Introduction

F. oxysporum is a major pathogen that can cause vascular wilt or root rot in several economically important crops, such as bananas, tomatoes, potatoes, and yams, resulting in serious reductions in yield, quality, and monetary return1,2,3,4,5. Plant chlorosis in older leaves is a common symptom of Fusarium wilt. As the disease progresses, the entire plant eventually wilts and dies3,6. F. oxysporum, the main Fusarium phytopathogen, can specifically infect underground plant organs, causing tissue browning, decay, and damping off2,4. Similarly, Fusarium wilt is defined as a soil-borne disease7,8. The pathogen, F. solani plays a crucial role in causing disease in many economically significant crops9. Both F. oxysporum and F. solani are identified as causal agents of root rot in trifoliate orange10, while sweet potato can be infected by F. oxysporum or F. solani in inoculated soil, resulting in root rot during storage11. F. oxysporum has also been isolated from underground plant organs other than roots12,13. Relevant to the present study, F. oxysporum has been isolated and identified from rhizomes of cultivated ginger (Zingiber officinale) in Queensland, Australia14, Shandong, China15, and the United States16.

Ginger rhizomes are an important horticultural crop globally and are produced in tropical and subtropical regions. They are mainly used as a condiment and food flavoring, as well as a traditional Chinese herb. In China, ginger rhizomes are used as a traditional vegetable, and are widely cultivated in Southwest China and the Yangtze River Basin, where they have high economic value. However, Fusarium represents a serious disease of cultivated ginger, and symptoms of Fusarium have become particularly prevalent where ginger is grown in continuously cropped soil. The pathogen propagates in rhizomes as they develop and this leads to the infection of new shoots which become chlorotic with the entire plant appearing stunted. Eventually, the whole plant appears wilted and dies because of the vascular infection. Importantly, the areas of ginger production in China with symptoms of wilt have been increasing14,17.

Ginger rhizomes represent an excellent habitat for microorganisms. For example, Fusarium sp. overwinters as chlamydospores in plant tissues, including rhizomes, and produces new microconidia, conidia, and hyphae. Ginger rhizomes infected with Fusarium are generally asymptomatic6. The pathogen then propagates asexually and accumulates in overwintering rhizome tissues. This accumulation of hyphae and conidia then serves as inoculum for new tissues that are generated the following spring when adventitious buds are formed and new shoots are generated2,17,18.

In this study, we postulated that Fusarium is the principal pathogenic fungi responsible for ginger wilt, and their significance cannot be underestimated. We successfully isolated and characterized F. oxysporum and F. solani from ginger rhizomes exhibiting soft rot, confirming their direct connection to this disease. Additionally, we evaluated the correlation between the firmness of ginger rhizomes and the quantity of Fusarium conidia as well as examined the progression of Fusarium wilt during the ginger development. To pinpoint the primary causal agents of Fusarium wilt, ITS amplicon sequencing was utilized to dissect the associated fungal microbiome. Our results lay a robust foundation for developing targeted disease management strategies, which could substantially mitigate the detrimental effects of ginger wilt on global ginger production.

Results

Ginger root rot disease

The average initial firmness of mature ginger rhizomes in the symptomatic group which were harvested and placed in a substrate was 99 N (Newton). Symptomatic rhizomes appeared distinctly brown with visible white hyphae on their surface after being cultivated at 25 °C for 12 days (Fig. 1A, B). Conidia with 3-5 septate were visible on the white hyphae that were collected and viewed microscopically (Fig. 1C). The morphology of conidia present on symptomatic rhizomes was similar to the Fusarium conidia that have been previously described19,20. The average firmness of symptomatic rhizomes decreased to an unmeasurable level (soft rot) over 12 days of cultivated at 25 °C. In contrast, the average initial firmness of rhizomes in the asymptomatic group was 150 N. The surface of these rhizomes began to brown over the course of storage; however, no hyphae were visible on the surface of asymptomatic rhizomes. The average firmness of asymptomatic rhizomes decreased to 7 N over the course of 12 days of cultivated at 25 °C (Fig. 1D). The concentration of Fusarium conidia could not be determined under an optical microscope in either group (symptomatic and asymptomatic). However, the average concentration of Fusarium conidia in asymptomatic and symptomatic determined after culturing the rhizomes for 12 days was 1.400 × 106 spores/g and 6.200 × 105 spores/g, respectively. In fact, the number of conidia obtained from asymptomatic rhizomes was significantly lower than the number obtained from symptomatic rhizomes beginning at 4 days of incubation and remained significantly lower throughout the remaining period of incubation (Fig. 1E).

Fig. 1: Ginger rhizome rot and Fusarium.
figure 1

A Asymptomatic ginger rhizome with no obvious symptoms of Fusarium rot after 12 days of incubation. B Symptomatic ginger rhizomes with evidence of Fusarium rot after 12 days of incubation. C Morphology of Fusarium conidia present on the surface of symptomatic ginger rhizomes. D Increase in the number of conidia obtained from asymptomatic and symptomatic ginger rhizomes during 12 days of incubation. E Changes in the level of firmness in asymptomatic and symptomatic ginger rhizomes during 12 days of incubation. Data represent the mean ± standard error (n = 3). Asterisks indicate a significant difference between asymptomatic and symptomatic rhizomes at *p < 0.05, **p < 0.01, and ***p < 0.001.

Full size image

Causal agent of ginger rhizome rot

Diseased rhizome tissues were cultured on PDA to isolate the causal pathogen of ginger rhizome rot. Obtained isolates were successfully cultured and purified. The mycelium of a purified colony was white on the top surface and pink underneath. The colony was prosenchymatic in appearance and flocculent after 7 days of culture. Conidia were sickle-shaped with several septa that were clearly visible. Most were 3-5 septate (Fig. 2B, C). The morphology of the purified isolate was similar to the morphology of an isolate of Fusarium previously described19. Thus, the present isolate was tentatively designated as Fusarium19,20. For precise identification and classification, internal transcribed spacer (ITS) sequences were analyzed. A BLAST search of the isolate’s ITS sequences against the NCBI database confirmed the isolates to be F. oxysporum (99.4% sequence similarity) and F. solani (99.8% sequence similarity), respectively (Fig. 2).

Fig. 2: Isolation and identification of the causal agent of ginger rhizome rot.
figure 2

A Phylogenetic analysis of ITS sequence obtained from diseased ginger rhizomes with other ITS sequences of Fusarium species and other related species. Isolate obtained from diseased ginger rhizomes is indicated in red font. B, C F. oxysporum (B) and F. solani (C) colony upper side (upper-left), underside (lower-left), and conidia (right) of the same colony cultured on PDA medium for 7 days at 25 °C.

Full size image

Pathogenicity assay

The isolation and purification of pathogens from diseased rhizomes led to the identification of two species: F. oxysporum and F. solani. Cultures of these fungi were prepared, and inoculations were conducted using a concentration of 106 spores/ml on asymptomatic ginger rhizomes. Over time, post-inoculation observations revealed progressive waterlogging within the sub-surface tissues of the ginger rhizomes, accompanied by the proliferation of dense white mycelium (Fig. 3A). Microscopic examination of this mycelium disclosed characteristic sickle-shaped conidia, confirming the growth of Fusarium conidia from the white hyphae associated with the observed surface symptoms (Fig. 3B, C). To rigorously assess the pathogenicity of both F. oxysporum and F. solani on ginger seedlings, a study was conducted using tissue-cultured sterile ginger seedlings planted in soil inoculated with fungal spores. The experiment monitored disease incidence and severity over time. Chlorosis symptoms appeared on the leaves after 7 days, followed by significant yellowing and wilting of the seedlings by the 14th day (Fig. 4A). The results indicated that the disease incidence was 4.17% in seedlings planted in field soil without inoculation, whereas it was 60.42% for F. oxysporum and 93.75% for F. solani inoculated soils (Fig. 4B). Disease severity scores were 2.08 for the control group, 36.81 for F. oxysporum treatment, and 57.64 for F. solani treatment, highlighting the substantial impact of these pathogens on ginger health and growth (Fig. 4C). These findings emphasize the aggressive nature of these Fusarium species towards ginger seedlings and provide critical information for the development of management strategies against Fusarium diseases in ginger cultivation.

Fig. 3: Reproduction and pathogenicity of F. oxysporum and F. solani in tubers.
figure 3

A Representative photographs before and 7 days after inoculation with sterile water, F. oxysporum, and F. solani. B, C Microscopic pictures of the conidia of F. oxysporum (B) and F. solani (C).

Full size image
Fig. 4: Pathogenicity of F. oxysporum and F. solani infected histocultured seedlings.
figure 4

A Representative photographs of pre-infection (Healthy seedlings), sterile water (Control), F. oxysporum, and F. solani infection for 14 days. B, C Disease incidence (B) and disease index (C) of histocultured seedlings infected with sterile water (Control), F. oxysporum and F. solani at 14 days. Data represent the mean ± standard error (n = 3). Asterisks indicate a significant difference between asymptomatic and symptomatic rhizomes at *p < 0.05, **p < 0.01, and ***p < 0.001.

Full size image

Fusarium wilt in the field

Fusarium wilt resulted in injury to ginger rhizomes, stems, and leaves. Shoots and leaves arising from new adventitious buds that were infected were stunted, wilted, and chlorotic (Fig. 5A–C). Older leaves were the first to become chlorotic and this progressed to younger leaves as the disease progressed until the entire plant was wilted. Disease incidence and the disease index of whole plants in the designated plots gradually increased as the growing season progressed (Fig. 5D, E). During the entire study period, the number of Fusarium conidia obtained from rhizome, stem, and leaf tissues in symptomatic plants was significantly higher than the number obtained from the same tissues in asymptomatic plants (Fig. 6A). The number of Fusarium conidia, however, increased with time in all three organs (rhizome, stem, and leaves) in both symptomatic and asymptomatic plants (Fig. 6B–D).

Fig. 5: Progression of Fusarium wilt in ginger plants during the growing season. Overwintered rhizomes were planted in February.
figure 5

A Development of new adventitious buds. B Fusarium wilt on ginger seedlings on shoots arising from new adventitious buds at 30 days after rhizomes were planted. C Fusarium wilt on ginger seedlings on shoots arising from new adventitious buds at 60 days after rhizomes were planted. D, E Increase in Fusarium disease incidence (D) and disease index (E) in ginger plants during the growing season.

Full size image
Fig. 6: Number of Fusarium conidia in asymptomatic and symptomatic ginger plants during the first 21 days of active growth in the field.
figure 6

A Asymptomatic and symptomatic ginger plants. B–D The number of Fusarium conidia obtained from asymptomatic and symptomatic rhizomes (B), stems (C), and leaves (D) during the first 21 days of active plant growth in the field.

Full size image

Comparison of fungal community structure in different tissues of asymptomatic and symptomatic ginger plants

The application of ITS amplicon sequencing to asymptomatic and symptomatic rhizome, stem, and leaf samples yielded a comprehensive dataset of 1,190,550 high-quality sequences, with an average sequence length of 223.26 nucleotides. The sequences were then accurately assigned to ASVs based on a rigorous similarity threshold of > 97%, ensuring precise taxonomic classification. Despite no significant differences in microbiota diversity at the genus level between asymptomatic and symptomatic rhizomes, profound distinctions were observed in stems and leaves. Specifically, a statistically significant difference (p < 0.001) was evident in stem microbiota diversity between asymptomatic and symptomatic samples. Similarly, a significant difference (p < 0.05) was noted in leaf microbiota diversity (Fig. 7A). Upon taxonomic assignment of the ASVs, the top ten most abundant genera were identified, with Fusarium dominating (>50%) alongside Cutaneotrichosporon, Sporobolomyces, Cladosporium, Alternaria, Penicillium, Candida, Apiotrichum, Gibberella, and Epicoccum (Fig. 6B and Table 1). Notably, significant differences (p < 0.01) were observed in the abundance of the top 15 genera across all sample groups, including asymptomatic and symptomatic rhizomes, stems, and leaves. Notably, the differences between Cutaneotrichosporon and Gibberella were highly significant (p < 0.001), indicating distinct ecological roles or responses to environmental conditions (Fig. 7C). Moreover, in-depth analysis of the samples, correlating them with specific species, revealed that Fusarium fungus emerged as the predominant species in each sample group, regardless of asymptomatic or symptomatic status (Fig. 7D). This finding underscores the significance of Fusarium in shaping the microbiota communities of ginger organs and suggests its potential role in disease development or resistance mechanisms.

Fig. 7: Fungal species composition in asymptomatic and symptomatic ginger rhizomes, stems, and leaves.
figure 7

Rhizomes were planted in February and ginger plants (including rhizomes) were harvested in May. Results represent the number of ASVs assigned to each taxon based on ITS amplicon sequencing of the different sample groups. RH and RD represent asymptomatic and symptomatic rhizomes, respectively. SH and SD represent asymptomatic and symptomatic stems, respectively. LH and LD represent asymptomatic and symptomatic leaves, respectively. A Shannon evenness index in the different sample groups. B Abundance of fungal genera in the different sample groups. C Histogram of multi-species difference analysis. D Circos diagram of genera relationships in the different sample groups.

Full size image
Table 1 Fungal genera with the highest abundance of ASVs in both asymptomatic and symptomatic ginger rhizome, stem, and leaf tissues
Full size table

Network analysis of fungal communities in ginger tissues

A species correlation network was constructed by determining the correlation between the presence and abundance of different fungal species. The complexity of the species correlation network varied among the different sample groups, with the simplest network observed in leaves, followed by rhizomes and stems (Fig. 8). Interestingly, Fusarium did not exhibit interactions with other fungal species in asymptomatic rhizomes but exhibited an antagonism to Cutaneotrichosporon in symptomatic rhizomes (Fig. 8D). Fusarium did exhibit interactions with other fungal species in both asymptomatic and symptomatic stem tissues. In asymptomatic stem tissues, Fusarium exhibited an antagonistic interaction with Plectosphaerella and a synergistic interaction with Rhodotorula (Fig. 7B). In symptomatic stem tissues Fusarium exhibited an antagonistic interaction with Candida and Gibberella (Fig. 8E). Notably, no species interactions were observed in either symptomatic or asymptomatic leaves (Fig. 8F). These results suggest that the main interactions involving Fusarium with other fungal species occur in rhizomes and stems, with a greater number of fungal species interacting with Fusarium in more complex communities. Furthermore, interaction relationships appear to be stronger in symptomatic tissues than in asymptomatic tissues (Fig. 8B, D, E). Additional insights into ginger infection with Fusarium and its impact on changes in the composition and complexity of endophytic fungi would further enhance our understanding of the pathogenic process.

Fig. 8: Co-occurrence relationships of species in the different sample groups.
figure 8

A–C represent the co-occurrence relationships of the fungus in roots (A), stems (B), and leaves (C) of the asymptomatic group. D–F represents the co-occurrence relationships of the fungus in roots (D), stems (E), and leaves (F) of the symptomatic group. The size of the nodes represents the abundance of species, with distinct colors indicating different species. The color of the connections indicates the nature of the correlation, with red indicating a positive correlation and green indicating a negative correlation. The greater number of lines connecting a species indicates stronger relationships with other species.

Full size image

Discussion

As early as 1964, Trujillo reported that Fusarium wilt was the most destructive disease in ginger production in Hawaii, with large areas of occurrence and increasing transmission21. Infected plants were stunted and chlorotic, and leaves became successively wilted from the oldest to the youngest as the disease progressed, eventually resulting in the death of the entire plant. Underground rhizomes were also infected. Infected rhizomes exhibited brown lesions on their surface, and infected rhizomes were vulnerable to temperature changes during storage that would induce them to rot. Although asymptomatic rhizomes did not exhibit decay, they developed disease symptoms when rhizomes were replanted the following year and developed adventitious buds. This was attributed to the presence of Fusarium (hyphae and conidia) in the asymptomatic rhizomes, similar to a latent infection. Once the replanted rhizomes began to actively grow the disease would also become active and cause lesions on the rhizomes and spread to newly developed stems and leaves. The size of the region infected with Fusarium wilt and rhizome rot gradually expanded and significant numbers of hectares were taken out of production14,17,18. This explains why Fusarium conidia were observed in both asymptomatic and symptomatic ginger rhizomes in our present study (Fig. 1). However, conidia were also detected in both asymptomatic and symptomatic rhizomes, stems, and leaves in the field (Fig. 5). Notably, the number of Fusarium conidia increased as the severity of the disease increased in ginger plants.

F. oxysporum and F. solani were isolated from diseased rhizomes in our study and inoculation experiments confirmed that F. oxysporum and F. solani could cause ginger rhizome rot. White mycelia were visible on the surface of infected rhizomes. Disease symptoms were consistent with the disease symptoms observed in overwintering ginger rhizomes in storage (Fig. 1A) and a previous study of disease symptoms in ginger rhizomes in storage17.

Results of the ITS amplicon sequencing conducted in the present study indicated that there were no significant differences in the Alpha diversity of fungal communities of mature asymptomatic and symptomatic ginger rhizomes. In contrast, the diversity of the fungal community in asymptomatic and symptomatic stem tissues was extremely different. The diversity of fungal communities in asymptomatic and symptomatic leaves was also significantly different. The abundance of Fusarium sp. in all organs (rhizomes, stems, and leaves) was >50%. The ten most abundant ASVs in all organs were Fusarium, Cutaneotrichosporon, Sporobolomyces, Cladosporium, Alternaria, Penicillium, Candida, Apiotrichum, Gibberella, and Epicoccum. Our results revealed that the Ascomycota community was the dominant community in ginger tissues and that Fusarium was the most abundant genus in each tissue. Previous research reports have indicated that the onset of disease can induce the reassembly and functional adaptation of the plant-associated microbiome22. For example, Fusarium was the most abundant fungal genus in both healthy and diseased pepper tissues, while Diaporthe, Fusarium, Phomopsis, Plectosphaerella, Stemphylium, and Cryptococcus were the dominant fungi in the root and stem tissues of peppers with symptoms of Fusarium wilt23. Fusarium, Alternaria, and Colletotrichum are the main fungal pathogens of potatoes in storage. In this regard, Ascomycota was reported to be the dominant fungal phylum in symptomatic and asymptomatic groups of potato tubers during storage24. Fusarium was also the most abundant fungal genus in stored oat seeds. More specifically, Fusarium, Aspergillus, Alternaria, and Epicoccum were the dominant fungal genera identified during the harvesting and storage of oat seeds. They were also important causal factors in the decline of oat seed quality25. F. oxysporum is the primary causal agent of Fusarium wilt in bananas. Notably, F. oxysporum and its related species are also the main fungal species found in healthy banana tissues26. Interestingly, among the ten most abundant ASVs, the genus Gibberella, characterized as the sexual stage of Fusarium27, was identified. Gibberella has been recognized as a key pathogen responsible for damaging crops such as wheat, maize, rice, and potato28. Furthermore, it is recognized as a soil-borne agent responsible for causing Gibberella stalk rot29 and Gibberella ear rot in maize30. G. fujikuroi is distinguished as a significant pathogen of bakanae disease, which is spread through seed and soil transmission31. Both Fusarium and Gibberella genera were found to predominate in the soil of fields under consecutive monoculture of ginseng over a period of six years32. These genera were also detected in soil samples from successive cultivations of Panax ginseng33. Several studies have demonstrated that Fusarium species, including its teleomorph stage, Gibberella28,30,31,32, can persist asymptomatically within plant tissues. These dormant pathogens may induce diseases when environmental conditions are conducive and predisposing factors are present.

Results of the interaction analysis of the fungal community conducted in the present study indicated that Fusarium exhibits a few negative correlations with other fungi in both asymptomatic and symptomatic tissue, but also several positive interactions. Previous studies have also found that Fusarium, as an endophytic fungus, positively interacts with other fungi including Ascomycota, Basidiomycota, Oomycota, Mortierellomycota, and Mucoromycota34,35. Fusarium, as a soil-borne pathogen, is the causal agent of disease in several crops3,8 and the prevalence of Fusarium disease is positively correlated with the abundance of Fusarium propagules in the soil36. Previous studies have also demonstrated that Fusarium can be isolated from above-ground plant tissues37 and can inhabit plant xylem tissues38. Given that Fusarium sp. can inhabit plant tissues as well as the soil39, both seed-borne and soil-borne sources of infection should be considered as potential primary inoculum sources for Fusarium wilt. The present study focused on Fusarium wilt of ginger caused by the Fusarium present in both asymptomatic and symptomatic ginger tissues. Our previous study also demonstrated that Fusarium can increase and accumulate in soils that are under continuous production of ginger40. In conclusion, it appears that mature rhizomes and soil infected with Fusarium (e.g., F. oxysporum and F. solani) are the main inoculum sources causing Fusarium wilt, the most destructive disease affecting ginger production in China.

Methods

Plant material

The Zhugen cultivar of ginger plants (Zingiber officinale Roscoe) used in this study is widely cultivated in the Sichuan, Chongqing, and other regions of southwest China. Mature rhizomes, developed over approximately 270 days, were harvested in mid-November from the Yongchuan Ginger Resource Garden of Chongqing Crop Germplasm (106.03°E, 29.11°N), stored over the winter, and then replanted in the following growing season in late February. The experimental design followed the protocol reported in our previous study41. Briefly, the stored rhizomes were washed with clean water, air-dried, and then divided into two groups. Rhizomes with epidermal surfaces without obvious symptoms of infection were considered to be the asymptomatic group, while rhizomes with epidermal surfaces that appeared watery, brown, or shrunken were considered to be the symptomatic group. Rhizomes in each group (symptomatic and asymptomatic) weighed approximately 50 g each, and each group contained 40 rhizomes amounting to about 2.0 kg. The rhizomes were again washed with clean water, soaked in 1% NaClO for 5 min, air dried, and then planted in a sterile peat substrate (Klasmann-Deilmann, Germany) and placed at 25 °C and 70% relative humidity for approximately one month to allow for adventitious bud formation. Each group comprised three biological replicates. 5 Rhizomes were randomly taken out from both the asymptomatic and symptomatic groups every two days to detect the firmness of the rhizomes using a Digital fruit firmness tester (GY-4-J, Zhejiang Top Cloud Agriculture Technology Co., Ltd, China). After that, the number of conidia was also assessed from destructive rhizome tissues.

Isolation and identification of F. oxysporum and F. solani

Symptomatic rhizomes were surface sterilized in 2% (v/v) sodium hypochlorite for 2 min, rinsed with sterile water three times, and then air-dried. Then a 3 × 3 mm portion of symptomatic tissue was cultured on Potato Dextrose Agar (PDA) medium containing ampicillin 100 μg/ml at 25 °C for 3 days. Single colonies were successively cultured on PDA plates three times to obtain a pure culture. Subsequently, the obtained purified strain was cultured at 25 °C for 5 days, to obtain approximately 0.05 g of mycelia. Genomic DNA was isolated from these mycelia using an E.Z.N.A.® Soil DNA Extraction Kit (Omega Bio-Tek). The extracted DNA was then amplified using the primer set ITS1: (5’TCCGTAGGTGAACCTGCGG3’), ITS4: (5’TCCTCCGCTTATTGATATGC3’). The reaction mixture comprised 10 μl of DreamTaq Green PCR Master Mix (2X), which includes DreamTaq polymerase, DreamTaq polymerase buffer, dNTPs and 4 mM MgCl2 (K1082, ThermoScientific, Vilnius, Lithuania), Additionally, it contained 1 μl upstream primer (10 μM), 1 μl downstream primer (10 uM), 7 μl ddH2O, and 1 μl DNA (500 ng/μl). The PCR reaction was performed after thorough mixing. The PCR protocol was as follows: pre-denaturation (94 °C, 5 min), denaturation (94 °C 30 s), annealing (ITS1, ITS4 annealing at 57 °C), extension (72 °C, 1 min) for 30 cycles, final extension (72 °C, 5 min). Using agarose gel electrophoresis to distinguish and assess the quality of PCR products. The amplified products were then sequenced by Tsingke Biotechnology Co., Ltd. The obtained ITS sequences were then subjected to BLAST analysis against sequence data in the National Center for Biotechnology Information (NCBI) database (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Sequences with high similarity (>= 97%) were downloaded and further compared using ClustalW42. MEGA-X43 was used to construct an evolutionary tree and iTOL44 was used to display the evolutionary tree. The morphology of mycelia and conidia was also examined with a microscope and recorded.

Pathogenicity of F. oxysporum and F. solani

Pathogenicity tests were conducted as previously described11. F. oxysporum and F. solani were cultured on PDA medium at 25 °C for 5 days and spores were eluted from the cultures by flooding the plates with 2 ml of sterile distilled water. The eluate was then collected and filtered through several layers of cheesecloth to remove mycelial debris. The obtained spore suspension was then adjusted to a concentration of 106 spores/ml with the aid of a hemocytometer. Asymptomatic ginger rhizomes, cultivated for approximately 270 days and harvested in the middle of November from Yongchuan Ginger Resource Garden of Chongqing Crop Germplasm (106.03。E, 29.11。N), were washed 3 times with clean water to remove any soil residue. The rhizomes were then cut into two pieces and their surface was abraded randomly 2–3 three times by a sterile scalpel blade. The rhizome pieces were disinfected by soaking them in 1% sodium hypochlorite for 5 min, followed by rinsing with sterile water 3 times, and air drying. Each prepared rhizome piece was then inoculated with 200 μl of spore suspension. The assay utilized 15 rhizomes and was repeated three times. The inoculated rhizomes were then incubated at 25 °C and 70% relative humidity and investigated disease symptoms every day. l

Field soil previously planted with the crop was used as a planted matrix to assess the pathogenicity of F. oxysporum and F. solani on ginger seedlings. 6 kilograms of filed soil was put into a nursery tray (43 cm×45 cm). The prepared spores were inoculated into field soil at a concentration of 106 spores/Kg. Sterile water-inoculated field soil served as the control group. The soils were then cultivated for 7 days. After being developed for 30 days, tissue culture sterile ginger seedlings were transferred to a greenhouse and continued cultivated for 5 days. Subsequently, 16 tissue-cultured seedlings were transplanted into each inoculated soil and the treatment was repeated three times. Meanwhile, the disease incidence and disease severity index (DSI) were evaluated. The disease incidence was calculated by the formula of IC = n/N × 100, where IC = incidence; n = number of diseased seedlings; and N = total number of seedlings. The disease severity of wilt caused by F. oxysporum and F. solani on seedlings was measured. Disease severity was determined according to the following equation: disease severity index (DSI)[∑ (number of decay fruit at each level × representative value of each level)/(total number of fruit surveyed × representative value of the highest level)] × 100. Seedlings wilt is classified into three grades, where 0 indicates no disease symptoms of seedlings, 1 indicates partial leaves chlorosis, 2 indicates whole seedlings chlorosis, and 3 indicates whole seedlings wilt.

Investigation of Fusarium wilt during ginger development

This portion of the study was conducted on a farm located in Panlong Town, Rongchang District, China (107.16。E, 30.14。N), a traditional area of ginger production. The plot used in this study had been continuously used for ginger production for 12 years, and the soil was known to be contaminated with Fusarium sp40. Rhizomes are sown every year in mid-February after the soil temperature has reached 10 °C and the replanted rhizomes are harvested in late July. The plots remain fallow from August to December every year. A total of 750 kg of nitrogen (N), phosphorus(P), and potassium (K) fertilizer (15N-15P-15K, Guizhou Xiyang Industrial Co., Ltd, China) was applied per hectare to the soil in January 2022. The soil in the plot was subjected to rotary tillage to a depth of 45–50 cm after the fertilizer was applied. The experimental area used in the study was about 667 m2, and this amount of area was replicated three times. The overwintered ginger rhizomes were planted in the test plots on February 16, 2022. The rows of planted rhizomes were covered with polyethylene film. Adventitious buds were allowed to develop on the covered rhizomes from February 24 to April 6, 2022.

Disease incidence and disease severity of ginger wilt in plots were assessed from April through June as described in our previous study40. Assessment of disease incidence and severity were conducted on April 14, April 29, May 15, May 30, and June 12, 2022. Disease incidence for Fusarium wilt was calculated using the following formula: IC = ( / ) × 100; where IC = incidence; n = number of diseased ginger plants; and N = total number of investigated plants. Disease severity was determined according to the following equation: disease severity index (DSI) = 100 × ∑ (number of diseased plants at all levels × representative values at all levels)/(total number of investigated plants × highest representative value). Fusarium wilt was classified into five grades, where Level 0 is no disease symptoms on ginger leaves; 1 indicates a wilting symptom on 0 to 25% of the leaves, 2 indicates wilting symptoms on 25% to 50% of the leaves, 3 indicates wilting symptoms on 50% to 75%, of the leaves, and 4 indicates wilting symptoms on 75% to 100% of the leaves. Wilted stems were automatically assigned the highest disease grade. Symptomatic and asymptomatic ginger plants were harvested and brought back to the laboratory on May 15, May 30, and June 12, 2022. The rhizomes, stems, and leaves of both symptomatic and asymptomatic plants representing different developmental stages were used to assess the concentration of Fusarium conidia in each type of organ.

Comparison of fungal community structure in symptomatic and asymptomatic tissues

Ginger rhizome, stem, and leaf tissues of ginger from symptomatic and asymptomatic plants were harvested on May 15, 2022, and sent to Shanghai Meiji Biomedical Technology Co., Ltd. For DNA extraction and ITS amplicon sequencing. The ITS primers used were ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC). The sequenced amplicons were analyzed on the cloud platform (https://login.majorbio.com/login) through access provided by Meiji Biomedical Technology Co., Ltd. The raw data was assembled and subjected to quality control using Qiime software45. The DADA246 algorithm was used to cluster the amplicon sequence variants (ASVs) using a similarity requirement >97%. The species assignment of an ASV was retained when the number of ASV sequences was ≥5 in at least 3 samples, and the total number of ASV sequences was >20. ASVs that aligned with Chloroplast and Mitochondrial sequences were removed. ASV sequences were annotated using RDP classifier software47. Unite v9.0 (http://unite.ut.ee/index.php) was used for the classification of fungal communities. Alpha diversity and Beta diversity analyses of the annotated species were conducted using Mthur48 and R v4.0.2 software. Co-occurrence network analysis was used to reveal the association of different fungal taxa. The established biologically relevant networks were analyzed using the complex network analysis toolkit Networkx49, which calculates the node degree distribution, network diameter, average shortest path through the network, and attributes such as node connectivity (degree), closeness centrality, and betweenness centrality. Cystoscape50 was used to display the results of correlation and network analysis.

Statistical analysis

Statistical analyses were conducted using the R programming language, version 4.0.3, and the ggplot2 package (version 3.3.2) for data visualization. The Student t-test was employed to evaluate significant differences between samples. A p-value threshold of less than 0.05 was established to determine statistical significance.

Reporting summary

Further information on research design is available in the Nature Research Reporting Summary linked to this article.