactivity than nucleotides involved in base pairing, stacking or other interactions. RNAfold⁴⁹, constrained by the SHAPE data, predicts hairpin loops in most of the binding sites (Fig. 4h). Analysis of the consensus motifs occurrence in the SINV RNA binding sites shows that approximately 70% of the binding sites contain at least one of the motifs (Fig. 4g and Supplementary Table 5).

For the validation of SINV RNA-binding sites obtained by iCLIP2, we designed a new RNA construct called RNA_50_motif1&2 (Supplementary Fig. 5m). This RNA includes nucleotides 1602–1652 of the SINV genome, which overlaps with the TRIM25 SINV binding site 1576–1626 and contains the two identified motifs, with only motif 1 present in the loop. This RNA contains a bulge in the stem similar to DENV-SL (Supplementary Fig. 5n). We confirmed that this RNA features base pairing by 1D-¹H and ¹H/¹H-NOESY experiments (Supplementary Fig. 5m, n). Interestingly, we observed the strongest affinity (3.5 nM) for this RNA (Supplementary Fig. 5o). The secondary structure similarity between this RNA and DENV-SL, another tightly bound RNA, suggests that the structure specificity of TRIM25 is more complex than merely binding to single stem-loop structures containing motifs 1 & 2. This confirms the iCLIP2 results showing that TRIM25 can bind viral RNA motifs with high affinity in vitro.

RNA binding is critical for TRIM25’s antiviral activity

TRIM25 is known to inhibit viral replication, as seen for Dengue, Influenza A and Rabies viruses^29,50. However, whether its RNA-binding activity is important for this antiviral role remains poorly understood. To test this, we infected TRIM25 KO cells rescued with either TRIM25 WT, mutants affecting either RNA-binding (m3, m9) or the E3 ligase activity (E3-dead¹⁸) with SINV.

We analysed the effect of our RNA-binding mutants on viral fitness using chimeric viruses expressing mScarlet (SINV_{NSP3-mScarlet}) or mCherry (SINV_mCherry) from the genomic or a duplicated subgenomic RNA, respectively (Supplementary Fig. 5a). Rescue of the KO line with WT TRIM25 decreased SINV fitness with similar strength to the parental line, validating the assay (Supplementary Fig. 5b). Notably, we observed that mutants m3 and m9 increased viral fitness relative to TRIM25-WT to a similar extent than the E3-dead mutant (Fig. 5a). These results suggest that both the E3 ligase activity and the RNA-binding activity are equally important for TRIM25’s antiviral activity against SINV. Red fluorescence derived from SINV_{NSP3-mScarlet} and SINV_mCherry is a proxy for the translation of the gRNA and sgRNA, respectively. TRIM25 suppressed the red fluorescence protein expression from both gRNA and sgRNA, which is compatible with the presence of TRIM25 binding sites in both RNAs (Fig. 5a). We orthogonally validated these experiments using Western blot to quantify capsid levels (Supplementary Fig. 5c). Again, the KO cell line rescued with WT TRIM25 restores the antiviral function to the levels of the parental cell line (Supplementary Fig. 5d). It is important to stress that the increase in capsid observed between the TRIM25-WT and the different mutants is significant in both fluorescence-based and Western blot approaches. However, the differences between m9, m3 and E3-null are non-significant although there is a trend for m9 to cause the strongest effects (Fig. 5a and Supplementary Fig. 5c).

**Fig. 5: Impact of the RNA binding activity of TRIM25 on its antiviral activity.**

SINV replicates in invaginations in endosome-derived membranes, referred to as replication organelles (ROs), where the replicating viral RNA is isolated from the host cytosol^51,52,53. TRIM25 is cytosolic in uninfected cells, but it accumulates in ROs upon SINV infection, together with viral RNA and capsid protein⁴³ (Fig. 5b). To determine whether the ability of TRIM25 to interact with SINV RNA promotes its redistribution to ROs, we used immunofluorescence and RNA single molecule in situ hybridisation (smFISH). TRIM25-WT and TRIM25-m9 showed diffuse localization in the cytoplasm of uninfected cells. Upon infection, TRIM25-WT accumulated into cytoplasmic foci that co-localise with the viral RNA and are consistent with ROs (Fig. 5b). Conversely, TRIM25-m9 remained diffuse after infection and did not accumulate in these foci (Fig. 5b). These results indicate that the RNA-binding activity of TRIM25 is important for its localization to ROs. We hypothesise that interaction with viral RNA can both recruit TRIM25 to the ROs and potentially regulate its E3 ubiquitin ligase activity as previously proposed¹⁷.

Discussion

Several attempts have been made to describe the RNA-binding mechanism of TRIM25^28,29, however a complete description of how TRIM25 recognises the RNA, and its specific motif is still lacking. We have been able to identify all the RNA binding regions of TRIM25 at residue resolution, revealing the cooperative behaviour between the PRY/SPRY and CC domains, and describe a consensus RNA motif by combining a variety of biophysical methods (NMR, ITC, SAXS, SEC-MALS) and iCLIP2. Our results show that TRIM25 achieves very tight binding of RNA by using multiple sites on the CC and PRY/SPRY domains, with each binding site contributing cooperatively to affinity and RNA specificity. Not only were we able to precisely describe the residues involved in RNA binding, but we also discover that the PRY/SPRY domain has a dual binding mode with one site having single-stranded RNA specificity and the other site preferring double-stranded RNA. The proximity of these two sites suggests structural specificity, and indeed we found that the binding of the CC-PRY/SPRY domains to several stem-loops is within nanomolar affinity. This extra layer of complexity may explain the failure of previous studies at identifying a distinct target sequence motif for TRIM25. Here, we show that TRIM25 is indeed a bona fide and highly specific RBP.

The molecular dissection of TRIM25’s RNA-binding activity allowed us to generate a mutant that does not bind RNA neither in vitro nor in cells, without affecting its fold or dimerization property. With this tool in hand, we managed to elucidate the RNA-binding specificity of TRIM25 inside the cell.

Previous iCLIP data on TRIM25^17,28 showed that TRIM25 prefers G- and C-rich sequences, but no strong consensus motif was identified. Our iCLIP2 data allowed us to describe a structural preference of TRIM25 for stem-loop structures inside the cell, including both host and viral RNA. This observation can also explain the G- and C-rich sequences observed in the previous dataset, as G-C base pairing is more stable than A-U due to the higher number of hydrogen bonds formed. We also identified two preferred sequence motifs within the hairpin loop of these stem-loop structures. Particularly, we found that the motif sequences have the common denominator of being A/G rich which also happens for the binding sites for SINV-RNA that do not have any of the motifs present. Interestingly, the sequence motifs found are both present in previously identified RNAs that bind TRIM25, such as pre-let-7 RNA and DENV-SL (Supplementary Fig. 4g). Importantly, the iCLIP2 data showed the lack of RNA-binding activity of TRIM25-m9, which is an important confirmation in cells of the mutations inferred by our biophysical data.

An open question is how TRIM25 exerts its antiviral activity and whether RNA binding is involved. There have been some efforts to answer these questions^28,29, but these studies used TRIM25 constructs that retained RNA-binding activity to some extent (Supplementary Fig. 3). Recently, it was shown to bind and destabilize IAV mRNAs¹⁷. Our data provide several lines of evidence supporting that RNA binding is an essential feature for the antiviral activity of TRIM25. We have shown that viral gene expression is strongly enhanced when RNA binding is completely abolished, phenocopying the mutant that lacks the E3 ligase function. In addition, our iCLIP2 data showed that TRIM25 binds to specific regions of viral RNA. Indeed, our microscopy analyses revealed that TRIM25 RNA-binding activity is a prerequisite to drive the localisation of TRIM25 to SINV ROs, which is likely a critical step for triggering its antiviral activity. This activity could be direct or through interaction with ZAP, which is known to localise to ROs upon SINV infection⁵⁴. Understanding whether TRIM25 RNA-binding activity is important for ZAP localisation, or whether interaction of TRIM25 with ZAP is essential for the antiviral effect, as well as exploring how TRIM25 condensates within ROs, will contribute to a better understanding of the antiviral mechanism driven by TRIM25.

Methods

Protein expression and purification

TRIM25 CC (aa 189–379), PRY/SPRY (439–630) and CC-PRY/SPRY (189–630) were cloned using restriction free cloning into pETM22 featuring a 3C-protease cleavable hexa-histidine and thioredoxin tag (His-Trx). N-terminally extended PRY/SPRY construct (407–630) was cloned into pETM20 with a TEV-protease cleavable His-Trx tag. TRIM25 189–379 was expressed in BL21(DE3). TRIM25 439–630, 407–630 and 189–630 were co-expressed with chaperones KJE, ClpB and GroELS in E. coli BL21(DE3)⁵⁵. All proteins were induced at OD600 = 0.6 by 200 µM isopropyl-ß-D-1-thiogalactopyranoside (IPTG, ROTH CN08.2) and incubated at 18 ˚C for 20 h.

All proteins were purified by immobilized Nickel affinity chromatography (Histrap HP, Cytiva 17524802) in 50 mM Tris, pH 7.5, 300 mM NaCl and 0.2 mM TCEP (ROTHHN95.2) and eluted with a gradient of imidazole (10–300 mM). In the case of co-expression with chaperones the column was washed with 50 mM Tris, pH 7.5, 350 mM KCl, 5 mM MgSO4 and 1 mM ATP(Merck, A9187) prior to elution. The tag was removed by 3C- or TEV-protease digestion overnight and an additional passage over the Histrap HP column (CC and extended PRY/SPRY) or GE Healthcare HiTrap SP HP cation exchange column (Cytiva 17115201, PRY/SPRY, residues 439–630 and CC-PRY/SPRY, residues 189–630). As a final step, aggregates were removed by gel filtration on a GE Healthcare Superdex S75 (Cytiva 29148721, CC, PRY/SPRY, extended PRY/SPRY) or S200 (Cytiva 28990944, CC-PRY/SPRY) in 20 mM MES (ROTH 4259.5), pH 6.5, 75 mM NaCl and 0.5 mM TCEP. For stable isotope labelling, proteins were expressed in M9 medium using ¹⁵NH₄Cl (Sigma299251, 0.5 g/l) as sole nitrogen and carbon source.

RNA production

Pre-let-7a-1@2 (5’-GUA UAG UUU AAA AGG AGA UAA CUA UAC −3’), Lnczc3h7a-SL (5’-UUUUAUCUGAGUUGGAGGUGAAG-3’) and DENV-SL (5’- GCA GGU CGG AUU AAG CCA UAG UAC GGG AAA AAC UAU GCU ACC UG-3’) were in vitro transcribed from DNA oligos using T7 RNA polymerase. Reaction mixtures containing 2 µM forward and reverse primer, 40 mM Tris, pH 8.0, 0.2 mM MgCl₂, 10 mM NTPs (NEBN0446S), 10 mM spermidine, 15 mM DTT, 0.01 % Triton X-100, 4 U/ml TIPP, 0.1 mg/ml T7 polymerase were incubated for 5 h at 37 ˚C and extracted by chloroform/phenol treatment. The aqueous phase was further purified by preparative gel electrophoresis via denaturing PAGE or HPLC using a Thermo DNA Pac PA100 22 x 250 mm anion exchange column at 95 ˚C. The purified RNA was dialyzed against 20 mM MES, pH 6.5, 75 mM NaCl and 0.5 mM TCEP and refolded before use by heating up at 95 ˚C for 5 min and snap-cooling on ice. The shorter pre-let-7 loop (5’-UAA AAG GAG AU-3’), stem-fusion (5’-G UAU AGU U C AAC UAU AC-3’), 28-mer duplex RNA (5’-AUG GCU AGC UGG AGC CAC CCG CAG UUC G-3’), pre-let-7a-1@2, pre-let-7_modified (5’- GUA UAG UUU AAA GAA UGG AUA ACU AUA C-3’) and RNA_50_motif1&2 (5’- UUA GUG GCA GAC AAA GGC AUC GAG GCA GCC GCA GAA GUU GUC UGC GAA GU-3’) constructs were purchased from IBA or Biomers.

Nuclear magnetic resonance spectroscopy

NMR spectra were acquired on Bruker Avance III spectrometers operating at magnetic field strengths corresponding to proton Larmor frequencies of 600, 700, and 800 MHz, equipped with cryogenic triple resonance probes (600 and 800 MHz) and a room temperature triple resonance probe (700 MHz). Protein observed experiments were performed in 20 mM sodium phosphate, pH 6.5, 150 mM NaCl, 2 mM TCEP, 5% D₂O and 0.02% sodium azide at 293 K. For RNA observed experiments samples were prepared in 20 mM MES, pH 6.5, 75 mM NaCl, 5 mM MgCl₂, 0.02% sodium azide and measured at 278 K.

For titrations 100 µM ¹⁵N-labelled TRIM25-PRY/SPRY (439–630) was titrated with stock solutions of 10–20 mM natural abundance RNA to a molar excess of 2.5–3 (details indicated in the Fig. 1b). At each titration point a ¹H,¹⁵N-HSQC spectrum was acquired. Due to protein precipitation, a different number of scans were used for different titration points (256 scans for PRY/SPRY domain alone, 512 scans for 1:1 and 1:2 and 1024 for 1:3). Figure 1B was generated using the same number of contour and noise thresholds. Spectra were processed using NMRPipe⁵⁶, visualized and peak shifts tracked using SPARKY⁵⁷. Peak shifts for PRY/SPRY 439-630 were assigned based on a previously published assignment³⁵. CSPs in histograms (Fig. 1d) were determined at a protein:RNA ratio of 1:3.

Isothermal titration calorimetry

Isothermal titration calorimetry (ITC) data was collected on a Malvern MicroCal PEAQ-ITC at 20 ˚C in 20 mM MES, pH 6.5, 75 mM NaCl and 0.5 mM TCEP. Depending on the protein construct, RNA was titrated from the syringe at concentrations ranging from 20 to 1100 µM into the cell containing protein with concentrations between 2 and 150 µM while stirring at 750 rpm (see Figs. 1, 2 and 3 and Supplementary Figs. 1, 2 and 3). For experiments with DENV-SL the RNA was kept in the cell at 15 µM and the protein titrated from the syringe at 110 µM. Experiments were typically done in triplicates and analysed using the Malvern MicroCal PEAQ-ITC analysis software. Data was fitted by assuming the simplest binding mode necessary to fully explain the data (one or two binding sites).

Sequence alignments

To reveal the conservation of TRIM25-PRYSPRY among TRIM proteins, sequences of the 44 human TRIM proteins belonging to group IV (containing the PRY/SPRY domain) and Riplet (RN135) were obtained from InterPro⁵⁸ using the PRY/SPRY domain as a seed. The alignment of the different PRY/SPRY domains was performed using ClustalW⁵⁹ and the alignment is provided in Supplementary Fig. 1g. Using the 44 sequences of human TRIM proteins containing the PRY/SPRY domain used previously, the structure of the proteins was modelled using Alphafold^60,61 to determine the boundaries of the CC domain for each protein. The alignment of the different CC domains was then performed using ClustalW ⁵⁹ and shown in Supplementary Fig. 2f.

To test sequence conservation of TRIM25 amongst different species, sequences of 18 TRIM25 proteins from different species were aligned using ClustalW⁵⁹ and the full alignment for the PRYSPRY domain is shown in Supplementary Fig. 1h. Sequences were obtained from ENSEMBL⁶² using the human TRIM25 protein as seed (UniProt ID: Q14258). Details of the species are given in Supplementary Data Table 2. In addition, the sequence logo corresponding to the CC specific region responsible for RNA binding was generated by WebLogo (http://weblogo.berkeley.edu/logo.cgi)⁶³ using the aligned protein sequences corresponding to the CC domain from the same 20 species (Supporting Table 2 and Supplementary Fig. 2f). The height of the stack of letters at each position reflects sequence conservation and reaches a maximum value of 4.32 for proteins. The height of each letter within a stack is proportional to its abundance.

Small-angle X-ray scattering

SAXS data were collected at the beamline P12, operated by EMBL Hamburg at the PETRA III storage ring (DESY, Hamburg, Germany)⁶⁴. Measurements were done at 20 °C in 20 mM MES, pH 6.5, 75 mM NaCl and 0.5 mM TCEP in flow cell mode at 1.24 Å. For each sample and buffer 20–100 frames with 0.05–0.195 s exposure time were acquired and frames showing radiation damage manually removed. SEC-SAXS data was collected at the BM29 BioSAXS beamline using a wavelength of 0.99 Å and a Superdex 10/300 S200 Increase size exclusion column and analysed using Chromixs^65,66. Per run 2500 frames with 1 s exposure time were collected. Data analysis was done using the ATSAS package version 2.8.3⁶⁷. PRIMUS was used for frame averaging and buffer subtraction⁶⁸. The radius of gyration, R_g, was estimated using the Guinier approximation in PRIMUS. Pair-wise distribution functions were calculated using GNOM⁶⁹. Collection statistics for SAXS measurements are summarized in Supplementary Table 3.

Circular dichroism spectroscopy

CD spectra were acquired using a Jasco 815 circular dichroism spectrometer. Samples were measured at 20 °C in quartz cuvettes with 1 mm path length in 20 mM MES, pH 6.5, 75 mM NaCl and 0.5 mM TCEP at 0.5 mg/ml.

Protein-RNA crosslink identification by CLIR-MS/MS

TRIM25 crosslinks were identified by CLIR-MS/MS³⁹. Experiments were performed using a Thermo Orbitrap Fusion Lumos mass spectrometer with settings as described in Vries et al. ⁷⁰ and data analysis was performed using RNxQuest, version 1.0⁷¹. As shown in Fig. 2e, the cross-linked peptide is detected as a triply charged ion with a mass difference of approximately 11 Da, corresponding to the introduction of ¹³C and ¹⁵N stable isotopes in the heavy RNA. MS/MS spectra of the peptide crosslinked to light U (right, top) or heavy U (right, bottom). Assigned fragment ions with a relative intensity greater than 5% are labelled. All assigned fragment ions (b and y ions) are shown on the peptide sequence in the lower right-hand corner. The localisation of the crosslinking site to the tyrosine residue (highlighted in bold) is confirmed by observing the unmodified b7 ion and the b8 ion carrying the U modification. All fragment ions carrying the U modification (e.g., b₈, b₉, y₁₅) show a mass shift between the light and heavy form spectra.

Size exclusion chromatography – multi-angle light scattering (SEC-MALS)

50 µl of CC domain or the mutants were injected onto a Superdex 200 5/150 GL gel-filtration column (Cytiva 28990945) in 20 mM MES, pH 6.5, 75 mM NaCl and 0.5 mM TCEP, at a flow rate of 0.3 ml/min and at room temperature. The column was connected to a MiniDAWN MALS detector and Optilab differential refractive index detector (Wyatt Technology). Data were analyzed using the Astra 7 software (Wyatt Technology).

Plasmids and recombinant DNA procedures

Synthetic genes for generation of inducible cell lines were obtain from Genscript. cloned into the pcDNA5/FRT with the HA-FLAG tag followed by a flexible linker encoding for GGSGGSGG (glycine and serine repeats) to facilitate the folding of the RBP of interest independently from the tag. The E3-dead mutant was generated by replacing Cys50 and Cys53 with serines which abolishes the E3 ligase activity of the RING domain as shown by Zheng et al. ¹⁸.

Cell lines generation

To generate the HEK293 TRIM25-WT, TRIM25-m3, TRIM25-m9 and TRIM25- E3-ligase dead cell lines, HEK293 TRIM25 KO cells were transfected with pOG44 and the corresponding pcDNA5/FRT plasmid containing the protein of interest using X-tremeGENE 360 transfection reagent following manufacturer’s recommendations (Roche, 8724121001). For the selection of inducible cell lines, 50 µg/ml Hygromycin B was added to the media. Cells were selected and checked TRIM25 variant expression by western blotting (Supplementary Fig. 4a).

In vivo ubiquitination assays

Briefly, HEK-293 TRIM25 KO cells were seeded the day before transfection. Next day, equal amount of Ub and HA-tagged TRIM25 constructs (WT, m9 and E3-dead) plasmids were mixed with Fugene HD transfection reagent (Promega no. E2311) in reduced serum medium. The transfection mix was incubated at room temperature for 5 min before adding dropwise to the cells. The transfected cells were incubated overnight at 37 °C, 5%CO₂. Twenty-four hours post-transfection, the proteasome was inhibited with a final concentration of 0.5 µM Carfilzomib/PR-171 (Selleckchem no. S2853) and put back in the incubator. After 6 h the cells were harvested.

The harvested cells were lysed in 1x cell lysis buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 0.5% IGEPAL (NP-40) and 50 mM NEM, cOmplete protease inhibitor cocktail (Sigma Aldrich)) for 30 min at 4 °C. Then the lysate was spin down for three minutes at 1500 rpm to sediment nuclei, transferred to a fresh tube and then spin down for 10 min at 17,000 x g at 4 °C. After pelleting the debris the protein concentrations in the supernatant were measured using Qubit Protein Broad Range Assay Kit (Q33211). The protein ubiquitination was analyzed by western blot with anti-TRIM25 (Supplementary Fig. 4b).

Western blotting

Samples were prepared by mixing with NuPAGE LDS Sample Buffer 4X (Thermo Fisher Scientific, #NP0008) and incubated at 95 °C for 5 min. Proteins were resolved by SDS-PAGE for 50 min at 180 V and transferred to nitrocellulose membranes using the Trans-Blot Turbo Transfer System (Bio-Rad). Membranes were blocked for 1 hour at RT or overnight at 4 °C. 5% skimmed milk in 0.1% PBS-T was used for blocking and for the preparation of antibody dilutions. Membranes were incubated with primary antibodies either for 1 h at RT or overnight at 4 °C. After three washes in 0.1% PBS-T, the membranes were incubated with the appropriate secondary antibodies for 1 h at RT. The membranes were then washed three more times in 0.1% PBS-T prior to imaging. LI-COR Odyssey CLx imaging system for visualisation and Image Studio software for quantification.

Viruses

Sindbis virus was produced by in vitro transcription from the plasmid pT7svwt⁷². SINV-mCherry and SINV-nsp3-scarlet was generated by duplication of subgenomic promoter and insertion of mCherry⁴³ (Supplementary Fig. 5a). SINV-nsp3-scarlet was generated by amplifying mScarlet sequence from pUC19_CRISPR_CT_Scarlet_GSG_P2A_BSD (primer forward: GGGGACTAGTATGGTGAGCAAGG; reverse: ccccACTAGTCTTGTACAGCTCG) and cloned into pT7SINV-WT using SpeI restriction enzyme (Supplementary Fig. 5a).

Fluorescence-based viral fitness assay

6 × 10⁴ cells were seeded on each well of a 96-well microplate with flat μClear bottom (Greiner Bio-One, #655986) in DMEM lacking phenol-red (Gibco # 31053028) and supplemented with 2% FBS and 1 mM sodium pyruvate. The different cell lines (KO rescued WT, E3-ligase dead, m3, and m9) were infected with SINV-mCherry or SINV-nsp3-mScarlet (see Supplementary Fig. 5a) at 0.1 MOI in complete DMEM lacking phenol-red and supplemented with FBS 2%. Cells were incubated at 37 °C and 5% CO₂ in a CLARIOstar fluorescence plate reader (BMG Labtech) for 24 h in FBS 2%; mCherry signal was monitored by measuring fluorescence (mCherry: excitation 570 nm, emission 620 nm; mScarlet: excitation 569 nm, emission 594 nm) every 15 min. Statistical significance of the difference in mCherry or mScarlet expression at 18 and 22 hpi was determined by t test (from n > 3).

iCLIP2

To identify TRIM25 binding sites for RNA on mock and SINV-infected cells at a high resolution, we employed iCLIP2-seq⁴⁴ with the modifications explained in Garcia-Moreno et al. ⁴⁵. 10 × 10⁶ HEK293 TRIM25 WT, TRIM25-m3, and TRIM25-m9 cells were seeded in 6 sets of 10 cm dishes and incubated for 24 h. Three cell sets per cell line were then infected with 3 MOI of SINV. At 9 hpi, cells were washed with PBS 1x, and UV irradiated with 300 mJ/cm² at 254 nm. To obtain RNA fragments of suitable length and to degrade DNA, 1 ml of thawed lysate of each replicate was incubated with 10 U Ambion RNase I (ThermoScientific, #AM2295) and 4 U Turbo DNase per ml of lysate for 3 min at 37 °C, with 1100 rpm agitation. Subsequently, lysates were placed on ice and supplemented with 200 U RiboLock RNase Inhibitor (ThermoScientific, #EO0382). Then, 10 µl of lysate was taken from each sample for the size-matched input (SMI). 30 µl of ANTI-FLAG M2 Magnetic Beads (Millipore, #M8823) slurry per ml of lysate was pre-equilibrated in lysis buffer and resuspended in 50 µl of lysis buffer. Beads were added to the lysate and incubated for 2 h at 4 °C with gentle rotation. Next, we followed the protocol, explained in Garcia-Moreno et al. ⁴⁵. To decide the number of cycles, a qPCR was performed using EvaGreen (Biotium, #31000), 2X Phusion HF PCR Master mix and P5/P3 Solexa primers (the optimal cycle number was considered as the cycle number at the centre at the “knee of exponential growth” −3). The number of cycles used for each replicate can be found in the supporting information (Supplementary Table 4). The final PCR products were purified by using ProNex beads (Promega, # NG2001) which allow for selecting the DNA of the correct size. The libraries were quantified using Qubit and the size was determined by using High Sensitivity D1000 TapeStation. Each group of samples was pooled equimolarly and then mixed considering the number of samples of the IP and the SMI and the ratio of reads. The final library was processed using single-end sequencing mode with a NextSeq 500/550 High Output v2 kit (75 cycles, Illumina).

Data processing for iCLIP2 and statistical analysis

Raw FASTQ files were demultiplexed using the Je Suite⁷³ and adapters were trimmed using Cutadapt⁷⁴. STAR was used to align reads to a concatenated human (GRCh38, ENSEMBL Release 106) and SINV (pT7-SVwt) genome in end-to-end alignment mode⁷⁵. Only uniquely aligned reads were retained for downstream analysis. PCR duplicates were collapsed using unique molecular identifiers (UMIs) with the Je Suite. The crosslink truncation site for each read (−1 from the 5’ start site of the read) was extracted using BEDTools⁷⁶.Peak calling was performed with HTSeq-clip and the R/Bioconductor package, DEW-seq⁷⁷. HTSeq-clip was used to generate a sliding window annotation of the human and SINV genome (50nt window, 20nt step size) and calculate the frequency of crosslink truncation sites within each window. DEW-Seq was then used to calculate the differential enrichment of each window relative to size matched input control samples, with a cut-off of 2 log2 fold change and 0.01 adjusted p-value. Multiple hypothesis correction was performed using the Independent Hypothesis Weighting (IHW) method⁷⁸. Overlapping windows were merged to form binding regions. PCA analysis was performed using DESeq2. Following size correction and variance stabilisation, the 1000 most variable sliding windows were selected and used for PCA plotting. Binding site properties, including gene name, biotype, gene feature, were extracted from the ENSEMBL genome annotation using the GenomicRanges package. Metagene analyses were performed using functions from the cliProfiler package. Sequences for motif prediction and secondary structure prediction were defined for each binding site as a 50-nucleotide region, centred on the peak in BigWig signal. They were extracted from the CDS sequence of the longest isoform of the gene in which the binding site occurred. For motif prediction, a gene and gene region-matched background sequence was extracted for each binding site to allow for differential enrichment analysis. Enrichment analysis was performed using HOMER. MotifStack was used to cluster and plot motifs. Secondary structures were predicted using RNAfold from ViennaRNA⁴⁹ and specific structure features were extracted by forgi. Enrichment for paired sequence was calculated relative to 10 scrambled controls of each input sequence. For plotting of SINV viral genome structures, SHAPE data from Kutchko et al. ⁷⁹ was included as a constraint in the structure prediction. Coordinates for plotting specific structures were generated with the RRNA package. SINV genome coverage in reads per million was calculated using BEDTools. SMI signal was subtracted from IP signal for plotting.

Clustering analysis of the percentage of paired and unpaired sequences

To determine the optimal number of clusters for the data, the R package NbClust was used. This package compiles several different methods for identifying the optimal number of clusters. After running the NbClust function, the number of clusters most frequently identified as optimal was either 2 or 5. To provide a more comprehensive overview of the data 5 clusters were used. Subsequently, the K-means clustering was performed using the FKM function from the fclust package in R. This method allowed us to classify the sequences into 5 distinct clusters. For each cluster, we calculated the mean ratio of paired to unpaired sequences at each position. This approach enabled us to analyse and interpret the distribution and characteristics of paired and unpaired sequences within each cluster effectively.

Combined inmunofluorescence and RNA smFISH assays

1.8 × 10⁵ cells were seeded on High Precision Coverslips (Merienfeld, #0117520) and incubated for 24 h in DMEM with 10% FBS. Cells were either mock-infected or infected with 1 MOI of SINV in DMEM without FBS at 37 °C, followed by the replacement of the medium with DMEM supplemented with 2% FBS. At 18 h post-infection, cells were washed with PBS and fixed in 4% paraformaldehyde for 10 min at room temperature. After three 5 min washes in PBS, the cells were permeabilised with 1x PBS supplemented with 0.1% Triton X-100 for 10 min at room temperature. Cells were washed twice with 1X PBS for 5 min each, twice with 2x SSC for 5 min each, and twice with pre-warmed pre-hybridization buffer (2x SSC and 10% deionized formamide in DEPC-treated water) at 37 °C for 20 min each. The cells were then incubated with 125 nM SINV RNAs specific Stellaris probes (LGC Biosearch Technologies) in pre-heated hybridization buffer (2x SSC, 10% deionized formamide and 10% dextran sulphate in DEPC water) at 37 °C in a humidified chamber overnight. Cells were then washed twice with pre-warmed pre-hybridization buffer for 20 min at 37 °C, twice with 2X SSC for 5 min each, and twice with 1X PBS 5 min each. All solutions used from now on were RNase free by adding RiboLock RNase Inhibitor (Thermo Fisher Scientific, # EO0381). Cells were incubated with 1X PBS-BSA 5% for 30 min followed by primary antibody (HA antibody, Biolegend 901502 1:250 dilution) in 1X PBS-Tween20 0.1% (PBST) supplemented with 5% BSA for 1 h. Next, the cells were washed three times with PBST for 5 min each and were then incubated with secondary antibody (α-rabbit Alexa488 at 1:500 dilution) in 0.1% PBST supplemented with 5% BSA for 1 h in the dark. The cells were washed three times in 0.1% PBST and once in 1X PBS for 5 min each. Cells were then incubated with DAPI (1:500 of 0.5 mg/mL stock) in 1X PBS for 10 min at room temperature, followed by two washes with 1x PBS for 5 min and one wash with DEPC-treated pure water for 1 min. Finally, coverslips were collected and mounted on glass slides using ProLong Diamond Antifade Mounting Medium (Catalog number: P36961).

Image acquisition

Cells were imaged on a Zeiss LSM880 confocal system using a 63X oil objective (Plan-Apochromat 63x/1.4 Oil DIC M27). Images were generated using Zeiss Zen 3.4 Blue Edition software.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

The data supporting the findings of this study are available from the corresponding authors upon request. The crystal structures of human TRIM25 PRYSPRY, CC and CC-PRY/SPRY are available in the PDB under the accession numbers 6FLM, 4LTB and 6FLN. SAXS data has been deposited in the SASBDB under accession codes SASDK78, SASDK88 SASDK98, and SASDKA8. The iCLIP2 data is available under accession code GSE276465. Source data are provided with this paper.

References

Takeuchi, O. & Akira, S. Innate immunity to virus infection. Immunol. Rev. 227, 75–86 (2009).
Article CAS PubMed PubMed Central Google Scholar
Deng, Y., Wang, Y., Li, L., Miao, E. A. & Liu, P. Post-Translational Modifications of Proteins in Cytosolic Nucleic Acid Sensing Signaling Pathways. Front Immunol. 13, 898724 (2022).
Article CAS PubMed PubMed Central Google Scholar
Zinngrebe, J., Montinaro, A., Peltzer, N. & Walczak, H. Ubiquitin in the immune system. EMBO Rep. 15, 28–45 (2014).
Article CAS PubMed Google Scholar
Jiang, X. & Chen, Z. J. The role of ubiquitylation in immune defence and pathogen evasion. Nat. Rev. Immunol. 12, 35–48 (2012).
Article CAS Google Scholar
Davis, M. E. & Gack, M. U. Ubiquitination in the antiviral immune response. Virology 479–480, 52–65 (2015).
Article PubMed Google Scholar
Hu, H. & Sun, S.-C. Ubiquitin signaling in immune responses. Cell Res. 26, 457–483 (2016).
Article CAS PubMed PubMed Central Google Scholar
Esposito, D., Koliopoulos, M. G. & Rittinger, K. Structural determinants of TRIM protein function. Biochem Soc. Trans. 45, 183–191 (2017).
Article CAS PubMed Google Scholar
Marín, I. Origin and diversification of TRIM ubiquitin ligases. PLoS One 7, e50030 (2012).
Article ADS PubMed PubMed Central Google Scholar
Short, K. M. & Cox, T. C. Subclassification of the RBCC/TRIM superfamily reveals a novel motif necessary for microtubule binding. J. Biol. Chem. 281, 8970–8980 (2006).
Article CAS PubMed Google Scholar
Gack, M. U. et al. TRIM25 RING-finger E3 ubiquitin ligase is essential for RIG-I-mediated antiviral activity. Nature 446, 916–920 (2007).
Article ADS CAS PubMed Google Scholar
Gack, M. U. et al. Roles of RIG-I N-terminal tandem CARD and splice variant in TRIM25-mediated antiviral signal transduction. Proc. Natl. Acad. Sci. USA. 105, 16743–16748 (2008).
Article ADS CAS PubMed PubMed Central Google Scholar
Oshiumi, H., Matsumoto, M., Hatakeyama, S. & Seya, T. Riplet/RNF135, a RING finger protein, ubiquitinates RIG-I to promote interferon-beta induction during the early phase of viral infection. J. Biol. Chem. 284, 807–817 (2009).
Article CAS PubMed Google Scholar
Kuniyoshi, K. et al. Pivotal role of RNA-binding E3 ubiquitin ligase MEX3C in RIG-I-mediated antiviral innate immunity. Proc. Natl Acad. Sci. USA. 111, 5646–5651 (2014).
Article ADS CAS PubMed PubMed Central Google Scholar
Yan, J., Li, Q., Mao, A.-P., Hu, M.-M. & Shu, H.-B. TRIM4 modulates type I interferon induction and cellular antiviral response by targeting RIG-I for K63-linked ubiquitination. J. Mol. Cell Biol. 6, 154–163 (2014).
Article CAS PubMed Google Scholar
Hayman, T. J. et al. RIPLET, and not TRIM25, is required for endogenous RIG-I-dependent antiviral responses. Immunol. Cell Biol. 97, 840–852 (2019).
Article CAS PubMed Google Scholar
Cadena, C. et al. Ubiquitin-Dependent and -Independent Roles of E3 Ligase RIPLET in Innate Immunity. Cell 177, 1187–1200.e16 (2019).
Article CAS PubMed PubMed Central Google Scholar
Choudhury, N. R. et al. TRIM25 inhibits influenza A virus infection, destabilizes viral mRNA, but is redundant for activating the RIG-I pathway. Nucleic Acids Res. 50, 7097–7114 (2022).
Article CAS PubMed PubMed Central Google Scholar
Zheng, X. et al. TRIM25 Is Required for the Antiviral Activity of Zinc Finger Antiviral Protein. J. Virol. 91, e00088-17 (2017).
Li, M. M. H. et al. TRIM25 Enhances the Antiviral Action of Zinc-Finger Antiviral Protein (ZAP). PLoS Pathog. 13, e1006145 (2017).
Article PubMed PubMed Central Google Scholar
Zhu, Y. et al. Zinc-finger antiviral protein inhibits HIV-1 infection by selectively targeting multiply spliced viral mRNAs for degradation. Proc. Natl Acad. Sci. USA. 108, 15834–15839 (2011).
Article ADS CAS PubMed PubMed Central Google Scholar
Guo, X., Carroll, J.-W. N., Macdonald, M. R., Goff, S. P. & Gao, G. The zinc finger antiviral protein directly binds to specific viral mRNAs through the CCCH zinc finger motifs. J. Virol. 78, 12781–12787 (2004).
Article CAS PubMed PubMed Central Google Scholar
Guo, X., Ma, J., Sun, J. & Gao, G. The zinc-finger antiviral protein recruits the RNA processing exosome to degrade the target mRNA. Proc. Natl. Acad. Sci. USA. 104, 151–156 (2007).
Article ADS CAS PubMed Google Scholar
Zhu, Y., Wang, X., Goff, S. P. & Gao, G. Translational repression precedes and is required for ZAP-mediated mRNA decay. EMBO J. 31, 4236–4246 (2012).
Article CAS PubMed PubMed Central Google Scholar
Castello, A. et al. Insights into RNA biology from an atlas of mammalian mRNA-binding proteins. Cell 149, 1393–1406 (2012).
Article CAS PubMed Google Scholar
Kwon, S. C. et al. The RNA-binding protein repertoire of embryonic stem cells. Nat. Struct. Mol. Biol. 20, 1122–1130 (2013).
Article CAS PubMed Google Scholar
Hentze, M. W., Castello, A., Schwarzl, T. & Preiss, T. A brave new world of RNA-binding proteins. Nat. Rev. Mol. Cell Biol. 19, 327–341 (2018).
Article CAS PubMed Google Scholar
Castello, A. et al. Comprehensive Identification of RNA-Binding Domains in Human Cells. Mol. Cell 63, 696–710 (2016).
Article CAS PubMed PubMed Central Google Scholar
Choudhury, N. R. et al. RNA-binding activity of TRIM25 is mediated by its PRY/SPRY domain and is required for ubiquitination. BMC Biol. https://doi.org/10.1186/s12915-017-0444-9. (2017).
Sanchez, J. G. et al. TRIM25 Binds RNA to Modulate Cellular Anti-viral Defense. J. Mol. Biol. 430, 5280–5293 (2018).
Article CAS PubMed PubMed Central Google Scholar
Manokaran, G. et al. Dengue subgenomic RNA binds TRIM25 to inhibit interferon expression for epidemiological fitness. Science. https://doi.org/10.1126/science.aab3369.(1979).
Meyerson, N. R. et al. Nuclear TRIM25 Specifically Targets Influenza Virus Ribonucleoproteins to Block the Onset of RNA Chain Elongation. Cell Host Microbe 22, 627–638.e7 (2017).
Article CAS PubMed PubMed Central Google Scholar
Wickenhagen, A. et al. A prenylated dsRNA sensor protects against severe COVID-19. Science (1979) 374, eabj3624 (2021).
Vaishali et al. Validation and classification of RNA binding proteins identified by mRNA interactome capture. RNA 27, 1173–1185 (2021).
Article CAS PubMed PubMed Central Google Scholar
Choudhury, N. R. et al. Trim25 Is an RNA-Specific Activator of Lin28a/TuT4-Mediated Uridylation. Cell Rep. 9, 1265–1272 (2014).
Article CAS PubMed PubMed Central Google Scholar
Koliopoulos, M. G. et al. Molecular mechanism of influenza A NS1-mediated TRIM25 recognition and inhibition. Nat. Commun. https://doi.org/10.1038/s41467-018-04214-8. (2018).
Lin, H. et al. The long noncoding RNA Lnczc3h7a promotes a TRIM25-mediated RIG-I antiviral innate immune response. Nat. Immunol.https://doi.org/10.1038/s41590-019-0379-0. (2019).
Maris, C., Dominguez, C. & Allain, F. H.-T. The RNA recognition motif, a plastic RNA-binding platform to regulate post-transcriptional gene expression. FEBS J. 272, 2118–2131 (2005).
Article CAS PubMed Google Scholar
Lai, C. et al. Long noncoding RNA AVAN promotes antiviral innate immunity by interacting with TRIM25 and enhancing the transcription of FOXO3a. Cell Death Differ. 28, 2900–2915 (2021).
Article CAS PubMed PubMed Central Google Scholar
Dorn, G. et al. Structural modeling of protein-RNA complexes using crosslinking of segmentally isotope-labeled RNA and MS/MS. Nat. Methods 14, 487–490 (2017).
Article CAS PubMed PubMed Central Google Scholar
Whitty, A. Cooperativity and biological complexity. Nat. Chem. Biol. 4, 435–439 (2008).
Article CAS PubMed Google Scholar
Ercolani, G. & Schiaffino, L. Allosteric, Chelate, and Interannular Cooperativity: A Mise au Point. Angew. Chem. Int. Ed. 50, 1762–1768 (2011).
Article CAS Google Scholar
Joynt, S., Morillo, V. & Leng, F. Binding the mammalian high mobility group protein AT-hook 2 to AT-rich deoxyoligonucleotides: enthalpy-entropy compensation. Biophys. J. 96, 4144–4152 (2009).
Article ADS CAS PubMed PubMed Central Google Scholar
Garcia-Moreno, M. et al. System-wide Profiling of RNA-Binding Proteins Uncovers Key Regulators of Virus Infection. Mol. Cell https://doi.org/10.1016/j.molcel.2019.01.017. (2019).
Buchbender, A. et al. Improved library preparation with the new iCLIP2 protocol. Methods 178, 33–48 (2020).
Article CAS PubMed Google Scholar
Garcia-Moreno, M. et al. Incorporation of genome-bound cellular proteins into HIV-1 particles regulates viral infection. https://doi.org/10.1101/2023.06.14.544764.
Van Nostrand, E. L. et al. Robust transcriptome-wide discovery of RNA-binding protein binding sites with enhanced CLIP (eCLIP). Nat. Methods 13, 508–514 (2016).
Article PubMed PubMed Central Google Scholar
Carrasco, L., Sanz, M. & González-Almela, E. The Regulation of Translation in Alphavirus-Infected Cells. Viruses 10, 70 (2018).
Article PubMed PubMed Central Google Scholar
Kutchko, K. M. et al. Structural divergence creates new functional features in alphavirus genomes. Nucleic Acids Res. 46, 3657–3670 (2018).
Article CAS PubMed PubMed Central Google Scholar
Lorenz, R. et al. ViennaRNA Package 2.0. Algorithms Mol. Biol. 6, 26 (2011).
Article PubMed PubMed Central Google Scholar
Yuan, Y. et al. Trim25 restricts rabies virus replication by destabilizing phosphoprotein. Cell insight 1, 100057 (2022).
Article PubMed PubMed Central Google Scholar
Frolova, E. I., Gorchakov, R., Pereboeva, L., Atasheva, S. & Frolov, I. Functional Sindbis virus replicative complexes are formed at the plasma membrane. J. Virol. 84, 11679–11695 (2010).
Article CAS PubMed PubMed Central Google Scholar
Froshauer, S., Kartenbeck, J. & Helenius, A. Alphavirus RNA replicase is located on the cytoplasmic surface of endosomes and lysosomes. J. Cell Biol. 107, 2075–2086 (1988).
Article CAS PubMed Google Scholar
Netherton, C. L. & Wileman, T. Virus factories, double membrane vesicles and viroplasm generated in animal cells. Curr. Opin. Virol. 1, 381–387 (2011).
Article CAS PubMed PubMed Central Google Scholar
Law, L. M. J. et al. ZAP’s stress granule localization is correlated with its antiviral activity and induced by virus replication. PLoS Pathog. 15, e1007798 (2019).
Article CAS PubMed PubMed Central Google Scholar
de Marco, A., Deuerling, E., Mogk, A., Tomoyasu, T. & Bukau, B. Chaperone-based procedure to increase yields of soluble recombinant proteins produced in E. coli. BMC Biotechnol. 7, 32 (2007).
Article PubMed PubMed Central Google Scholar
Delaglio, F. et al. NMRPipe: a multidimensional spectral processing system based on UNIX pipes. J. Biomol. NMR 6, 277–293 (1995).
Article CAS PubMed Google Scholar
Lee, W., Tonelli, M. & Markley, J. L. NMRFAM-SPARKY: enhanced software for biomolecular NMR spectroscopy. Bioinformatics 31, 1325–1327 (2015).
Article PubMed Google Scholar
Paysan-Lafosse, T. et al. InterPro in 2022. Nucleic Acids Res. 51, D418–D427 (2023).
Article CAS PubMed Google Scholar
Larkin, M. A. et al. Clustal W and Clustal X version 2.0. Bioinformatics 23, 2947–2948 (2007).
Article CAS PubMed Google Scholar
Varadi, M. et al. AlphaFold Protein Structure Database: massively expanding the structural coverage of protein-sequence space with high-accuracy models. Nucleic Acids Res. 50, D439–D444 (2022).
Article CAS PubMed Google Scholar
Jumper, J. et al. Highly accurate protein structure prediction with AlphaFold. Nature 596, 583–589 (2021).
Article ADS CAS PubMed PubMed Central Google Scholar
Hubbard, T. J. P. et al. Ensembl 2009. Nucleic Acids Res. 37, D690–D697 (2009).
Article CAS PubMed Google Scholar
Schneider, T. D. & Stephens, R. M. Sequence logos: a new way to display consensus sequences. Nucleic Acids Res 18, 6097–6100 (1990).
Article CAS PubMed PubMed Central Google Scholar
Blanchet, C. E. et al. Versatile sample environments and automation for biological solution X-ray scattering experiments at the P12 beamline (PETRA III, DESY). J. Appl. Crystallogr. 48, 431–443 (2015).
Article ADS CAS PubMed PubMed Central Google Scholar
Pernot, P. et al. Upgraded ESRF BM29 beamline for SAXS on macromolecules in solution. J. Synchrotron Radiat. 20, 660–664 (2013).
Article CAS PubMed PubMed Central Google Scholar
Panjkovich, A. & Svergun, D. I. CHROMIXS: automatic and interactive analysis of chromatography-coupled small-angle X-ray scattering data. Bioinformatics 34, 1944–1946 (2018).
Article CAS PubMed Google Scholar
Franke, D. et al. ATSAS 2.8: a comprehensive data analysis suite for small-angle scattering from macromolecular solutions. J. Appl Crystallogr. 50, 1212–1225 (2017).
Article ADS CAS PubMed PubMed Central Google Scholar
Konarev, P. V., Volkov, V. V., Sokolova, A. V., Koch, M. H. J. & Svergun, D. I. PRIMUS: a Windows PC-based system for small-angle scattering data analysis. J. Appl Crystallogr. 36, 1277–1282 (2003).
Article ADS CAS Google Scholar
Svergun, D. I. Determination of the regularization parameter in indirect-transform methods using perceptual criteria. J. Appl. Crystallogr. 25, 495–503 (1992).
Article ADS CAS Google Scholar
de Vries, T. et al. Specific protein-RNA interactions are mostly preserved in biomolecular condensates. Sci. Adv. 10, eadm435 (2024).
Sarnowski, C. P., Götze, M. & Leitner, A. RNxQuest: An Extension to the xQuest Pipeline Enabling Analysis of Protein–RNA Cross-Linking/Mass Spectrometry Data. J. Proteome Res. 22, 3368–3382 (2023).
Article CAS PubMed PubMed Central Google Scholar
Castelló, A., Sanz, M. Á., Molina, S. & Carrasco, L. Translation of Sindbis Virus 26S mRNA Does Not Require Intact Eukariotic Initiation Factor 4 G. J. Mol. Biol. 355, 942–956 (2006).
Article PubMed Google Scholar
Girardot, C., Scholtalbers, J., Sauer, S., Su, S.-Y. & Furlong, E. E. M. Je, a versatile suite to handle multiplexed NGS libraries with unique molecular identifiers. BMC Bioinforma. 17, 419 (2016).
Article Google Scholar
Kechin, A., Boyarskikh, U., Kel, A. & Filipenko, M. cutPrimers: A New Tool for Accurate Cutting of Primers from Reads of Targeted Next Generation Sequencing. J. Comput Biol. 24, 1138–1143 (2017).
Article CAS PubMed Google Scholar
Dobin, A. et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29, 15–21 (2013).
Article CAS PubMed Google Scholar
Quinlan, A. R. & Hall, I. M. BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics 26, 841–842 (2010).
Article CAS PubMed PubMed Central Google Scholar
Sahadevan, S., Sekaran, T. & Schwarzl, T. A Pipeline for Analyzing eCLIP and iCLIP Data with Htseq-clip and DEWSeq. Methods Mol. Biol. 2404, 189–205 (2022).
Article CAS PubMed Google Scholar
Ignatiadis, N., Klaus, B., Zaugg, J. B. & Huber, W. Data-driven hypothesis weighting increases detection power in genome-scale multiple testing. Nat. Methods 13, 577–580 (2016).
Article CAS PubMed PubMed Central Google Scholar
Kutchko, K. M. & Laederach, A. Transcending the prediction paradigm: novel applications of SHAPE to RNA function and evolution. Wiley Interdiscip Rev. RNA 8, e1374 (2017).
Pettersen, E. F. et al. UCSF Chimera—A visualization system for exploratory research and analysis. J. Comput. Chem. 25, 1605–1612 (2004).
Article CAS PubMed Google Scholar

Download references

Acknowledgements

We thank the EMBL Genomics Facility, especially Ferris Jung, for the data acquisition. We thank the EMBL Data Science Internal Support team, especially Sarah Kaspar, for the statistical consulting. L.A. was supported by a fellowship from the EMBL Interdisciplinary (EI4POD) program under Marie Skłodowska-Curie Actions COFUND (847543) and acknowledges support by the Joachim Herz Foundation through an Add-on Fellowship for Interdisciplinary Life Sciences. L.I. is funded by BBSRC DTP scholarship number BB/M011224/1 V.R. is funded by the European Union’s Horizon 2020 research and innovation programme under Marie-Sklodowska-Curie n. 892756. K.R. is supported by the Francis Crick Institute, which receives its core funding from Cancer Research UK (CC2075), the UK Medical Research Council (CC2075), and the Wellcome Trust (CC2075). A.L. acknowledges Paola Picotti (ETH Zurich) for access to instrumentation and laboratory infrastructure. G.M. is funded by project financed under Dioscuri, a programme initiated by the Max Planck Society, jointly managed with the National Science Centre in Poland, and mutually funded by Polish Ministry of Science and Higher Education and German Federal Ministry of Education and Research (2019/02/H/NZ1/00002). G.M. was also a recipient BBSRC project grant (BB/T002751/1). F.A. acknowledge support of the SNSF NCCR RNA and Disease (51NF40-182880). A.C. is funded by the European Research Council (ERC) Consolidator Grant ‘vRNP-capture’ 101001634 and the MRC grants MR/R021562/1, MC_UU_00034/2 and MC_UU_00034/5. J.H. gratefully acknowledges EMBL’s Infection Biology Transversal Theme Synergy Grant and support from the Deutsche Forschungsgemeinschaft (DFG) via grants HE7291/1-1 and HE7291/8-1.

Funding

Open Access funding enabled and organized by Projekt DEAL.

Author information

These authors contributed equally: Lucía Álvarez, Kevin Haubrich.

Authors and Affiliations

Molecular Systems Biology Unit, European Molecular Biology Laboratory (EMBL) Heidelberg, 69117, Heidelberg, Germany
Lucía Álvarez, Kevin Haubrich, Sandra Augsten, Bernd Simon, Pawel Masiewicz & Janosch Hennig
Nuffield Department of Medicine, Peter Medawar Building for Pathogen Research, University of Oxford, Oxford, OX1 3SY, UK
Louisa Iselin
Department of Biochemistry, University of Oxford, South Parks Road, OX1 3QU, Oxford, UK
Louisa Iselin
MRC-University of Glasgow Centre for Virus Research, 464 Bearsden Road, Glasgow, G61 1QH, Scotland, UK
Louisa Iselin, Vincenzo Ruscica & Alfredo Castello
Institute of Biochemistry, Department of Biology, ETH Zürich, Zürich, Switzerland
Laurent Gillioz & Frédéric H. T. Allain
Protein expression and purification facility, European Molecular Biology Laboratory (EMBL) Heidelberg, 69117, Heidelberg, Germany
Karine Lapouge
Director’s Research, European Molecular Biology Laboratory (EMBL) Heidelberg, 69117, Heidelberg, Germany
Ina Huppertz & Matthias W. Hentze
Dioscuri Centre for RNA-Protein Interactions in Human Health and Disease, International Institute of Molecular and Cell Biology in Warsaw, Warsaw, Poland
Nila Roy Choudhury & Gracjan Michlewski
Infection Medicine, University of Edinburgh, The Chancellor’s Building, Edinburgh, UK
Nila Roy Choudhury & Gracjan Michlewski
Department of Molecular Biology and Biophysics, University of Connecticut Health Center, Farmington, CT, USA
Bernd Simon
European Molecular Biology Laboratory, 71 Avenue des Martyrs, CS 90181, 38042 Grenoble Cedex 9, Grenoble Cedex, France
Mathilde Lethier & Stephen Cusack
Molecular Structure of Cell Signalling Laboratory, The Francis Crick Institute, 1 Midland Road, London, NW1 1AT, UK
Katrin Rittinger
Université Grenoble Alpes, Institut de Biologie Structurale, Grenoble, France; Commissariat à l’Energie Atomique et aux Energies Alternatives, Direction de la Recherche Fondamentale, Institut de Biologie Structurale, Grenoble, France; Centre National de la Recherche Scientifique, Institut de Biologie Structurale, Grenoble, France
Frank Gabel
Institute of Molecular Systems Biology, Department of Biology, ETH Zürich, 8093, Zürich, Switzerland
Alexander Leitner
Chair of Biochemistry IV, Biophysical Chemistry, University of Bayreuth, 95447, Bayreuth, Germany
Janosch Hennig

Authors

Lucía Álvarez
View author publications
Search author on:PubMed Google Scholar
Kevin Haubrich
View author publications
Search author on:PubMed Google Scholar
Louisa Iselin
View author publications
Search author on:PubMed Google Scholar
Laurent Gillioz
View author publications
Search author on:PubMed Google Scholar
Vincenzo Ruscica
View author publications
Search author on:PubMed Google Scholar
Karine Lapouge
View author publications
Search author on:PubMed Google Scholar
Sandra Augsten
View author publications
Search author on:PubMed Google Scholar
Ina Huppertz
View author publications
Search author on:PubMed Google Scholar
Nila Roy Choudhury
View author publications
Search author on:PubMed Google Scholar
Bernd Simon
View author publications
Search author on:PubMed Google Scholar
Pawel Masiewicz
View author publications
Search author on:PubMed Google Scholar
Mathilde Lethier
View author publications
Search author on:PubMed Google Scholar
Stephen Cusack
View author publications
Search author on:PubMed Google Scholar
Katrin Rittinger
View author publications
Search author on:PubMed Google Scholar
Frank Gabel
View author publications
Search author on:PubMed Google Scholar
Alexander Leitner
View author publications
Search author on:PubMed Google Scholar
Gracjan Michlewski
View author publications
Search author on:PubMed Google Scholar
Matthias W. Hentze
View author publications
Search author on:PubMed Google Scholar
Frédéric H. T. Allain
View author publications
Search author on:PubMed Google Scholar
Alfredo Castello
View author publications
Search author on:PubMed Google Scholar
Janosch Hennig
View author publications
Search author on:PubMed Google Scholar

Contributions

Conception/design: L.A., K.H., A.C., J.H; Data acquisition: L.A., K.H., V.R., L.G., S.A., I.H., B.S., P.M., F.G., A.L.; Material contribution: M.L., S.C., K.R., G.M., N.R.C.; Data analysis: L.A., K.H., L.I., L.G., K.L., F.G., A.L., A.C., J.H.; Data interpretation: L.A., K.H., L.I., A.L., F.A., A.C., J.H.; Writing, original draft: L.A., K.H., A.C., J.H.; Writing, editing, all authors; Funding acquisition: A.C., J.H.: Supervision, S.C., A.L., M.H., F.A., A.C., J.H.

Corresponding authors

Correspondence to Alfredo Castello or Janosch Hennig.

Ethics declarations

Competing interests

The authors declare no competing interests.

Peer review

Peer review information

Nature Communications thanks Cyril Dominguez and the other, anonymous, reviewers for their contribution to the peer review of this work. A peer review file is available.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Supplementary Information

Peer Review File

Reporting Summary

Source data

Source Data

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Álvarez, L., Haubrich, K., Iselin, L. et al. The molecular dissection of TRIM25’s RNA-binding mechanism provides key insights into its antiviral activity. Nat Commun 15, 8485 (2024). https://doi.org/10.1038/s41467-024-52918-x

Download citation

Received: 07 December 2023
Accepted: 23 September 2024
Published: 01 October 2024
DOI: https://doi.org/10.1038/s41467-024-52918-x

This article is cited by

Acetylation-dependent USP7-TRIM25 axis drives oncogenic progression in non-small cell lung cancer
- Jian Yang
- Zhike Chen
- Jun Zhao
Cell Death & Disease (2025)