Abstract
Somatic alterations in the oncogenic kinase AKT1 have been identified in a broad spectrum of solid tumours. The most common AKT1 alteration replaces Glu17 with Lys (E17K) in the regulatory pleckstrin homology domain1, resulting in constitutive membrane localization and activation of oncogenic signalling. In clinical studies, pan-AKT inhibitors have been found to cause dose-limiting hyperglycaemia2,3,4,5,6, which has motivated the search for mutant-selective inhibitors. We exploited the E17K mutation to design allosteric, lysine-targeted salicylaldehyde inhibitors with selectivity for AKT1 (E17K) over wild-type AKT paralogues, a major challenge given the presence of three conserved lysines near the allosteric site. Crystallographic analysis of the covalent inhibitor complex unexpectedly revealed an adventitious tetrahedral zinc ion that coordinates two proximal cysteines in the kinase activation loop while simultaneously engaging the E17K–imine conjugate. The salicylaldimine complex with AKT1 (E17K), but not that with wild-type AKT1, recruits endogenous Zn2+ in cells, resulting in sustained inhibition. A salicylaldehyde-based inhibitor was efficacious in AKT1 (E17K) tumour xenograft models at doses that did not induce hyperglycaemia. Our study demonstrates the potential to achieve exquisite residence-time-based selectivity for AKT1 (E17K) by targeting the mutant lysine together with Zn2+ chelation by the resulting salicylaldimine adduct.
This is a preview of subscription content, access via your institution
Access options
Access Nature and 54 other Nature Portfolio journals
Get Nature+, our best-value online-access subscription
$32.99 / 30 days
cancel any time
Subscribe to this journal
Receive 51 print issues and online access
$199.00 per year
only $3.90 per issue
Buy this article
- Purchase on SpringerLink
- Instant access to full article PDF
Prices may be subject to local taxes which are calculated during checkout
Similar content being viewed by others
Data availability
The reported crystal structures have been deposited in the PDB with accession numbers 8UVY, 8UW2, 8UW7, 8UW9 and 9C1W. The raw proteomic data have been deposited to MassIVE with accession number MSV000093542, including the Homo sapiens reviewed Swiss-Prot FASTA database file used for searches. Source data are provided with this paper. Statistical tests, descriptive statistics and associated graphical data are included in source data files.
References
Carpten, J. D. et al. A transforming mutation in the pleckstrin homology domain of AKT1 in cancer. Nature 448, 439–444 (2007).
Hyman, D. M. et al. AKT inhibition in solid tumors with AKT1 mutations. J. Clin. Oncol. 35, 2251–2259 (2017).
Kalinsky, K. et al. Effect of capivasertib in patients with an AKT1 E17K-mutated tumor. JAMA Oncol. 7, 271 (2021).
Kalinsky, K. et al. Ipatasertib in patients with tumors with AKT mutations: results from the NCI-MATCH ECOG-ACRIN trial (EAY131) sub-protocol Z1K. Eur. J. Cancer 174, S8–S9 (2022).
Smyth, L. M. et al. Capivasertib, an AKT kinase inhibitor, as monotherapy or in combination with fulvestrant in patients with AKT1 E17K-mutant, ER-positive metastatic breast cancer. Clin. Cancer Res. 26, 3947–3957 (2020).
Banerji, U. et al. A phase I open-label study to identify a dosing regimen of the pan-AKT inhibitor AZD5363 for evaluation in solid tumors and in PIK3CA-mutated breast and gynecologic cancers. Clin. Cancer Res. 24, 2050–2059 (2018).
Truebestein, L. et al. Structure of autoinhibited Akt1 reveals mechanism of PIP3-mediated activation. Proc. Natl Acad. Sci. USA 118, e2101496118 (2021).
Lučić, I. et al. Conformational sampling of membranes by Akt controls its activation and inactivation. Proc. Natl Acad. Sci. USA 115, E3940–E3949 (2018).
Hoxhaj, G. & Manning, B. D. The PI3K–AKT network at the interface of oncogenic signalling and cancer metabolism. Nat. Rev. Cancer 20, 74–88 (2020).
Landgraf, K. E., Pilling, C. & Falke, J. J. Molecular mechanism of an oncogenic mutation that alters membrane targeting: Glu17Lys modifies the PIP lipid specificity of the AKT1 PH domain. Biochemistry 47, 12260–12269 (2008).
Bae, H. et al. PH domain-mediated autoinhibition and oncogenic activation of Akt. eLife 11, e80148 (2022).
Rudolph, M. et al. AKT1E17K mutation profiling in breast cancer: prevalence, concurrent oncogenic alterations, and blood-based detection. BMC Cancer 16, 622 (2016).
Cohen, Y. et al. AKT1 pleckstrin homology domain E17K activating mutation in endometrial carcinoma. Gynecol. Oncol. 116, 88–91 (2010).
Yesilöz, Ü. et al. Frequent AKT1E17K mutations in skull base meningiomas are associated with mTOR and ERK1/2 activation and reduced time to tumor recurrence. Neuro. Oncol. 19, 1088–1096 (2017).
Clark, V. E. et al. Genomic analysis of non-NF2 meningiomas reveals mutations in TRAF7, KLF4, AKT1, and SMO. Science 339, 1077–1080 (2013).
Varkaris, A. et al. Allosteric PI3Kα inhibition overcomes on-target resistance to orthosteric inhibitors mediated by secondary PIK3CA mutations. Cancer Discov. https://doi.org/10.1158/2159-8290.CD-23-0704 (2023).
Lindhurst, M. J. et al. Ubiquitous expression of Akt1 p.(E17K) results in vascular defects and embryonic lethality in mice. Hum. Mol. Genet. 29, 3350–3360 (2020).
Lindhurst, M. J. et al. A mosaic activating mutation in AKT1 associated with the proteus syndrome. N. Engl. J. Med. 365, 611 (2011).
Turner, N. C. et al. Capivasertib in hormone receptor-positive advanced breast cancer. N. Engl. J. Med. 388, 2058–2070 (2023).
Cho, H. et al. Insulin resistance and a diabetes mellitus-like syndrome in mice lacking the protein kinase Akt2 (PKBβ). Science 292, 1728–1731 (2001).
Dummler, B. et al. Life with a single isoform of Akt: mice lacking Akt2 and Akt3 are viable but display impaired glucose homeostasis and growth deficiencies. Mol. Cell. Biol. 26, 8042–8051 (2006).
George, S. et al. A family with severe insulin resistance and diabetes due to a mutation in AKT2. Science 304, 1325–1328 (2004).
Cho, H., Thorvaldsen, J. L., Chu, Q., Feng, F. & Birnbaum, M. J. Akt1/PKBα is required for normal growth but dispensable for maintenance of glucose homeostasis in mice. J. Biol. Chem. 276, 38349–38352 (2001).
Buzzi, F. et al. Differential effects of protein kinase B/Akt isoforms on glucose homeostasis and islet mass. Mol. Cell. Biol. 30, 601–612 (2010).
Chen, W. S. et al. Growth retardation and increased apoptosis in mice with homozygous disruption of the akt1 gene. Genes Dev. 15, 2203–2208 (2001).
Ostrem, J. M., Peters, U., Sos, M. L., Wells, J. A. & Shokat, K. M. K-Ras(G12C) inhibitors allosterically control GTP affinity and effector interactions. Nature 503, 548–551 (2013).
Skoulidis, F. et al. Sotorasib for lung cancers with KRAS p.G12C mutation. N. Engl. J. Med. 384, 2371–2381 (2021).
Jänne, P. A. et al. Adagrasib in non-small-cell lung cancer harboring a KRASG12C mutation. N. Engl. J. Med. 387, 120–131 (2022).
Lapierre, J. M. et al. Discovery of 3-(3-(4-(1-aminocyclobutyl)phenyl)-5-phenyl-3H-imidazo[4,5-b]pyridin-2-yl)pyridin-2-amine (ARQ 092): an orally bioavailable, selective, and potent allosteric AKT inhibitor. J. Med. Chem. 59, 6455–6469 (2016).
Yu, Y. et al. Targeting AKT1-E17K and the PI3K/AKT pathway with an allosteric AKT inhibitor, ARQ 092. PLoS ONE 10, e0140479 (2015).
Molina, D. M. et al. Monitoring drug target engagement in cells and tissues using the cellular thermal shift assay. Science 341, 84–87 (2013).
Parker, C. G. & Pratt, M. R. Click chemistry in proteomic investigations. Cell 180, 605–632 (2020).
Haffner, M. C. et al. Phenotypic characterization of two novel cell line models of castration‐resistant prostate cancer. Prostate 81, 1159–1171 (2021).
Sangai, T. et al. Biomarkers of response to Akt inhibitor MK-2206 in breast cancer. Clin. Cancer Res. 18, 5816–5828 (2012).
Aoki, M., Batista, O., Bellacosa, A., Tsichlis, P. & Vogt, P. K. The Akt kinase: molecular determinants of oncogenicity. Proc. Natl. Acad. Sci. USA 95, 14950–14955 (1998).
Kovacina, K. S. et al. Identification of a proline-rich Akt substrate as a 14-3-3 binding partner. J. Biol. Chem. 278, 10189–10194 (2003).
Oshiro, N. et al. The proline-rich Akt substrate of 40 kDa (PRAS40) is a physiological substrate of mammalian target of rapamycin complex 1. J. Biol. Chem. 282, 20329–20339 (2007).
Vasta, J. D. et al. Quantitative, wide-spectrum kinase profiling in live cells for assessing the effect of cellular ATP on target engagement. Cell Chem. Biol. 25, 206–214 (2018).
Tamames, B., Sousa, S. F., Tamames, J., Fernandes, P. A. & Ramos, M. J. Analysis of zinc-ligand bond lengths in metalloproteins: trends and patterns. Proteins 69, 466–475 (2007).
Leussing, D. L. & Leach, B. E. Stabilities, rates of formation, and rates of transimination in aqueous solutions of some zinc(II)-Schiff base complexes derived from salicylaldehyde. J. Am. Chem. Soc. 93, 3377–3384 (1971).
Laitaoja, M., Valjakka, J. & Jänis, J. Zinc coordination spheres in protein structures. Inorg. Chem. 52, 10983–10991 (2013).
Bruyneel, W., Charette, J. J. & De Hoffmann, E. Kinetics of hydrolysis of hydroxy and methoxy derivatives of N-benzylidene-2-aminopropane. J. Am. Chem. Soc. 88, 3808–3813 (1966).
Arslan, P., Di Virgilio, F., Beltrame, M., Tsien, R. Y. & Pozzan, T. Cytosolic Ca2+ homeostasis in Ehrlich and Yoshida carcinomas. A new, membrane-permeant chelator of heavy metals reveals that these ascites tumor cell lines have normal cytosolic free Ca2+. J. Biol. Chem. 260, 2719–2727 (1985).
Cuesta, A. & Taunton, J. Lysine-targeted inhibitors and chemoproteomic probes. Annu. Rev. Biochem. 88, 365–381 (2019).
Yang, T. et al. Reversible lysine-targeted probes reveal residence time-based kinase selectivity. Nat. Chem. Biol. 18, 934–941 (2022).
Katz, B. A. et al. Design of potent selective zinc-mediated serine protease inhibitors. Nature 391, 608–612 (1998).
Liu, W. et al. Lactate regulates cell cycle by remodelling the anaphase promoting complex. Nature 616, 790–797 (2023).
Oksenberg, D. et al. GBT440 increases haemoglobin oxygen affinity, reduces sickling and prolongs RBC half-life in a murine model of sickle cell disease. Br. J. Haematol. 175, 141–153 (2016).
Vichinsky, E. et al. A phase 3 randomized trial of voxelotor in sickle cell disease. N. Engl. J. Med. 381, 509–519 (2019).
Kong, A. T., Leprevost, F. V., Avtonomov, D. M., Mellacheruvu, D. & Nesvizhskii, A. I. MSFragger: ultrafast and comprehensive peptide identification in mass spectrometry–based proteomics. Nat. Methods 14, 513–520 (2017).
Yu, F., Haynes, S. E. & Nesvizhskii, A. I. IonQuant enables accurate and sensitive label-free quantification with FDR-controlled match-between-runs. Mol. Cell. Proteomics 20, 100077 (2021).
Gibson, D. G. et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods 6, 343–345 (2009).
Cox, J. & Mann, M. MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification. Nat. Biotechnol. 26, 1367–1372 (2008).
Davies, B. R. et al. Tumors with AKT1E17K mutations are rational targets for single agent or combination therapy with AKT inhibitors. Mol. Cancer Ther. 14, 2441–2451 (2015).
Kabsch, W. XDS. Acta Crystallogr. Sect. D: Biol. Crystallogr. 66, 125–132 (2010).
Evans, P. R. & Murshudov, G. N. How good are my data and what is the resolution? Acta Crystallogr. Sect. D: Biol. Crystallogr. 69, 1204–1214 (2013).
McCoy, A. J. et al. Phaser crystallographic software. J. Appl. Crystallogr. 40, 658–674 (2007).
Emsley, P., Lohkamp, B., Scott, W. G. & Cowtan, K. Features and development of Coot. Acta Crystallogr. Sect. D: Biol. Crystallogr. 66, 486–501 (2010).
Adams, P. D. et al. PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallogr. Sect. D: Biol. Crystallogr. 66, 213–221 (2010).
Winter, G. xia2: an expert system for macromolecular crystallography data reduction. J. Appl. Crystallogr. 43, 186–190 (2010).
Acknowledgements
Funding for this study was provided by the Ono Pharma Foundation (J.T.), the Tobacco-Related Disease Research Program Postdoctoral Fellowship Award (T32FT4880 to G.B.C.) and Terremoto Biosciences. We thank the UCSF Preclinical Therapeutics Core and V. Steri for research assistance and M. Haffner (FHCC) for providing the LAPC4-CR cells. ICP-MS measurements were performed by the Oregon Health & Science University Elemental Analysis Core with partial support from the US National Institutes of Health (NIH) (S10OD028492). The Berkeley Center for Structural Biology is supported by the Howard Hughes Medical Institute, participating research team members and the NIH National Institute of General Medical Sciences, ALS-ENABLE grant P30 GM124169. The Advanced Light Source is a Department of Energy Office of Science User Facility under contract no. DE-AC02-05CH11231. The Pilatus detector on beamline 2.0.1 was funded under NIH grant S10OD021832. Beamline 8.3.1 is supported with NIH grants (R01 GM124149 and P30 GM124169).
Author information
Authors and Affiliations
Contributions
G.B.C. and J.T. conceived the project, analysed data and wrote the paper. G.B.C. designed, performed and analysed biochemical, cellular, chemoproteomic and X-ray crystallographic experiments. G.B.C., H. Chu. and H. Chen designed, synthesized and characterized the compounds. J.D.S., B.C., S.D. and W.K. designed, performed and analysed in vivo experiments. X.M. designed and analysed X-ray crystallographic experiments. J.D.C. designed and analysed nanoBRET experiments. Y.C., A.D.Z., K.S.Y., S.H.R, J.R.L. and P.A.T. assisted with data analysis and provided key scientific input.
Corresponding author
Ethics declarations
Competing interests
H. Chu., J.D.S., J.D.C., B.C., X.M., S.D., W.K., A.D.Z., K.S.Y., S.H.R., P.A.T. and J.R.L. are current or former employees of Terremoto Biosciences. J.T. is a cofounder of Kezar Life Sciences and Terremoto Biosciences and is a scientific advisor to Iambic Therapeutics. J.T., G.B.C., S.H.R., K.S.Y., H.C., J.D.C. and P.A.T. are inventors on a patent application filed by the University of California and Terremoto Biosciences (WO2023168291A1). The remaining authors declare no competing interests.
Peer review
Peer review information
Nature thanks Elena De Vita, Derek Lowe and the other, anonymous reviewer(s) for their contribution to the peer review of this work.
Additional information
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Extended data figures and tables
Extended Data Fig. 1 Additional in vitro characterization of compound 3.
a, Deconvoluted intact-protein mass spectra of AKT2(WT) (1 µM) treated with vehicle or 1–3 (5 µM, 37 °C, 15 min) and then reduced with NaBH4 (10 mM, 5 min). b, Dissociation of preformed AKT2(WT)-ligand complexes (1 µM AKT2(WT), 5 µM ligand) was initiated by the addition of excess ARQ092 (50 µM) with continuous incubation at 37 °C. At the indicated time points, the percentage of covalently modified AKT2(WT) was determined by intact-protein MS after quenching with NaBH4 (10 mM, 5 min). Duplicate measurements for each time point were plotted, and dissociation half-times were determined using an exponential decay function. Kinetics of AKT1 dissociation are reproduced from Fig. 1d. c, The melting temperature (Tm) of AKT2(WT) (2 µM) treated with DMSO, 3 (10 µM), or ARQ092 (10 µM) was assessed by differential scanning fluorimetry (DSF, mean ± s.d., n = 3). ΔTm was calculated relative to the DMSO control (mean ± s.d.). Apparently missing errors bars indicate that the error is too small to be visualized. Data for AKT1 are reproduced from Fig. 1e. d, IC50 values from biochemical AKT kinase activity assays (10 μM ATP, radioisotope filter binding, 10-pt dose response, Reaction Biology). e, Modified site identification by tryptic LC-MS/MS. Purified recombinant AKT1(E17K) or AKT1(WT) (f), was treated with compound 3 (4 µM, 15 min) and reduced with NaBH4 (5 mM). The sample was reduced with DTT, alkylated with iodoacetamide and then digested with trypsin. The tryptic peptides were analysed by LC-MS/MS and modified sites identified using MSFragger. The modified sites with the greatest MS1 intensity were Lys17 for AKT1(E17K) (e) and Lys297 for AKT1(WT) (f). The annotated MS2 spectra with b- and y-ions for the relevant modified peptides are shown.
Extended Data Fig. 2 Dot blot images and CETSA data related to Fig. 2.
a, Dot blot images related to Fig. 2a. b, Dot blot images related to Extended Data Fig. 2c. c, Cellular thermal shift assay (CETSA) data reproduced from Fig. 2a with the addition of AKT2(WT) data. Melting temperatures (Tm) were determined by sigmoidal regression analysis (n = 3). ΔTm was calculated relative to the DMSO control for each protein (mean ± s.d.). Apparently missing errors bars indicate that the error is too small to be visualized.
Extended Data Fig. 3 In-gel fluorescence data related to Fig. 2.
a, Crystal structure of ARQ092 (grey) with AKT1(WT) (green) (PBD: 5kcv) illustrating the solvent-exposed vector that informed the design of 3-alkyne. b, BEAS-2B cells (FLAG-AKT1(E17K), FLAG-AKT1(WT) or FLAG-AKT2(WT)) were treated with 3-alkyne (2 µM) for 0, 5, 10, 30, 60 or 120 min. After cell lysis and reduction with NaBH4 (10 mM), the labelled proteins were conjugated to TAMRA-azide and visualized by in-gel fluorescence. c, In-gel fluorescence images related to Fig. 2d. d, In-gel fluorescence images related to Fig. 2e. Replicate 1 is shown in Fig. 2e. e, BEAS-2B cells (FLAG-AKT1(E17K) or FLAG-AKT1(WT)), were treated with increasing concentrations of 3-alkyne for 10 or 60 min. The cells were lysed and reduced with NaBH4 (10 mM). The labelled proteins were conjugated to TAMRA-azide and visualized by in-gel fluorescence. f, Normalized in-gel fluorescence data reproduced from Fig. 2d (6 h dose-response, n = 3) with the addition of the 10 and 60 min dose responses (n = 1) from Extended Data Fig. 3e. Apparently missing errors bars indicate that the error is too small to be visualized. The experiments in (b-d) were performed twice with similar results. The experiment in (e) was performed once.
Extended Data Fig. 4 AKT1(WT/E17K) selectivity in LAPC4-CR cells and tumors.
LAPC4-CR AKT1(WT/E17K) zygosity determination (a) and (b). a, Sequencing of AKT1 exon2 amplicon derived from LAPC4-CR gDNA. Amplicon primers: f = TGACCTCTAACTGTGGACGC; r = CAAGGGGATACTTACGCGCC. Sequencing primer = TCGCTGGCCCTAAGAAACAG. b, Sequencing of AKT1 transcript amplicon derived from LAPC4-CR cDNA. Amplicon primers: f = ATGGACAGGGAGAGCAAACG; r = ACAGGTGGAAGAACAGCTCG. Sequencing primer = TGCATCAGAGGCTGTGGCCAG. c, LAPC4-CR tumor bearing mice were dosed with vehicle or 3-alkyne (30 mg kg–1, IP injection) (n = 4). Tumors were harvested after 4 h and lysed. Tumor lysate was reduced with NaBH4 (10 µM), and conjugated with biotin-picolyl-azide. Biotinylated proteins were pulled down with neutravidin agarose, eluted, and analyzed by immunoblotting. d, LAPC4-CR cells were transduced with empty vector, AKT1(WT) or myrAKT1(WT) and selected with puromycin. Transduced cells were treated with the indicated concentrations of ARQ092, compound 3 or 4 for 72 h, and cell viability was determined by the Alamar Blue assay. Data (mean ± s.d., n = 4) were fitted with sigmoidal regression. Apparently missing errors bars indicate that the error is too small to be visualized. e, Transduced LAPC4-CR cells relating to (d) were lysed and analyzed by immunoblotting for FLAG, tAKT1, pAKT1S473 and pPRAS40T246 (loading control: GAPDH). This experiment was performed twice with similar results.
Extended Data Fig. 5 Inhibition of AKT signaling in cancer cells, related to Fig. 3d.
a, LAPC4-CR, HBCx-2, SkBr3 and MCF7 cells were treated with increasing concentrations of ARQ092 or compound 3 for 2 h, lysed, and analyzed by immunoblotting for pAKT1S473, pPRAS40T246, pS6RPS235/236, pGSK3βS9 (loading controls: tAKT1, tPRAS40, tS6RP, tGSK3β and GAPDH). b, Washout of compound 3 in LAPC4-CR and SkBr3 cells. LAPC4-CR or SkBr3 cells were treated with 2 µM compound 3 for 2 h. The media was aspirated and replaced with compound-free media. After 0, 0.5, 2, 7, or 24 h, the cells were lysed and then probed for pAKT1S473 and pPRAS40T246 by immunoblotting (loading controls: tAKT1, tPRAS40, GAPDH). c, The pPRAS40 signal (b) was normalized to the DMSO control and fitted with an exponential regression. The experiments in (a, b) were performed twice with similar results.
Extended Data Fig. 6 In vitro and in vivo characterization of compound 4.
a, The melting temperature (Tm) of AKT1(E17K), AKT1(WT) and AKT2(WT) (2 µM) treated with DMSO or 4 (10 µM) was assessed by differential scanning fluorimetry (DSF, mean ± s.d., n = 3). Apparently missing errors bars indicate that the error is too small to be visualized. b, Dissociation of the preformed complex of AKT1(E17K), AKT1(WT) or AKT2(WT) (1 µM) bound to compound 4 (5 µM) was initiated by the addition of excess ARQ092 (50 µM) with continuous incubation at 37 °C. The percentage of modified AKT at the indicated time points was determined by intact-protein mass spectrometry after quenching aliquots with NaBH4 (10 mM, 5 min). Duplicate measurements for each time point were plotted, and dissociation half-times were determined using an exponential decay function Dissociation kinetics were determined using an exponential decay function. c, Pharmacokinetic data for compounds 3 and 4 (mean, n = 3). d, Target engagement of full-length AKT1(E17K), AKT1(WT), and AKT2(WT) fused to NanoLuc was determined in HEK293 cells using the NanoBRET assay kit (Promega). IC50s were calculated by sigmoidal regression and presented as the geometric mean. e, Cell viability EC50s (72 h incubation) for compound 4 and ARQ092 in LAPC4-CR, HBCx-2, SkBr3 and MCF7 cells. f, Athymic male nude mice (nu/nu) bearing LAPC4-CR-derived xenografts were dosed with vehicle or 40 mg kg–1 compound 4 by IP injection (n = 4). Euthanasia was performed 2, 7, or 24 h after dosing with compound 4 (vehicle = 2 h) and tumors were collected, homogenized, and analyzed by immunoblotting (loading controls: tAKT1, tPRAS40, GAPDH). g, Tumor pAKT1 intensities were determined by immunoblotting (f) and normalized to the mean intensity from vehicle-treated mice. Data are mean ± s.d., n = 4.
Extended Data Fig. 7 Further in vivo characterization of compound 4.
a, Individual growth curves of LAPC4-CR xenografts related to Fig. 4a. LAPC4-CR tumor-bearing mice (athymic nu/nu) were randomized to vehicle (n = 10) or compound 4 treatment groups (30 mg kg–1, BID, IP, n = 12). b, Individual tumor growth curves (a) were integrated (AUC, mm3) over the 18 day study. Vehicle, n = 10; compound 4, n = 12 (mean ± s.e.m.). Student’s t-test (two-tailed, unpaired, parametric) was used to calculate the P value without adjustments for multiple comparison tests. c, Percentage change in mouse body weights during the LAPC4-CR tumor growth inhibition study. Vehicle, n = 10; compound 4, n = 12 (mean ± s.e.m.). d, LAPC4-CR tumor-bearing mice (athymic nu/nu) were randomized to vehicle or ARQ092 treatment groups (100 mg kg–1, PO, QD), n = 10. Tumor volumes (mean ± s.e.m.) and body weights (mean ± s.e.m.) were measured on the indicated days. The humane endpoint was 20% body weight loss and the ARQ092 arm was terminated when 50% of the animals in the group reached this threshold. e, Percentage change in mouse body weights during the HBCx-2 tumor growth inhibition study (see Fig. 4c). n = 8, mean ± s.e.m., ns = not significant. Adjusted P values were calculated for the final day measurements relative to the vehicle using an ordinary one-way ANOVA with Dunnett’s multiple comparison test. f, BT-474 tumor-bearing mice (athymic nude) were randomized to vethicle (BID, IP injection), compound 4 (30 mg kg–1, BID, IP injection), ARQ092 (100 mg kg–1, QD, PO) or capivasertib (150 mg kg–1, BID, PO) treatment groups (n = 10). Tumor volumes (mean ± s.e.m) were measured on the indicated days. Adjusted P values were calculated for the final day measurements relative to the vehicle using an ordinary one-way ANOVA with Dunnett’s multiple comparison test. g, Percentage change in mouse body weights during the BT-474 tumor growth inhibition study. n = 10, mean ± s.e.m. Adjusted P values were calculated for the final day measurements relative to the vehicle using an ordinary one-way ANOVA with Dunnett’s multiple comparison test. Apparently missing errors bars indicate that the error is too small to be visualized.
Extended Data Fig. 8 Supplementary crystal structures and electron density maps.
a, Ligand electron density map (2Fo-Fc, 1.0 σ) for AKT1(E17K)–3 cocrystallized without added Zn2+. b, Ligand electron density map (2Fo-Fc, 1.0 σ) for AKT1(E17K)–3 with added ZnSO4 (2 equiv). c, Cocrystal structure of AKT1(E17K) bound to salicylaldehyde 4 (grey) at 1.9 Å resolution. Yellow dashes, hydrogen bonds; orange dashes, π-stacking; black dashes, Zn2+-chelate interactions. d, Ligand electron density map (2Fo-Fc, 1.0 σ) for AKT1(E17K)–4. e, Ligand electron density map (2Fo-Fc, 1.0 σ) for AKT1(E17K) labelled with iodoacetamide and cocrystallized with compound 3 (Zn2+-free). f, Ligand electron density map (2Fo-Fc, 1.0 σ) for AKT1(WT)–3. g, Cocrystal structure of AKT2(WT) bound to salicylaldehyde 3 (grey) at 2.0 Å resolution. Yellow dashes, hydrogen bonds; orange dashes, π-stacking. h, Ligand electron density map (2Fo-Fc, 1.0 σ) for AKT2(WT)–3.
Extended Data Fig. 9 Crystallographic data and effect of Zn2+ on thermal stability.
a, Crystallographic data collection and refinement statistics. b, Purified WT or mutant AKT1 (2 µM) was treated with DMSO or compound 3 (10 µM) in the presence or absence of ZnSO4 (10 µM) for 15 min. Thermal stability (melting temperature, Tm) was assessed by differential scanning fluorimetry (mean ± s.d., n = 3). Apparently missing errors bars indicate that the error is too small to be visualized.
Extended Data Fig. 10 Further characterization of Zn2+ binding in cells.
a, CETSA data related to Fig. 5e. BEAS-2B cells stably expressing FLAG-AKT1(E17K or E17K/C296A/C310A) were treated for 3 h with compound 3 (2 µM) and DMSO or TPEN (10 µM). Thermal stability of FLAG-AKT1 was determined by CETSA with three biological replicates. After treatment with compounds, cells were heat-challenged at the indicated temperatures for 3 min and lysed. Levels of soluble FLAG-AKT1 were determined by dot blot (Biological replicates 1 and 2: plotted as mean ± s.d., three technical replicates. Biological replicate 3: plotted as mean ± s.d., two technical replicates). Apparently missing errors bars indicate that the error is too small to be visualized. Melt temperatures (Tm) were determined by sigmoidal regression analysis. b, BEAS-2B cells stably expressing FLAG-AKT1(E17K) or AKT1(E17K/C296A/C310A) were treated with DMSO or 2 µM compound 3 for 2 h (n = 4). The cells were washed with PBS, lysed, and incubated with anti-FLAG agarose beads for 1 h at 4 °C. The agarose resin was washed 6 times and then FLAG-AKT1 was eluted from the beads with 3xFLAG peptide. Samples were incubated with Chelex 100 resin (15 min), filtered, and concentrated to 57 µL by spin filtration. Samples were analysed by SDS-PAGE with Flamingo dye staining and in-gel fluorescence. Equal volumes of the immunopurified FLAG-AKT1 samples and dilutions of purified recombinant AKT1(E17K) were loaded on the gel. The extrapolated concentrations of immunopurified and eluted FLAG-AKT1 were used to estimate the molar equivalents of transition metals quantified by ICP-MS analysis (Fig. 5f).
Supplementary information
Supplementary Information
Synthetic methods, chemical characterization and 1H NMR spectra.
Supplementary Figure 1
Uncropped gels and western blots.
Supplementary Table 1
Related to Fig. 3b. Proteins identified after neutravidin pull-down from LAPC4-CR cells treated with vehicle or 3-alkyne.
Rights and permissions
Springer Nature or its licensor (e.g. a society or other partner) holds exclusive rights to this article under a publishing agreement with the author(s) or other rightsholder(s); author self-archiving of the accepted manuscript version of this article is solely governed by the terms of such publishing agreement and applicable law.
About this article
Cite this article
Craven, G.B., Chu, H., Sun, J.D. et al. Mutant-selective AKT inhibition through lysine targeting and neo-zinc chelation. Nature 637, 205–214 (2025). https://doi.org/10.1038/s41586-024-08176-4
Received:
Accepted:
Published:
Issue date:
DOI: https://doi.org/10.1038/s41586-024-08176-4
This article is cited by
-
Targeting Mutant Protein Kinase B with Lysine-Selective Salicylaldehyde Inhibitors and Zn2⁺ Chelation: A Novel Therapeutic Strategy
Molecular Biomedicine (2025)
-
Covalent inhibitor engages oncogenic AKT kinase
Nature Reviews Drug Discovery (2025)
-
Selective targeting of the AKT1 (E17K) mutation: advances in precision oncology and therapeutic design
Discover Oncology (2025)
-
AKT kinases as therapeutic targets
Journal of Experimental & Clinical Cancer Research (2024)
