Introduction

Melanoma, as one of the deadliest types of skin cancer, its malignant progression poses a great threat to human health1. Although early surgical excision is the mainstay of treatment for melanoma, patients with melanoma that has metastasized have poorer outcomes and prognosis1,2. Therefore, exploring new therapeutic approaches is crucial for improving patient prognosis.

In recent years, with the deepening of molecular biology research, the important role of mitochondria in tumor development has been gradually recognized2,3,4,5. Mitochondria are not only the center of cellular energy supply, but also involved in the regulation of cell growth, differentiation and death2,4,6. In particular, aberrant activation of mitochondrial biogenesis has been closely associated with the development of a variety of tumors, including melanoma2,6,7,8,9,10,11. Mitochondrial biogenesis is regulated by a variety of factors that adapt mitochondrial populations to cellular energy demands12. Dysregulation of these factors directly results in altered mitochondrial DNA (mtDNA) expression in tumor cells, leading to cellular metabolic reprogramming and mitochondrial dysfunction13,14. The expression and function of cytosolic-encoded mitochondrial transcription factor A (TFAM), one of the key regulators of mitochondrial biogenesis, has received extensive attention in a wide range of tumors9,12.TFAM increases the number of mitochondria by facilitating the replication and transcription of mtDNA, thereby maintaining a high level of metabolic activity and oxidative phosphorylation in tumor cells15,16, which in turn promoting malignant tumor progression17. Studies have reported that TFAM abnormalities can promote drug resistance and aggressiveness of BRAF inhibitors in melanoma18,19. Therefore, the search for molecules that can inhibit TFAM-mediated mitochondrial biogenesis is clinically important for the treatment of melanoma.

Cysteine-rich protein 1 (CRIP1) belongs to the LIM/double zinc finger protein family. LIM proteins act as DNA-binding transcription factors or facilitate protein-protein interactions20. CRIP1 is a multifunctional cytoskeletal-associated protein, which is aberrantly expressed in a wide range of tumors and is involved in the regulation of tumor cell proliferation, migration and invasion20,21,22. However, the role of CRIP1 in melanoma remains unclear. In this study, we aimed to determine whether CRIP1 is involved in melanoma and to investigate the relationship between CRIP1 and TFAM-mediated mitochondrial biogenesis.

In this study, we found that CRIP1 expression was low in melanoma and correlated with poor patient prognosis. Through in vitro functional assays, CRIP1 was found to inhibit the ability of melanoma cells to proliferate, migrate and invade. Further mechanistic investigations revealed that CRIP1 inhibited TFAM-mediated mitochondrial biogenesis to suppress the proliferation and invasion ability of melanoma cells. Our findings reveal for the first time the inhibitory role of CRIP1 in melanoma development and explore its novel mechanism to suppress tumor malignant progression by regulating mitochondrial biogenesis. These findings not only provide new molecular mechanisms for understanding melanoma development, but also provide new strategies and targets for clinical treatment of melanoma.

Materials and methods

Cell culture

Two human cutaneous melanoma cell lines, including SK-MEL-2 and A375, were obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai). All cells were identified by short tandem repeat (Str) mapping and passaged for less than 6 months after thawing. SK-MEL-2 and A375 cell lines were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (Hyclone, Logan, USA) and 100 μm U/mL penicillin/streptomycin (Gibco) in an incubator at 37 °C and 5% CO2 humidity. SK-MEL-2 cells silencing CRIP1 were cultured with 8 µM rotenone (sigma) and A375 cells silencing CRIP1 with 9 µM rotenone.

Bioinformatics analysis

A total of 472 RNA-seq data and corresponding clinical information of melanoma patients were downloaded from the SKCM project of The Cancer Genome Atlas (TCGA) (Data Release 41.0 - August 28, 2024) ( GDC Data Portal Homepage); those without clinical information were discarded. Finally, a total of 468 clinical messages were available for further analysis of CRIP1 expression in melanoma patients, prognosis, and the relationship between CRIP1 and clinicopathological parameters. Normal skin samples were obtained from the GTEx database. Cluster Profiler version 3.11 package23 was used to analyze GSEA enrichment and visualization. Immunohistochemical image of CRIP1 expression in melanoma tissue from THE HUMAN PROTEIN ATLA database (Expression of CRIP1 in melanoma - The Human Protein Atlas).

RNA extraction and real-time fluorescence quantitative PCR (RT-qPCR)

Total RNA was extracted from cells using Trizol reagent (Invitrogen, Carlsbad, CA). cDNA was reverse transcribed from RNA using a PrimeScript RT kit (Promega, Madison, WI, USA). The preparation and conditions of the RT-qPCR reaction system were carried out according to SYBR PreMix ex Taq benchmark (Takala, Dalian, China). Each experiment was repeated three times, and the relative expression of target genes was expressed as 2-ΔΔCt. The primer sequences used to amplify CRIP1 were 5’- CCTGCCTGAAGTGCGAGAAAT − 3’ (forward) and 5’- CCTTTAGGCCCAAACATGGC − 3’ (reverse). The GAPDH primer sequences were 5’ - GCACCGTCAAGGCTGAGAAC − 3’ (forward) and 5’- TGGTGAAGACGCCAGTGGA − 3’ (reverse).

Western blots analysis (WB)

Cells are lysed with RIPA lysis buffer supplemented with protease inhibitor mixture and PMSF. Lysates are centrifuged at 12,000 g for 30 min and protein concentration is measured by BCA assay (Beyotime Biotechnology, China). Proteins were denatured immediately prior to SDS-PAGE separation and transferred to polyvinylidene fluoride (PVDF) membranes (Pall Corp, Port Washington, NY). After sealing in TBST buffer containing 5% skimmed milk, the membranes were incubated overnight at 4 °C with the indicated primary antibodies. The next day, after washing, the membrane was incubated with the appropriate secondary antibody for 1 h at room temperature. The signal was then detected using enhanced chemiluminescence (Pierce, Rockford, 1 L, USA). Primary antibodies included: anti-CRIP1 (ab183029, Abcam, 1:10,000 dilution); β-tubulin, β-actin (M20045, P30002, Abmart, 1:5000 dilution); ND1, UQCRC2, MTCOX2, ATP5A1, PGC1α, PGC-1β, PRC (19733-1-AP, 14842-1-AP, 55070-1-AP, 14676-1-AP, 66369-1-Ig, 12482-1-AP, 22586-1-AP, Proteintech, 1:1000 dilution), SDHB (ab14714, Abcam, 1:200 dilution); anti-caspase3, anti-Cleaved Caspase3, anti-PARP, anti-Cleaved PARP (1:1000 dilution; CST, USA).

Lentiviral infection

LV-CRIP1 shRNA constructed with hU6-MCS-ubiquitin-firefly-luciferase-IRES-puromycin vector and LV-CRIP1 viral supernatant constructed with Ubi-MCS-SV40-firefly-luciferase-IRES-puromycin vector were infected into SK-MEL-2 and A375 cells according to the manufacturer’s instructions (Gen Chem, Shanghai, China). SK-MEL-2 and A375 cells transfected with LV-CRIP1 shRNA viral supernatant were re-transfected with LV-TFAM shRNA viral supernatant (Gen Chem, Shanghai, China) containing neo gene and TFAM knockdown gene. Selection was then treated with 2 µg/ml puromycin. Proteins and mRNA from transfected cells were extracted for RT-qPCR and Western blots analysis.

Cell proliferation assay

Cells were inoculated into 24-well plates as previously described24 and cultured for 24 h before being assayed using the Edu Proliferation Kit (Beyotime Biotechnology, China). Cells were then fixed, permeabilized and stained according to the manufacturer’s instructions. The cells were observed under a fluorescence microscope.

Colony formation assay

After transfection or treatment, cells were inoculated in 6-well plates (200 cells/well) and cultured for 2 weeks. Fix colonies in 70% methanol and stain with 0.15% crystal violet for 15 min. Count the number of colonies with more than 50 cells.

Cellular wound healing assay

1 × 106 cells were inoculated in 6-well plates. When the confluence of cells reached about 90%, a scratch wound was made with a 10 µl pipette, washed with PBS and incubated with serum-free medium. The wounds were observed and photographed under a microscope at 0 h and 72 h, respectively. The ability of cells to migrate was quantified by measuring the cell migration distance in three randomly selected fields of view at each time point, as described previously25.

Transwell invasion assay

The upper chamber of the Transwell is pre-coated with Matrigel. 2 × 105 cells suspended in serum-free medium are placed in the upper compartment of 8 μm pore size Transwells and 10% serum-containing DMEM complete medium is added to the lower compartment. After 24–36 h of incubation, the samples were fixed in 4% paraformaldehyde for 20 min and stained with 0.1% crystal violet for 15 min. Count and photograph the infiltrating cells in 5 randomly selected fields of view under the microscope.

Measurement of mitochondrial mass

Mitochondria of SK-MEL-2 cells were labeled by incubating the cells with medium containing 100 nmol/L MitoTracker Red CMXRos (Beyotime Biotechnology, China) for 30 min at 37 °C. Subsequently, the cells were washed twice, analyzed under a fluorescence microscope and images were captured.

Measurement of intracellular ATP levels

Intracellular ATP levels were measured using an ATP assay kit (Beyotime Biotechnology, China) according to the instructions. Cell samples were lysed and centrifuged at 12,000 × g for 5 min at 4 °C as previously described26. The supernatant was collected and photochemically reacted with the ATP working solution. The light units of the ATP standard solution and the samples were obtained by Microplate Autoreader (Bio-Rad, Hercules, CA, USA) assay. The ATP levels of each sample were calculated from a calibration curve made from the assay values of the ATP standard solution. To exclude the effect of cell volume differences on ATP measurements, the amount of protein in each sample was determined using the BCA assay (Beyotime Biotechnology, China).

Measurement of mtDNA content by RT-qPCR

Genomic DNA was extracted using a genomic DNA isolation kit (QIAGEN, Germantown, MD) according to the manufacturer’s instructions. Relative mtDNA copy number was measured using an RT-qPCR-based method as described previously27.

Oxygen consumption measurement

The oxygen consumption rate (OCR) of cells is measured using the Extracellular OCR Plate Assay Kit (Dojindo) according to the manufacturer’s protocol28. Briefly, cells (5 × 104 cells) are inoculated into each well of a 96-well black-bottom plate. Cells were treated with an oxygen probe. Cells were stimulated with FCCP at a final concentration of 2 µM and mineral oil was added dropwise. The fluorescence signal was measured every 10 min using an enzyme marker Varioscan Lux (Thermo Fisher Scientific). The OCR was calculated from the analysis of the kinetic curves obtained from the measurements.

Statistics and reproducibility

Data are expressed as the mean ± SD of three independent experiments. Statistical analysis of data was performed by ImageJ software, Prism9 (GraphPad software), and R 4.2.1. The Shapiro-Wilk test was used to determine the type of sample distribution as previously described24. The two-tailed Student’s t-test was used to assess the statistical significance between two groups of normal distribution. For nonparametric tests, the two-tailed Mann-Whitney test was used to assess statistical significance between two groups. For more than two factors, two-way ANOVA was used to calculate significance; post hoc Tukey’s test or Sidak’s test was used for multiple comparisons. For more than two groups, significance was calculated using the Kruskal-Wallis test or ordinary one-way ANOVA depending on the type of sample distribution; multiple comparisons were made using the post hoc Tukey test. P < 0.05 were considered statistically significant, ns indicated no statistical significance. P < 0.001 is denoted by ***, P < 0.01 is denoted by **, P < 0.05 is denoted by *, and P > 0.05 is denoted by ns. All data in the article are available. Each experiment was repeated independently at least three times.

Results

Association between CRIP1 expression and clinical features

To investigate the clinical relevance of CRIP1 in melanoma, an analysis of the TCGA-SKCM dataset revealed that CRIP1 mRNA levels were significantly lower in melanoma tissues compared to normal tissues (Fig. 1A). The HPA database also indicated reduced CRIP1 expression in melanoma tissues (Fig. 1B). A further analysis of CRIP1 expression in relation to clinical features showed a notable association between low CRIP1 levels and advanced T-stages, particularly T4 (Fig. 1C), as well as melanoma ulceration (Fig. 1E) and Clark levels (Fig. 1F). However, no significant correlation was found with N-stages (Fig. 1D). These findings were confirmed by Fisher’s exact test and chi-square test, which yielded similar results (Table 1). Additionally, a one-way logistic regression analysis of CRIP1 expression (Table 2) revealed a strong correlation with T-stage, Clark level, and ulceration, but not with N-stage, M-stage, or clinical stage. Collectively, these results suggest that CRIP1 expression plays a role in melanoma development and progression.

Fig. 1
figure 1

Association between CRIP1 expression and clinical features. (A) CRIP1 mRNA in cutaneous melanoma was significantly lower than that in normal tissue. (B) CRIP1 expression in melanoma from the HPA database. (C) The most significant difference in CRIP1 expression was from T1-2 to T4 stage tissues. (D) In the TCGA database, there was no significant difference between CRIP1 expression and N-stage of melanoma tissues. (E) CRIP1 mRNA was lower in melanomas with ulcers than in melanomas without ulcers. (F) CRIP1 expression progressively decreased from Clark grades I-III to grade IV and V melanomas.

Full size image
Table 1 Association of CRIP1 expression and clinicopathological features in melanoma.
Full size table
Table 2 Logistic regression analysis of CRIP1 expression associated with clinical pathological characteristics.
Full size table

Low CRIP1 expression affects the prognosis of melanoma patients

To explore the impact of CRIP1 expression on the prognosis of melanoma patients, we analyzed the correlation between CRIP1 levels and patient outcomes. The results showed that melanoma patients with low CRIP1 expression had significantly reduced Overall Survival (OS), Disease Specific Survival (DSS), and Progression Free Interval (PFI) (Fig. 2A-C). Survival curve analysis further indicated that patients with low CRIP1 expression had poorer OS compared to those with high expression (Fig. 2D). Similarly, both DSS and PFI were notably shorter in the low-expression group (Fig. 2E-F). Univariate analysis revealed that factors such as T-stage, N-stage, M-stage, Clark level, ulceration, age, Breslow depth, and CRIP1 expression were all significant predictors of melanoma prognosis (P < 0.05). Multivariate Cox regression analysis identified N-stage, Breslow depth, and CRIP1 expression as independent prognostic factors for OS in melanoma patients (Table 3). These findings suggest that CRIP1 expression is closely linked to the prognosis of melanoma patients.

Fig. 2
figure 2

Low CRIP1 expression affects the prognosis of cutaneous melanoma patients. The overall survival (A), disease-specific survival (B) and progression-free interval (C) of melanoma patients with low CRIP1 expression were shorter than those with high CRIP1 expression. Survival curve analysis showed that patients with low CRIP1 expression had significantly shorter overall survival (D), disease-specific survival (E) and progression-free interval (F).

Full size image
Table 3 Univariate and multivariate Cox proportional hazards analysis for CRIP1 expression.
Full size table

CRIP1 overexpression inhibits proliferation and invasion of cutaneous melanoma cells

To investigate the possible function of CRIP1 in the progression of cutaneous melanoma, two melanoma cell lines stably overexpressing CRIP1, SK-MEL-2/CRIP1 and A375/CRIP1, were established. Cells transfected with empty lentiviral vectors were used as negative controls. RT-qPCR and WB assays showed that the stable overexpression of CRIP1 cell lines were successfully constructed (Fig. 3A-B). EDU cell proliferation and colony formation assays showed that CRIP1 overexpression inhibited the proliferation of SK-MEL-2 and A375 cells (Fig. 3C-D). In addition, CRIP1 overexpression significantly inhibited the migration and invasion of melanoma cells as detected by wound healing and Transwell invasion assays (Fig. 3E-F). Further detection of total and cleaved PARP and caspase3 proteins during apoptosis revealed that overexpression of CRIP1 did not affect the apoptotic process of melanoma cells (Fig. 3G). The above in vitro experiments suggested that CRIP1 overexpression significantly inhibited the proliferation, migration and invasion of melanoma cells.

Fig. 3
figure 3

CRIP1 overexpression inhibits proliferation and invasion of cutaneous melanoma cells. RT-qPCR (A) and WB (B) confirmed that CRIP1 was stably overexpressed in SK-MEL-2 and A375 cells. EDU cell proliferation assay (C) and colony formation assay (D) were performed to assess the proliferative capacity of CRIP1 overexpressed cutaneous melanoma cells (Fig. C scale bar 50 μm). (E) Wound healing assay to assess the migration ability of CRIP1 overexpressing cutaneous melanoma cells (scale bar 100 μm). (F) Transwell invasion assay to assess the invasive ability of CRIP1 overexpressing cutaneous melanoma cells (scale bar 50 μm). (G) WB assay to assess the apoptosis of CRIP1 overexpressing cutaneous melanoma cells. Data are shown as SD ± mean.

Full size image

CRIP1 downregulation promotes proliferation and invasion of cutaneous melanoma cells

To elucidate the effect of CRIP1 knockdown on melanoma cells, lentiviral vectors carrying targeted CRIP1 were used to silence endogenous CRIP1 expression in SK-MEL-2 and A375 cells (Fig. 4A-B). EDU cell proliferation and colony formation assays showed that CRIP1 knockdown promoted proliferation of SK-MEL-2 and A375 cells (Fig. 4C-D). In addition, CRIP1 knockdown significantly promoted the migration and invasion of melanoma cells as detected by wound healing and Transwell invasion assays (Fig. 4E-F). Further detection of total and cleaved PARP and caspase3 proteins during apoptosis revealed that silencing CRIP1 did not affect the apoptotic process of melanoma cells (Fig. 4G). The above in vitro experiments suggested that CRIP1 knockdown significantly promoted the proliferation, migration and invasion of melanoma cells.

Fig. 4
figure 4

CRIP1 downregulation promotes proliferation and invasion of cutaneous melanoma cells. RT-qPCR (A) and WB (B) confirmed stable knockdown of CRIP1 in SK-MEL-2 and A375 cells. EDU cell proliferation assay (C) and colony formation assay (D) assessed the proliferative capacity of CRIP1-knockdown cutaneous melanoma cells (Fig. C scale bar 50 μm). (E) Wound healing assay to assess the migration ability of CRIP1 knockdown cutaneous melanoma cells (scale bar 100 μm). (F) Transwell invasion assay to assess the invasive ability of CRIP1 knockdown cutaneous melanoma cells (scale bar 50 μm). (G) WB assay to assess the apoptosis of CRIP1-knockdown cutaneous melanoma cells. Data are shown as SD ± mean.

Full size image

Predicting CRIP1 affects mitochondrial biogenesis-related pathways in melanoma

Based on the normalized enrichment score (NES), we selected melanomas with low CRIP1 gene expression (Fig. 5, Supplementary Table S1). As shown in Fig. 5, the GSEA results indicate that CRIP1-associated melanoma consists of a number of key pathways, including mitochondrial biogenesis (Fig. 5A), mitochondrial translation (Fig. 5B), mitochondrial protein import (Fig. 5C), mitochondrial complex I assembly model oxphos system (Fig. 5D), respiratory electron transport (Fig. 5E), and electron transport chain in mitochondria oxphos system (Fig. 5F). These suggest that CRIP1 is primarily involved are associated with mitochondrial function and biogenesis in melanoma cells.

Fig. 5
figure 5

Predicted pathways related to CRIP1 influence on mitochondrial biogenesis in melanoma. CRIP1 is differentially enriched in mitochondrial biogenesis (A), mitochondrial translation (B), mitochondrial protein import (C), mitochondrial complex I assembly model oxphos system (D), respiratory electron transport (E), and mitochondrial electron transport chain oxphos system (F). ES: enrichment score; NES: normalized es; FDR: false discovery rate.

Full size image

CRIP1 inhibits mitochondrial biogenesis in cutaneous melanoma cells

Studies have reported that increased mitochondrial biogenesis plays an important role in tumor development2. Therefore, we further explored the correlation between CRIP1 expression and mitochondrial biogenesis in melanoma cells. As shown in Fig. 6, CRIP1 overexpression suppressed the relative mitochondrial content (Fig. 6A), relative mtDNA copy number (Fig. 6B-C), ATP production (Fig. 6D-E), expression levels of oxidative phosphorylation (OXPHOS)-related proteins (Fig. 6F), and respiratory capacity (Fig. 6G) in melanoma cells, compared with controls. In contrast, the opposite results were observed in CRIP1 knockdown melanoma cells. It is known that rotenone is a common respiratory complex I inhibitor29, and we investigated whether rotenone could reverse the effect of CRIP1-regulated mitochondrial biogenesis by adding rotenone to CRIP1-silenced melanoma cells. Firstly, the results of cytotoxicity assay showed that the half inhibitory concentration (IC50) of rotenone was 8 µM in CRIP1-silenced SK-MEL-2 cells and 9.1 µM in CRIP1-silenced A375 cells (Fig. 7A). Next, we applied rotenone at concentrations of 8µM and 9µM to culture CRIP1-silenced SK-MEL-2 and A375 cells. It was found by EDU proliferation assay that rotenone reversed the proliferative ability of melanoma cells promoted by silencing CRIP1 (Fig. 7B). Transwell invasion assay revealed that rotenone reversed the invasive ability of melanoma cells promoted by silencing CRIP1 (Fig. 7C). These findings suggest that CRIP1 inhibits mitochondrial biogenesis in cutaneous melanoma cells.

Fig. 6
figure 6

CRIP1 inhibits mitochondrial biogenesis in cutaneous melanoma cells. (A) Relative mitochondrial content in CRIP1 overexpressed and knockdown SK-MEL-2 cells (scale bar is 10 μm). Mitochondria were labeled using Mitotracker (Red). The right panel shows the fluorescence intensity ratio of Mitotracker (Red) to DAPI. (B&C) Relative mtDNA copy number in cutaneous melanoma cells overexpressing and knocking down CRIP1 was determined by RT-qPCR. (D&E) Mitochondrial ATP water was measured in skin melanoma cells overexpressing and knocking down CRIP1 using an ATP assay kit. (F) WB analysis of the expression of oxidative phosphorylation-related proteins in cutaneous melanoma cells overexpressing and knocking down CRIP1. ND1 (CI), SDHB (CII), UQCRC2 (CIII), MTCOX2 (CIV) and ATP5A1 (CV) were included. (G) OCR was measured in control and SK-MEL-2 cells stably overexpressing CRIP1. Basal respiration (untreated) and maximal respiration (FCCP) were analyzed. Data are shown as SD ± mean.

Full size image
Fig. 7
figure 7

Rotenone reversed the proliferative and invasive capacity of melanoma cells promoted by silencing CRIP1. (A) Cytotoxicity assays were performed to assess the half inhibitory concentration (IC50) of rotenone on CRIP1-silenced SK-MEL-2 and A375 cells. (B) EDU cell proliferation assay was used to assess the proliferative capacity after the addition of rotenone to CRIP1-silenced cutaneous melanoma cells (scale bar is 50 μm). (C) Transwell invasion assay was used to assess the invasive ability after addition of rotenone to CRIP1-silenced cutaneous melanoma cells (scale bar is 50 μm). Data are shown as SD ± mean.

Full size image

CRIP1 inhibits proliferation and invasion of cutaneous melanoma cells by suppressing TFAM-mediated mitochondrial biogenesis

It has been shown that mitochondrial biogenesis is regulated by multiple factors12, including the well-studied PGC1α, NRF1, and TFAM13,14. We explored whether CRIP1 inhibits mitochondrial biogenesis by regulating these star molecules. CRIP1 suppressed the protein levels of TFAM but did not affect the protein levels of PGC1α and NRF1 compared to controls (Fig. 8A). Further we knocked down TFAM in melanoma cells that knocked down CRIP1 and found that the knockdown of TFAM counteracted the increased relative mtDNA copy number (Fig. 8B), ATP production (Fig. 8C), respiratory capacity (Fig. 8D), and proliferative (Fig. 8E) and invasive (Fig. 8F) capacity of melanoma cells that were increased by CRIP1 silencing. These data suggest that CRIP1 inhibits the proliferation and invasion of cutaneous melanoma cells by suppressing TFAM-mediated mitochondrial biogenesis.

Fig. 8
figure 8

CRIP1 inhibits proliferation and invasion of cutaneous melanoma cells by suppressing TFAM-mediated mitochondrial biogenesis. (A) WB analysis of the protein levels of TFAM, PGC1α and NRF1 in cutaneous melanoma cells overexpressing and knocking down CRIP1. (B) The relative mtDNA copy numbers in cutaneous melanoma cells with both CRIP1 and TFAM knockdown were determined by RT-qPCR. (C) Mitochondrial ATP water in cutaneous melanoma cells with both CRIP1 and TFAM knockdown was determined using an ATP assay kit. (D) OCR was measured in SK-MEL-2 cells silenced with CRIP1 and with both CRIP1, TFAM. Basal respiration (untreated) and maximal respiration (FCCP) were analyzed. (E) EDU cell proliferation assay was performed to assess the proliferation ability of cutaneous melanoma cells with both CRIP1 and TFAM knocked down (scale bar 50 μm). (F) Transwell invasion assay was performed to assess the invasive ability of cutaneous melanoma cells with both CRIP1 and TFAM knocked down (scale bar 50 μm). Data are shown as SD ± mean.

Full size image

Discussion

Metastasis, the leading cause of death in melanoma patients1,30, has attracted much attention and research in melanoma studies. However, the molecular mechanisms underlying melanoma development remain largely unknown. In this study, we systematically revealed the oncogenic role of CRIP1 in cutaneous melanoma for the first time. Our experimental results showed that high expression of CRIP1 significantly inhibited the proliferation, migration and invasion ability of melanoma cells.

Cysteine-rich intestinal protein 1 (CRIP1) is a small, cysteine-rich calcium-binding protein belonging to the zinc-finger protein family31. CRIP1 has been suggested to play a role in a variety of cellular biological processes, such as cell differentiation, proliferation, signaling, and stress response, etc20,21,22,32. , but its specific functions and regulatory mechanisms are still incompletely understood in many aspects. The function of CRIP1 in cells is closely related to its involvement in calcium and zinc binding activities31,33. Due to the regulatory effects of zinc ions on a variety of biological processes, CRIP1 may act as a mediator of metal ion regulation in cells through zinc binding33,34. In addition, CRIP1 is involved in processes related to the immune response, cellular metabolism, and the cytoskeleton20,21,22,35. CRIP1 is also involved in intracellular calcium signaling regulation36,37. Calcium, as an important second messenger, is involved in a variety of intracellular signaling pathways, including processes such as cell proliferation and apoptosis9. CRIP1, by regulating intracellular calcium levels, may affect the activation state of these signaling pathways36, thus playing an important role in the regulation of cell behavior. Combined with previous studies on the role of CRIP1 in cancer, the dual functions exhibited by CRIP1 in different types of cancer may be closely related to factors such as cell type, cancer stage, and tumor microenvironment. For example, in cervical cancer38, gastric cancer22 and certain types of colorectal cancer34, CRIP1 exhibits significant oncogenic properties. In breast cancer32, CRIP1 exhibits cancer inhibitory properties. We observed that in melanoma models, CRIP1 may limit tumor energy supply through regulation of mitochondrial biogenesis, thereby limiting tumor cell proliferation and invasion, but not affecting the apoptotic.

Mitochondrial biogenesis is the process of mitochondrial proliferation and the formation of new mitochondria. As the “energy factories” in the cell, mitochondria play a crucial role in maintaining normal cellular function and producing energy (mainly ATP)6. Mitochondrial biogenesis is a complex and highly coordinated process that involves interactions between nuclear and mitochondrial genes and is regulated by a variety of signaling pathways and transcription factors7,11,39, such as PGC-1α (peroxisome proliferator-activated receptor-gamma coactivator 1α)3, NRF-1/2 (nuclear respiratory factor)40,41, and TFAM (mitochondrial transcription factor A)42,43. The initiation of this process is usually triggered by cellular responses to the external environment or intrinsic conditions, such as increased energy demand, oxidative stress, exercise, and caloric deficit44. These signals activate upstream transcription factors, which in turn direct the expression of mitochondrial proteins and the replication of mitochondrial DNA, resulting in an increase in mitochondrial number and function in response to the cell’s energy demands and changes in physiological status39.

In tumors, the role of mitochondrial biogenesis is more complex. Tumor cells have much higher energy requirements than normal cells due to their rapid proliferation, and thus often require increased mitochondrial number and function to meet their metabolic needs45. Studies have shown that in a variety of cancer types, mitochondrial biogenesis is activated to increase ATP production to support tumor growth and spread. For example, upregulation of the expression of mitochondrial biogenesis-related genes is often observed in breast46 and colon cancers47, which is closely associated with increased proliferation, drug resistance and invasiveness of cancer cells. On the other hand, mitochondria are also a major site of oxidative phosphorylation, generating large amounts of ROS. Increased mitochondrial biogenesis in tumor cells may lead to elevated levels of ROS, which can help to trigger gene mutations, activate pro-cancer signaling pathways, and thus promote tumor progression10. At the same time, an excess of ROS can also activate apoptosis. Therefore, tumor cells need to finely balance ROS production by regulating mitochondrial function to promote growth and avoid excessive cell death10,48. The role of mitochondrial biogenesis in tumors is dual. On the one hand, it provides energy and metabolic intermediates to tumor cells to support their rapid growth and proliferation; on the other hand, the regulation of mitochondrial function can also be used as a therapeutic target to reduce the energy supply of tumor cells by inhibiting mitochondrial biogenesis, which in turn inhibits tumor progression9,41,48,49. This dual role makes mitochondrial biogenesis an important direction in cancer research with potential therapeutic value. Our study revealed that CRIP1 inhibited the mitochondrial biogenesis process in cutaneous melanoma cells. This included inhibition of the relative mitochondrial content, mitochondrial DNA copy number, ATP production, respiratory capacity, and expression levels of oxidative phosphorylation-related proteins in melanoma cells.

TFAM is a key nuclear-encoded protein involved in the replication, transcription and maintenance of mitochondrial DNA (mtDNA)39. TFAM plays a central role in the regulation of mitochondrial biogenesis and is responsible for binding and stabilizing mitochondrial DNA to ensure the normal function of the mitochondrial genome15,39. TFAM plays a central role in the regulation of mitochondrial biogenesis, responsible for binding and stabilizing mitochondrial DNA to ensure the normal function of the mitochondrial genome. TFAM also plays an important role in tumorigenesis and progression42,47. Tumor cells usually require large amounts of energy to sustain their rapid proliferation and migration, thus requiring increased mitochondrial biogenesis. Studies have shown that TFAM expression is commonly upregulated in a variety of tumor types to enhance mitochondrial function and increase energy availability to support the malignant behavior of tumor cells15. For example, TFAM upregulation has been found to be associated with tumor progression in lung50, breast51, and gastric cancers52, among others17,18. Our data suggest that overexpression of CRIP1 significantly reduces the expression of the mitochondrial DNA replication factor TFAM, thereby inhibiting mitochondrial biogenesis and thus melanoma malignant progression.

An important implication of this study is that CRIP1 may serve as a novel target for melanoma treatment. Existing melanoma treatments, such as immune checkpoint inhibitors and BRAF-targeted regimens53,54, still suffer from problems such as drug resistance and side effects, although they have improved patient survival to some extent. The present study revealed that CRIP1 significantly inhibited the malignant progression of cutaneous melanoma by inhibiting TFAM-mediated mitochondrial biogenesis, suggesting that CRIP1 may be a novel oncogenic factor that regulates mitochondrial function. By affecting the energy metabolism level of tumor cells, cell proliferation and migration were inhibited. This finding provides a new perspective for targeted therapy of melanoma, and the targeting strategy against CRIP1 is expected to become one of the effective therapeutic means in the future. However, our study is based on an in vitro cell model, and in vivo animal studies are needed to verify the inhibitory effect of CRIP1 on melanoma growth and metastasis.

In conclusion, our study demonstrates that CRIP1 plays a significant inhibitory role in the progression of cutaneous melanoma by regulating mitochondrial biogenesis through TFAM.