Introduction

Blunt force trauma (BFT) refers to injury of the body by forceful impacts such as falls, motor vehicle crashes and collisions. It is expected that BFT will become the third largest contributor to the burden of disease with 46,980 deaths and 5.4 million injuries caused by motor vehicle crashes in 2021 alone1,2. A significant adverse outcome of BFT is internal injuries. It is estimated that at least 65% of all severe trauma cases involve vital organs such as the liver, kidneys, heart and lungs, necessitating urgent medical intervention and potentially causing long-term complications or even life-threatening situations3,4. Liver rupture, for example, often caused by a direct impact on the abdomen at specific velocities and energies and can be caused by non-penetrating impact5, can lead to severe blood loss, shock, and immediate death6,7. Patients of acute kidney injury, with 80-90% from blunt impact8, experience long-term risk of developing fibrosis and chronic kidney disease9,10,11,12,13. Blunt cardiac injuries, ranging from clinically silent, transient arrhythmias to fatal rupture14, are related to 75% of traumatized patients and significantly increase the risks of thoracic and intra-abdominal injuries15,16. Lung contusion, usually resulting from blunt trauma17, affects 17-25% of adult BFT patients and leads to increased risks of pneumonia, severe acute lung injury, and acute respiratory distress syndrome18. Therefore, there is a critical need to develop effective personal protection devices to prevent and reduce severe blunt-force injury to biological tissues.

Solid hollow structures including stochastic and periodic foams are widely used in energy absorption devices for non-penetrating injuries in automotive, aerospace, packing, contact sports, and military applications19,20,21,22,23. Foams have attractive physical and mechanical properties including extremely lightweight, large deformability and easy fabrication. The main energy mitigation mechanism of foams is based on the permanent deformation including bending, buckling, and stretching of the cellular structures. When the foam structure is crushed, the externally applied energy is dissipated into heat.

While these materials are highly effective as cushioning in packages and protection devices of infrastructures, the protection of biological tissues from non-penetrating BFT remains a unique challenge. This is mainly attributed to their insufficient energy mitigation efficiency considering the dissimilar properties between the foams and biological tissues. The optimal working pressure for biotissue protection is determined to be at the order of 1 MPa24. At this working pressure, the energy mitigation efficiency of foam materials is around 0.5 J/g, which is at the lower end of their mitigation capabilities and has been associated with BFT-induced medical implications25,26,27,28,29.

To address the unique working pressure for biotissues, we have designed a novel liquid nanofoam (LN) for efficient energy absorption for non-penetrating BFT30,31,32,33. The LN is a liquid suspension of hydrophobic nanoporous particles (NpPs) in a non-wettable liquid. At ambient condition, the liquid molecules cannot enter the empty nanopores contained by the NpPs due to the energy barrier at the interface of the liquid and the nanopore surface. When an external force is applied on the LN, hydrostatic pressure increases in the liquid. Once the pressure surpasses a critical threshold, named as the infiltration pressure of LN, the potential energy stored in the liquid molecules is high enough to overcome the surface energy barrier. Consequently, the liquid molecules flow into the nanopores and the potential energy carried by them is dissipated as heat. This infiltration process leads to an extremely high energy efficiency, up to 100 J/g, which is 10 times higher than the energy absorption efficiency of solid foam-based protection materials34.

The unique property of high energy mitigation efficiency and fluid-like nature raises the possibility of using LN to protect biological tissues from blunt force trauma. To test this possibility, we investigated the biocompatibility of LN using human culture cells. In addition, we analyzed the protective efficiency of LN on both cultured cells and whole animal organs. Our study revealed that LN is compatible with growing, cultured human cells. In addition, the LN demonstrated significant and substantial protection of multiple biological tissues from quasi-static compressions. This research suggests the potential of LN as a novel and effective energy-absorbing medium for the protection of biological tissues from BFT.

Results

Infiltration behavior of LN-containing cell culture medium

Under quasi-static loading, the initial response of the LN is purely elastic as the system internal pressure is insufficient to overcome the energy barrier at the liquid and nanopore interface (Fig. 1a, b). When the internal hydrostatic pressure reaches Pin, the liquid molecules start to infiltrate into the nanopores. As the liquid molecules continuously flow into the nanopores, a pressure-plateau is observed. The width of the pressure-plateau is defined as the total liquid infiltration volume, Vin. The measured value, 1.8 cm3/g is close to but smaller than the total porosity of the NpPs. Due to their large porosity, these NpPs start to deform at extremely low pressure, even before the liquid infiltration process initiates31. When the system internal pressure reaches Pin, the liquid infiltration process of the LN is activated. Because the liquid molecules flow into the nanopores at a faster rate than the deformation of the NpPs, the remaining nanopore volume is accessible for liquid flow and no further deformation of the NpPs is allowed31.

Fig. 1
figure 1

Liquid nanofoam schematic (a) and its typical infiltration behavior with DI water (b) and effect of cell culture medium on liquid infiltration, demonstrated by (c) individual components of the 293T cell culture medium, (d) complete 293T cell culture medium, PBMC medium and Stem cell medium.

Full size image

Once the nanopores are fully filled by the liquid molecules, the system internal pressure increases again at the rate similar to that during the initial elastic response of LN. With the removal of the externally applied force, the internal hydrostatic pressure drops immediately and then gradually decreases to zero. The pressure associated with the unloading process is much lower than the loading one. The liquid molecules flow into the nanopores may or may not flow out from the nanopores during the unloading process35,36,37,38. The area enclosed in the loading-unloading curve of the LN (shaded area in Fig. 1b) represents the volumetric energy mitigation efficiency of the LN.

To apply the LN material to biological systems, we first tested whether the fluid used in cell culture had any effect on liquid infiltration. We observed that the infiltration behavior of LN was not changed with addition of individual components of the 293T cell culture medium or complete culture media (Fig. 1c, d). In addition, the infiltration behavior of the LN was independent from the mass ratio between NpPs and liquid (Supplementary Fig. S1). These results confirm that the surface tension of the cell culture media is similar to the value of DI water, consistent with published findings39.

Biocompatbility of LN

To study the biocompatibility of LN, we focused on the 293T cell line. This cell line was used because it is the most widely used cell line as a model for biological and biomedical research40. As a commonly used human cell line, the 293T cell line can be reliably propagated in vitro and its genetic and epigenetic compositions have been thoroughly characterized40,41,42,43,44. We cultured 293T cells with LN at different NpP -cell culture medium ratios (0, 0.03 g/mL, 0.05 g/mL and 0.1 g/mL). These particle-to-liquid ratios were chosen to match the LN samples used for the protection of cells and whole organs. We observed no adverse effect on cell viability with this range of NpP-liquid ratios during three days of culture (Fig. S2a). In addition, long-term culture of cells over nine days showed no reduction in viability with 0.05 g/mL NpP-liquid ratio, a ratio subsequently used for all samples (Fig. S2b). Mock treatment (i.e. no additional treatment) was used as negative control of the study. These results verify that NpP exhibits biocompatibility with human culture cells. The.

LN protection of cells under low energy loading

Before the internal system pressure reaches Pin, the energy mitigation mechanism, i.e. liquid infiltration, is not activated for the LN. Therefore, it is necessary to validate that at the onset of the liquid infiltration, cells are not damaged by external loading. To this end, we conducted a series of compression tests on LN and live cells under low energy loading. We subjected 293T cells to 0.26 J over the sample area of 286 mm2 in the presence or absence of NpPs. Compression test without NpPs was used as positive control of the study. Post-compression, we observed cell morphology by confocal microscopy and found populations of live (round cells with intact membrane), dead (cell debris with ruptured membrane) and deformed (cells with changed shape in response to the external force45,46,47,48,49) cells (Fig. 2). The deformed cells were identified as those whose shortest dimension was equal to or smaller than 90% of its longest dimension. These observations were confirmed with Trypan Blue staining (Fig. S3).

Fig. 2
figure 2

Representative confocal microscopy images of cells under low energy loading. Under low energy loading without NpPs protection, 74% of cells were viable with intact membranes. Within the viable population, 80.3% exhibited a circular morphology consistent with a healthy status (left) and 19.7% exhibited deformed morphology representing compromised health (right). 26% cells were dead and burst (middle). NpPs addition significantly increased the percentage of healthy cells and decreased the percentages of unhealthy and dead cells under loading.

Full size image

The addition of NpPs significantly increased cells that remained viable post compression from 74 to 100% (Fig. 3a). In addition, NpP addition decreased the percentage of deformed cells by 80% (Fig. 3b). These results suggest that the LN acts as a buffer against cellular damage induced by external energy, safeguarding cellular integrity. The energy mitigation mechanism is not based on the nanoscale liquid flow as the lower energy loading cannot trigger liquid infiltration. This is due to the special physical properties of the NpPs used in this study. As shown in the liquid infiltration test, 10% of the nanopores are crushed at extremely low pressure to dissipate energy. Although this mechanism holds similarity to conventional foams, a solid-based foam does not exhibit additional energy mitigation capacity for higher energy loadings as the energy mitigation capacity is predetermined by the low working pressure of the solid-based foam. In next section, the high energy mitigation capacity of the LN based on the unique liquid infiltration mechanism will be demonstrated.

Fig. 3
figure 3

Protective effect of LN on living cells under low energy loading. (a) Quantification of cell viability with or without nanoporous particles. (b) Quantification of deformed cells with or without nanoporous particles. *, P < 0.05, Student’s t-test.

Full size image

In addition to gross-morphology and cell viability, external force may cause gene expression changes. To test this possibility, we measured the expression levels of the c-Fos, which is known to orchestrate target gene expression in response to cellular stress50,51,52,53. As expected, energy loading significantly increased the expression level of c-Fos. Notably, the presence of NpPs in the LN system significantly reduced the upregulation of c-Fos, demonstrating the protective effect of LN (Fig. 4a).

Fig. 4
figure 4

Regulatory effect of LN on stress gene expression in living cells under low energy loading. Relative expression levels of (a) c-FOS, (b) IL-1b. *P < 0.05, Student’s t-test.

Full size image

Given that blunt force trauma causes long-term inflammation in its associated chronic comorbidities, we also measured the expression levels of IL-1b, a potent pro-inflammatory cytokine54,55,56. Energy loading upregulated the expression levels of IL-1b, which again was effectively attenuated by the LN system (Fig. 4b). As a negative control, energy loading did not alter the expression level of the housekeeping gene GAPDH (Fig. S4). Collectively, these results suggest that low energy loading leads to stress and inflammatory responses that can be effectively mitigated by LN.

LN protection of cells under high energy loading

The high energy loading condition was set to 0.78 J over the sample area of 286 mm2. This was the total energy needed to complete the liquid infiltration process of the selected LN, which was calculated based on the testing curves shown in Fig. 1. Under high energy loading, we observed a significant protective effect of LN on 293T cells in both viability and deformability (Fig. 5). The addition of NpPs increased cell viability from 67 to 100% and decreased the percentage of deformed cells by 90%. Furthermore, LN protected cells from upregulation of stress and pro-inflammatory genes (Fig. 6). The presence of NpPs reduced the upregulation of c-Fos and IL-1b by 82% and 89%, respectively. These results demonstrate that the nanoscale liquid flow of LN can significantly reduce cellular damage under high energy impacts.

Fig. 5
figure 5

Protective effect of LN on living cells under high energy loading. (a) Quantification of cell viability with or without nanoporous particles. (b) Quantification of deformed cells with or without nanoporous particles. *P < 0.05, Student’s t-test.

Full size image
Fig. 6
figure 6

Regulatory effect of LN on stress gene expression in living cells under high energy loading. Relative expression levels of (a) c-FOS, (b) IL-1b *P < 0.05, Student’s t-test.

Full size image

When the external input energy was increased from 0.26 J (low energy loading) to 0.78 J (high energy loading), cells under direct compression without the protection of LN showed reduction in cell viability and increase in deformation as well as increase in expression of stress response and inflammatory genes. LN effectively mitigated these cellular and molecular damages at both low and high energy loading conditions with an energy mitigation efficiency of 2.6 J/g and 7.8 J/g, respectively. The energy mitigation efficiency of the LN based on the nanoscale liquid flow mechanism was 3 times of the value associated with the permanent deformation of the NpPs. In addition, the LN significantly reduced the upregulation of c-Fos and IL-1b, which is known to associate with multiple BFT-comorbidities57,58,59,60.

LN protection of whole organs under compression

Given the protective effect of LN on cultured cells, we further tested whether LN protected whole animal organs from mechanical loading. LN composed of 0.25 g NpPs and 1.5 mL 39% LiCl aqueous solution was sealed in a TPU pouch with a diameter of 25.4 mm and a thickness of 6.4 mm (Fig. 7a). The sealing strength was much higher than the loading conditions used for all experiments and no pouch burst was observed. The sealed LN pouch was then stacked with the organ specimen for quasi-static compression tests, with a total external energy of 1.74 J applied over the area of 506 mm2 (Fig. 7b). The energy level was increased based on the larger sample area and the increased amount of NpPs in the pouch. As the LN was not in direct contact with the biotissues, the liquid phase was changed to electrolyte solutions, which increased the working temperature range of LN and satisfied the temperature requirements of protective devices such as football helmets. The liquid infiltration behavior of the LN pouch was similar to that containing DI water. As additional controls, we conducted compression tests with a 22 mm × 23 mm × 6.4 mm expanded polystyrene (EPS) foam (Fig. 7c) using the same experimental setup. The size of the EPS foam sample was exactly the same as the LN pouch. The density of the EPS foam was 1.8 × 103 kg/m3.

Fig. 7
figure 7

Schematic of organ compression tests. (a) A TPU pouch containing LN, (b) Schematic of quasi-static compression test conducted on a mouse organ, and (c) an EPS reference foam with same size of the LN pouch.

Full size image

Similar to the scenario in BFT, mechanical loading caused numerous cracks on the mouse liver under both non-protected or EPS-shielded conditions. On the contrary, the LN pouch almost completely protected mouse liver from tearing (Fig. 8). This finding was further supported by H&E staining of liver (Fig. 9). Quantification of the damage areas showed that the LN pouch reduced the structural damage of the liver by 97%, while the EPS foam only reduced the damage by 53% (Fig. S5).

Fig. 8
figure 8

Protective effect on whole liver by (a) LN pouch and (b) EPS reference foam. For each material, representative images of mouse liver under the uncompressed condition are shown on the left and those under compression are shown on the right. w/o, without. w/, with. LN, liquid nanofoam. EPS, expanded polystyrene.

Full size image
Fig. 9
figure 9

Protective effect of LN on whole liver by H&E staining, 10× magnification. Representative images of H&E staining of mouse liver under uncompressed (a), compressed without protection (b), compressed with LN pouch (c), and compressed with EPS foam (d), with arrows pointing to cracked areas under compression. (e) Quantification of intact areas of mouse liver under the indicated conditions. *P < 0.05, Student’s t-test.

Full size image

We performed the same loading test on additional organs implicated in severe BFT, including the kidney, heart and lungs. As shown in Figs. 10 and 11 and S6, the compressed kidney sample without any protection showed a 41% of crack area, while the additional LN pouch and the EPS foam limited the crack area to 3% and 23%, respectively. Therefore, the LN pouch and the EPS foam reduced the structural damage of the kidney by 93% and 43%, respectively.

Fig. 10
figure 10

Protective effect on whole kidney by (a) LN pouch and (b) EPS foam. For each material, representative images of mouse kidney under the uncompressed condition are shown on the left and those under compression are shown on the right. w/o, without. w/, with. LN, liquid nanofoam. EPS, expanded polystyrene.

Full size image
Fig. 11
figure 11

Protective effect of LN on whole kidney by H&E staining, 10× magnification. Representative images of H&E staining of mouse kidney under uncompressed (a), compressed without protection (b), compressed with LN pouch (c), and compressed with EPS foam (d), with arrows pointing to cracked areas under compression. (e) Quantification of intact areas of mouse liver under the indicated conditions. *P < 0.05, Student’s t-test.

Full size image

As shown in Figs. 12 and 13 and S7, the compressed heart sample exhibited a 32% of crack area without protection, while the LN pouch and the EPS foams had comparative protection efficiency by decreasing the area of damage to 16% and 14%, respectively. This result is consistent with previous finding that the mechanical properties of heart tissues are significantly different from those of other organs61.

Fig. 12
figure 12

Protective effect on whole heart by (a) LN pouch and (b) EPS. For each material, representative images of mouse heart under the uncompressed condition are shown on the left and those under compression are shown on the right. w/o, without. w/, with. LN, liquid nanofoam. EPS, expanded polystyrene.

Full size image
Fig. 13
figure 13

Protective effect of LN on whole heart by H&E staining, 10× magnification. Representative images of H&E staining of mouse heart under uncompressed (a), compressed without protection (b), compressed with LN pouch (c), and compressed with EPS foam (d), with arrows pointing to cracked areas under compression. (e) Quantification of intact areas of mouse liver under the indicated conditions. *P < 0.05, Student’s t-test.

Full size image

As shown in Figs. 14 and 15 and S8, in lungs, BFT caused 29% in crack areas, whereas the application of LN pouch limited damage area to 1% only, corresponding to a reduction of damage by 97%. The EPS foam limited damage area to 19% with a corresponding protection efficiency of 33% only.

Fig. 14
figure 14

Protective effect on whole lungs by (a) LN pouch and (b) EPS. For each material, representative images of mouse lungs under the uncompressed condition are shown on the left and those under compression are shown on the right. w/o, without. w/, with. LN, liquid nanofoam. EPS, expanded polystyrene.

Full size image
Fig. 15
figure 15

Protective effect of LN on whole lung by H&E staining, 10× magnification. Representative images of H&E staining of mouse lung under uncompressed (a), compressed without protection (b), compressed with LN pouch (c), and compressed with EPS foam (d), with arrows pointing to cracked areas under compression. (e) Quantification of intact areas of mouse liver under the indicated conditions. *P < 0.05, Student’s t-test.

Full size image

In summary, in the presence of the LN pouch, the vital organs tested maintained tissue integrity under mechanical compression, suggesting that the liquid infiltration mechanism of the LN has efficiently mitigated the input mechanical energy. The effective prevention of local stress concentration and biotissue damage of LN is likely to be attributed to their unique fluidity. In addition, during the entire compression process, the LN pouch maintained complete contact with the biotissue samples. Therefore, LN can effectively protect vital organs from blunt force-caused damage.

Methods

Infiltration tests of LN

A type of hydrophobic nanoporous silica (Perform-O-Sil 668, Nottingham Corp.), is chosen as the NpPs for this investigation because of the extremely large porosity to maximize the total deformation of the LN system. Initially received in powder form, the average particle size and nanopore diameter of the NpPs are 4 μm and 115 nm, respectively. The LN samples containing 0.10 of NpPs and 2.0 mL liquid are sealed in a stainless-steel (SS316) cylindrical testing chamber by two pistons equipped with o-rings. The cross-sectional area of the testing chamber, A, is 286 mm2. The LN samples are compressed by a universal tester (Model 5982, Instron) at a constant loading rate of 2 mm/min. Once a peak loading force of 3.0 kN is reached, the cross head of the Instron is moved back at the same rate. During all tests, no leakage of liquid is observed.

To ensure the biocompatibility of the LN, various cell growth mediums are selected for sample preparation, including 293T culture medium [Dulbecco’s Modified Eagle’s Medium (DMEM), 10% Fetal Bovine Serum (FBS), 1% antimycotic-antibiotics, and 2mM L-glutamine], PBMC culture medium [Roswell Park Memorial Institute (ROMI-1640) media with 10% FBS, 1% sodium pyruvate, 1% nonessential amino acds, 1% Beta-Mercaptoethanol, 1% L-GLU, 1% p/s] and stem cell culture medium (mTeSR™ Plus Basal Medium and 20% mTeSR™ Plus 5х Supplement). Deionized water is also selected as the liquid phase for the control group.

Quasi-static compression tests on cells and organs covered by LN

The experimental setup is similar to the quasi-static infiltration testing setup of the LN detailed in Fig. 1a. 293T cells (ATCC CRL3216) are seeded onto coverslips (Bellco Glass Inc. Round German Coverslip 12 Mm, #1 Thick) treated with Poly-L-Lysine solution (Sigma Aldrich, CAS-No: 25988-63-0, 0.1% in sterile water) and the experimental setup for cell compression testing parallels the methodology employed for LN infiltration. Coverslips with seeded cells are positioned within a cleaned SS316 testing chamber treated with 70% alcohol. A layer of 0.1 g of NpPs is then added on the surface of the liquid, followed by the insertion of the top piston. The identical setup without NpPs serves as a control group. Post-compression analysis includes an assessment of cell viability via trypan-blue staining and deformation, both with and without NpPs. To ensure the credibility and replicability of results, each specific experimental condition is subjected to triplicate testing.

For compression tests on whole animal organs, LN composed of 0.25 g NpPs and 1.5 mL 39% LiCl aqueous solution was sealed in a TPU pouch with a diameter of 25.4 mm and a thickness of 6.4 mm. The sealed LN pouch was then stacked with various mouse organs harvested from B6 carcasses (Charles River Laboratory CRL 027) for quasi-static compression tests, with a total external energy of 1.74 J applied over the area of 506 mm2.

Cell viability assay

Cells are trypsinized and mixed 1:1 with Trypan blue (Fisher Scientific, Gibco 15250061) following manufacturer instructions. Live and dead cells are counted with the hemocytometer. Viability is calculated as follows:

$$\:\text{V}\text{i}\text{a}\text{b}\text{i}\text{l}\text{i}\text{t}\text{y}\:\left(\text{\%}\right)=\frac{\#\:\text{o}\text{f}\:\text{L}\text{i}\text{v}\text{e}\:\text{C}\text{e}\text{l}\text{l}\text{s}\:}{\#\:\text{o}\text{f}\:\text{L}\text{i}\text{v}\text{e}\:\text{C}\text{e}\text{l}\text{l}\text{s}\:+\:\#\:\text{o}\text{f}\:\text{D}\text{e}\text{a}\text{d}\:\text{C}\text{e}\text{l}\text{l}\text{s}\:}*100\%$$
(1)

Quantitative polymerase chain reaction (qPCR)

Total RNA is isolated using the Purelink RNA Mini Kit, and reverse transcription is performed using the SuperScript IV First-Strand Synthesis System following the manufacturer’s instructions. The qPCR reaction is performed using primers (TCTCTTACTACCACTCACCC and TGGAGTGTATCAGTCAGCTC for c-Fos; CCACAGACCTTCCAGGAGAATG and GTGCAGTTCAGTGATCGTACAGG for IL-1b; and TTGTAGCCCTCTGTGTGCTCAAG and reverse GCCTGACCAAGGAAAGCAAAGTC for GAPDH) with the SYBR Green PCR Master Mix on the QuantStudio 7 Flex Real-Time PCR instrument. The PCR cycling condition is denaturation at 90 °C for 1 min and 40 cycles of 56 °C for 15 s and 72 °C for 2 min. Fold changes in gene expression are calculated with CT (cycle threshold) measurements according to the literature62,63.

Discussion

Current personal protective devices cannot effectively prevent blunt force trauma and there is a need to develop protective materials with new energy mitigation mechanisms64,65. To this end, we have invented the liquid nanofoam system with a novel energy mitigation mechanism based on the nanoscale liquid flow. In addition to a previously unachievable high energy mitigation efficiency, the fluid-like nature of the LN maximizes the integrity of the LN-biotissue interface and engages all NpPs for effective energy mitigation.

While our previous work has demonstrated the mechanical properties of LN, the effects of LN on biological systems remains unknown. This current study advances from our prior work by demonstrating the protective effects of LN on biological systems and providing direct evidence supporting the application of LN in trauma mitigation in humans. Specifically, we have demonstrated the potential of the LN system as a new energy absorbing material for BFT prevention by showing the following characteristics:

Biocompatibility

LN exhibits biocompatibility, maintaining high cell viability with minimal cytotoxicity and adverse effects on gene expression. This biocompatibility is relevant for the biological application of LN because an in vitro cell culture model is needed to ultimately demonstrate the preclinical potential of LN for trauma protection. For example, one needs to demonstrate that the addition of LN can protect gene expression and biological alterations in cells under traumatic conditions. Additionally, in severe-impact scenarios, the LN pouch may burst and consequently skin cells will be exposed to LN. With compromised epithelial barrier, LN will be in direct contact with internal organs and cells as well. The biocompatibility of LN becomes critical in such traumatic conditions.

Protection effectiveness of LN

Our data demonstrates that LN has a protection efficiency of 3.8 J/g gravimetrically and 2.1 J/cm3 volumetrically. In comparison, we tested the protection performance of EPS foam, which is currently used in protective gears against blunt force trauma66,67,68,69,70. Under the same experimental setting and matched material dimensions, the EPS foam shows a protection efficiency of 1.1 J/g gravimetrically and 0.2 g/cm3 volumetrically.

Protection of live cells from loading-induced damage on both the cellular and molecular levels

While mechanical testing demonstrates high effectiveness of LN, one needs to analyze cells and tissues in order to establish the protection efficiency of LN on biological systems. Without LN, external loading causes cell deformation and death. In addition, these mechanical stimuli upregulate stress response and proinflammatory genes mediating trauma and its co-morbidities. For example, of the inflammatory genes we tested in preliminary studies, we have found that mechanical loading upregulated IL1b, a pro-inflammatory cytokine rapidly induced in brain tissue after acute injury and contributing to severe and secondary brain injuries71. Similarly, in our system, compression activated the expression of c-FOS, a marker of post-traumatic stress disorder (PTSD) and a gene known to respond to stress in multiple organs72. LN can effectively protect cells from these loading-induced damages.

Protection of whole organs against force-induced structural alterations

For a range of vital organs commonly damaged in blunt-force trauma, including heart, lung, kidney and liver, LN acts as an effective shield during compression, significantly reducing tissue damage and preserving tissue integrity compared to uncompressed or non-LN protected organs. Intriguingly, different organs exhibit varying sensitivity to loading-induced damage, consistent with known differences in their mechanical properties61,73. This finding suggests a future direction of organ-targeted design of protection materials and devices.

To the best of our knowledge, this is the first non-solid energy mitigation material system that is shown to effectively protect cells and biotissues from mechanical compression. It provides a proof-of-principle design for future development of energy mitigation materials. We envision future studies to apply the LN to the design of helmet liners to address the major challenge of concussion, which affects 2.9 million people every year74. In addition, the incorporation of the LN in passive safety devices on automobiles is expected to significantly enhance the safety of occupants and prevent injuries due to collision. A further application of LN system lies in the development of military personal protective equipment such as body armors.

One limitation of the study is that cell deformation was quantified manually. Future studies should consider the incorporation of comprehensive, computer vision-enhanced analyses methods75,76.

In summary, this study highlights LN’s versatility and compatibility for biomedical applications such as the prevention of blunt force trauma. Given its distinct capability to protect cells and biotissues against mechanical stress, the LN could offer a novel solution to meet the critical needs for effective personal protection devices, such as wearable devices in contact sports and battle fields, and passive safety devices on ground and air vehicles. The protection performance of the LN-functionalized structures can be programed at the structure level, which further increase their adaptability to specific and dynamic requirements.