Infection with novel duck reovirus induces stress granule and methylation-mediated host translational shutoff in Muscovy ducklings

Yun, Tao; Hua, Jionggang; Chen, Liu; Ye, Weicheng; Ni, Zheng; Zhu, Yinchu; Zhang, Cun

doi:10.1038/s42003-024-07259-2

Download PDF

Article
Open access
Published: 21 November 2024

Infection with novel duck reovirus induces stress granule and methylation-mediated host translational shutoff in Muscovy ducklings

Tao Yun¹,
Jionggang Hua¹,
Liu Chen¹,
Weicheng Ye¹,
Zheng Ni¹,
Yinchu Zhu¹ &
…
Cun Zhang¹

Communications Biology volume 7, Article number: 1549 (2024) Cite this article

2462 Accesses
1 Altmetric
Metrics details

Subjects

Abstract

The recently identified novel duck reovirus (NDRV) is a waterfowl reovirus that can seriously harm or kill various waterfowl species. However, how NDRV interacts with host cells in Muscovy ducklings beyond the typical pathogenesis resulting from a viral infection is unknown. The current study examined the global translation efficiency of the Fabricius bursa of Muscovy ducklings infected with NDRV HN10 using mass spectrometry and ribosome footprint sequencing. Protein-protein interactions were investigated using immunogold labeling, transmission electron microscopy, and immunocytochemistry. An analysis of the relationship between m⁶A and translation was performed using RNA immunoprecipitation and m⁶A methylation immunoprecipitation. We found that both in vivo and in vitro, the translation efficiency of RNA modified with m⁶A could be significantly reduced by σB, a structural protein component of NDRV HN10. Furthermore, σB might simultaneously interact with the stress granule complex CAPRIN1 and G3BP1 and the m⁶A reader protein YTHDF1/3. Significant overlap was observed between m6A-modified and G3BP1-enriched RNA, indicating that granule stress could capture m6A-methylated RNA. We discovered a new function for NDRV HN10 in translational shutoff by recruiting m⁶A-modified RNA into stress granules located in the Fabricius bursa of Muscovy ducklings.

Multi-omics analysis of SFTS virus infection in Rhipicephalus microplus cells reveals antiviral tick factors

Article Open access 21 May 2025

Experimental infection of aquatic bird bornavirus in Muscovy ducks

Article Open access 30 September 2022

Novel duck reovirus exhibits pathogenicity to specific pathogen-free chickens by the subcutaneous route

Article Open access 03 June 2021

Introduction

In the last ten years, novel duck reovirus (NDRV) has been identified in various duck species in China¹. Unlike classical DRV, NDRV can cause severe liver and spleen hemorrhage in ducklings, resulting in a high mortality rate of 50%², which can cause incalculable economic losses to the waterfowl industry in China. Unfortunately, there is currently no commercial vaccine available to prevent NDRV infection and transmission. As a result, understanding the pathophysiology of NDRV in ducklings will aid in the development of new treatments and vaccines against NDRV.

NDRV has been shown to attack the immunological system (bursa of Fabricius) of Muscovy ducklings. Most studies on NDRV have focused on the pathological phenotype of the bursa of Fabricius. On this basis, our team has previously provided a large amount of high-throughput transcriptome and proteome data^3,4. From these studies, we found that the nucleic acids carried by the virus can not only influence the viral structure and function but also react with the endogenous miRNAs of the duckling.

In the present study, we used a virulent NDRV strain named HN10 to infect the bursa of Fabricius in Muscovy ducklings. Then, we focused on translation efficiency via combined RNA-seq, Ribo-seq, and m⁶A MeRIP-seq analyses, and we further investigated the molecular mechanism underlying the influence of NDRV on protein translation regulation in the bursa of Fabricius cells. Our findings could advance our understanding of the molecular biology involved in NDRV infection in ducklings, and this cross-species response may be generalized to other virus-mammal interactions, potentially providing novel ideas and clues for the study of virus evolution, prevention, and treatment.

Results

The novel duck reovirus weakens gene translation in the bursae of Fabricius

The bursa of Fabricius of Muscovy ducklings was infected with the novel duck reovirus (NDRV) HN10, and RNA-seq data were used in our previous research⁴. Ribo-seq and m⁶A MeRIP-seq were subsequently conducted to investigate the ribosome-enriched and m⁶A-modified transcriptomes. The global abundance (transcripts per million, TPM) of ribosome-enriched mRNAs without NDRV-derived transcripts was significantly lower than that in the NC group (p = 1.84 × 10⁻¹²) after normalization (Fig. 1a). By assessing the translational efficiency index (TEI, defined as the relative level of translation to transcription) combined with previous RNA-seq data, we observed that the proportion of RNA showing the same TEI value after HN10 infection was much lower than that of uninfected RNA (p = 3.7 × 10⁻¹⁵), which indicated that NDRV HN10 drastically reduced translation more than transcription after eliminating the disturbance of viral RNA (Fig. 1b). Moreover, we further noted that the significantly upregulated m⁶A-modified mRNAs strongly overlapped (64.8%) with the downregulated ribosome-enriched mRNAs in the NDRV HN10 infection group compared to the negative control group (Fig. 1c).

**Fig. 1: NDRV affects the gene translation of the bursa of Fabricius in Muscovy ducklings.**

To further clarify whether HN10 inhibited transcriptional efficiency or promoted protein degradation, we infected DEFs stably transfected with the CMV-driven firefly luciferase reporter with NDRV HN10 and treated them with the protein synthesis inhibitor cycloheximide (CHX) or the proteasome inhibitor bortezomib (BTZ). Compared with those of the NC, the effects of NDRV HN10 and CHX on reducing luciferase activity were indeed observed (Fig. 1d). On the other hand, the BTZ-induced fluorescence signal could be compromised by subsequent NDRV HN10 infection, whereas BTZ failed to rescue the prior effect of NDRV HN10 (Fig. 1e), indicating that the decrease in luciferase activity observed following NDRV HN10 infection is not connected to proteasomal activity or protein degradation. We divided the twelve coding proteins of NDRV HN10⁵ into individual plasmids and transfected them into DEFs to examine the effect on gene translation (Fig. 1f, g). We observed that only σB had a remarkable toxic effect compared with the other components (Fig. 1h). Ribo-seq also indicated that σB could obviously unload mRNA from ribosomes compared to empty vector or other NDRV HN10 proteins (Fig. 1i). Overall, we concluded that NDRV HN10 might terminate the gene translation process in the bursa of Fabricius.

Characterization of σB-interacting proteins in Muscovy ducklings

To further investigate the mechanism by which NDRV HN10 affects gene translation, transient Flag-σB (with Flag-λA as a control) transfection was conducted in subsequent studies. Flag IP was conducted to capture the interacting proteome, which was further characterized by mass spectrometry. A series of RNA binding proteins showing higher homology with those of Homo sapiens were identified in the list of peptides with the 40 highest confidence levels compared to λA (Fig. 2a, Supplementary Data 1). GO analysis revealed that these proteins were largely related to RNA metabolism and translation (Fig. 2b). We unexpectedly noticed that the m6A methylation readers YTHDF1 and YTHDF3 could interact with σB. Moreover, the stress granule components CAPRIN1 and G3BP1 could also be pulled down by σB. WB analysis of YTHDF1, YTHDF3, CAPRIN1, and G3BP1 to validate the interaction with σB was performed with commercial antibodies against these targets of Muscovy ducklings against the same immunogen across Homo sapiens (Fig. 2c).

**Fig. 2: σB interacts with YTHDF1, YTHDF3, CAPRIN1 and G3BP1.**

σB facilitates the assembly of the m⁶A reader complex and stress granules

Immunocytochemistry showed a remarkable colocalization of G3BP1 and YTHDF1 with σB compared to λA and the empty vector (EV) (Fig. 3a, b) in DEFs treated with sodium arsenite (transfection of a single component cannot mimic NDRV HN10 infection to create stress conditions). Gel filtration showed that the protein fractions containing the highest abundances of YTHDF1/3, G3BP1, CAPRIN1, and σB were identical after σB transfection (Fig. 3d) but staggered after λA transfection (Fig. 3e) compared to EV control (Fig. 3c), suggesting that the m⁶A methyltransferase complex YTHDF1/3 was assembled with G3BP1/CAPRIN1 by σB. Similarly, G3BP1/CAPRIN1 were also colocalized in the bursa of Fabricius after NDRV HN10 infection compared to that in the NC group in vivo (Fig. 3f, g). Transmission immunoelectron microscopy verified that the G3BP1 (large dots) and YTHDF1 (small dots) proteins were more closely related to each other in response to HN10 infection (Fig. 3h) than in response to the negative control (Fig. 3i). Previous studies have indicated that both G3BP1 and CAPRIN1 are the core members involved in the organization of SGs^6,7,8. Therefore, σB of NDRV HN10 might affect the gene translation of Muscovy ducklings by promoting stress granule formation.

**Fig. 3: σB is required for the formation of YTHDF1/3 and stress granules.**

Stress granule packages of RNA with m⁶A modification at the 5′ UTR

To further investigate the role of stress granules in the response to NDRV HN10 infection, we conducted RIP-seq to examine the G3BP1-binding transcripts included in stress granules in vivo. Among the four populations with differential G3BP1- or m⁶A-enriched genes, 73.5% of the highly G3BP1-enriched transcripts overlapped with upregulated m⁶A-modified RNA (Fig. 4a, Supplementary Data 2). GO analysis indicated distinct functions and pathways of these four populations of genes (Fig. 4b). Furthermore, the m⁶A signal was primarily distributed at the 5′ UTR of these RNA molecules (Fig. 4c). Consistently, σB and λA RIP-seq of DEFs treated with sodium arsenite also suggested that 94.7% of the G3BP1-binding RNAs in vivo were σB-specific RNA molecules in vitro (Fig. 4d, Supplementary Data 3). Compared to λA-binding RNAs, σB-binding RNAs also exhibited robust m⁶A modifications at the 5′ untranslated region (UTR) according to in vivo mRIP-seq data (Fig. 4e). These results indicated that robust RNA with m⁶A modification was packaged into SGs by NDRV HN10 infection.

**Fig. 4: G3BP1 is largely occupied by RNA with m⁶A modification by σB of NDRV HN10.**

σB/YTHDF1/3 links stress granules with m⁶A-enriched RNA

Finally, we investigated the role of σB in bridging stress granules and m⁶A-modified RNA. YTHDF1/3, two σB-binding proteins (Supplementary Data 1), play a role as m⁶A readers in eukaryotic cells^9,10. YTHDF1 or YTHDF3 were silenced by siRNA in advance (Fig. 5a), and σB was subsequently transfected into DEFs treated with sodium arsenite. The results of the RIP-qPCR analysis of the two genes with the greatest increases in m⁶A modification in NDRV HN10 compared to those in the negative controls Reg4 (log₂ = 10.65, P < 0.05) and LOC113843712 (log₂ = 8.38, P < 0.05) are shown in Fig. 4b. We observed that the abilities of σB (Fig. 5b, c) and G3BP1 (Fig. 5d, e) to capture the transcripts of these two genes were not affected by YTHDF1 or YTHDF3 knockdown alone but were weakened when YTHDF1/3 was simultaneously knocked down. Similarly, simultaneous YTHDF1/3 knockdown impaired the interaction between σB and G3BP1/CAPRIN1 (Fig. 5f). Finally, both YTHDF1/3 knockdowns reduced the translation of endogenous genes in DEFs to some extent via HN10 infection (P = 2.8 × 10⁻⁵) (Fig. 5g).

**Fig. 5: YTHDF1/3 determine σB-mediated translational shutoff.**

Our study revealed that σB of NDRV HN10 could bind with YTHDF1/3 and G3BP1 and then recruit m⁶A-modified RNA to stress granules for translation shutoff of the endogenous gene of Muscovy ducklings (Fig. 6).

**Fig. 6: The working model in this study.**

Discussion

Viruses have evolved a variety of ways to manipulate the cellular translation machinery, emphasizing viral translation over normal protein synthesis. These mechanisms include the use of specific molecular markers on viral mRNA, such as internal ribosome entry sites (IRESs) and genome-linked viral proteins (VPgs). Furthermore, virus-encoded factors can quickly transform the global landscape of posttranscriptional processes by coopting and subverting cellular pathways that control mRNA degradation, modification, and translation. These processes facilitate viral translation through unconventional interactions with translation machinery components and by promoting RNA circularization^11,12. In contrast, in response to viral infections, host cells typically adopt concurrent cell-intrinsic countermeasures that use posttranscriptional mechanisms to activate key innate immune responses¹³.

In addition to the overall pathological changes caused by viral infection, the structural and functional protein components of NDRV have many other functions that are gradually being deciphered during the infection process in waterfowl. For example, σNS can promote autophagy¹⁴, and p10.8 induces ER stress and apoptosis¹⁵. The outer capsid protein of NDRV is predominantly composed of the S3-encoded protein σB, which is functionally identical to the σ3/σB proteins of mammalian reovirus (MRV), avian reovirus (ARV), and classical duck reovirus (CDRV). The NDRV σB protein has approximately 60% and 70% amino acid homology with ARV and CDRV, respectively. It possesses group-specific neutralizing epitopes and induces a robust antibody response against the virus. The NDRV σB protein has conserved sequence properties and is closely related to virus infection, pathogenicity, and immunogenicity, making it a promising option for NDRV serodiagnosis⁵.

In response to external stressors such as heat, nutrient deficiency, oxidative stress, UV radiation, and viral infection, eukaryotic cells usually activate stress response mechanisms¹⁶, resulting in changes in gene transcription, epigenetics, and mRNA translation. Under such harsh conditions, the cytoplasm forms stress granules, which are mRNA‒protein complexes¹⁷. The translation of most mRNAs is temporarily halted, and mRNAs, translation regulatory factors, and other RNA-binding proteins are transported from ribosomes to stress granules¹⁸. Limited energy resources are available for the translation of stress proteins (e.g., heat shock proteins) that aid the cell in overcoming stress. The translation of nonessential mRNA is temporarily shut down but not degraded, allowing for the resumption of translation when conditions return to normal. The stress granules function as a “safe haven” for these RNA molecules^19,20.

Stress granules are non-membrane-bound aggregates in the cytoplasm comprising a dense and stable “core” structure with a dynamic “shell” area, including an intrinsically disordered region (IDR)²¹. Shell formation involves liquid-liquid phase separation. Stress-induced stress granule formation occurs through protein kinase-induced phosphorylation of eIF2α^22,23 and inhibition of eIF4A/E activity^24,25, both of which lead to the blockade of translation initiation. Upon translation initiation blockade, RNA-binding proteins containing IDRs, such as G3BP1 and G3BP2, interact with each other and undergo self-aggregation to form the core of stress granules, followed by further fusion, growth, and shell formation through protein-protein interactions^26,27. Stress granule formation is a cellular response mechanism by which eukaryotic cells adapt and survive under stress conditions. It helps cells survive by selectively attracting mRNAs to stress granules for translation or repression. Stress granules recruit signaling molecules or factors that govern cell apoptosis, thereby preventing stress-induced cell death.

Viral infections trigger the formation of stress granules, but the impact and mechanisms of different viruses on stress granules vary. The well acknowledged is that stress granules inhibit host protein synthesis by pausing mRNA translation²⁸. This process helps cells conserve resources to cope with viral infection and may also limit the synthesis of viral proteins²⁹. However, stress granules can also inhibit viral RNA for translation. Many virus takes advantage of the characteristics of the stress granules to develop a series of response mechanisms for their own benefit through various mechanisms³⁰. Multiple viruses have evolved to block or subvert SGs components to promote their replication and spread. For example, West Nile Virus and dengue viral proteins interact with TIA-1/TIAR proteins to interfere the formation of stress granules and body assembly³¹. Poliovirus encodes 2 A protease and 3 C protease, which can cleave key stress granule proteins, inhibiting the formation of stress granules, thereby facilitating viral replication³². EBOV VP35 represses the assembly of canonical and non-canonical SGs via interaction with G3BP1, eIF3 and eEF2³³. While others may utilize the formation of stress granules to evade host immune surveillance³⁴. Some viral proteins can directly target stress granules, modulating their formation and function³⁵. Hepatitis C and COVID-19 can enhance stress granule assembly via targeting to eIF3 and G3BP1/2^36,37,38. So G3BP1 seems to be a target for a variety of viruses including our NDRV HN10. The development of G3BP1 drugs to combat the viral use of SG pathogenesis is worthy of attention.

The viral RNA itself is regulated by m6A methylation, and this modification further affects RNA stability and translation. Thus viruses have also developed a set of functions that affect the activity of m⁶A regulators, such as enterovirus 2 A(pro) cutting the YTHDF m⁶A reader to suppress the activity of interferon-driven JAK/STAT signaling³⁹, as well as COVID-19 weakening the expression of METTL3 to decrease m⁶A levels in COVID-19 and host genes, then subsequently enhancing the downstream innate immune signaling pathway and inflammatory gene expression⁴⁰.

This study’s findings focus on the process of cellular protein translation via σB. The core idea of this study is that σB acts as a bridge to bind to YTHDF1/3 to recognize m⁶A-labeled RNAs effectively and then recruits G3BP1-mediated stress particles and wraps these RNAs from ribosomes to terminate translation. YTHDF1/3 knockdown disrupted the interaction between stress granules and σB, indicating that YTHDF1 and YTHDF3 have complementary effects on each other. Although there is no direct evidence of m⁶A modification in NDRV RNA (we did not find positive NDRV RNA in the m⁶A MeRIP sequencing data), the virus appears not to be able to disrupt stress particles but rather to cleave the host cellular RNA into stress particles, leaving enough viral transcripts in the cytoplasm for efficient translation. We speculate that viral RNA is likely not modified by m⁶A. It is interesting to think about how viruses exploit cellular regulatory machinery to serve themselves rather than simply destroying them. The interaction protein of σB interacts with numerous other RNA-binding proteins (Supplementary Data 1). The molecular involvement of σB in eukaryotic cells warrants additional study.

Overall, our study reveals a novel role for σB of NDRV HN10 in the translation shutoff of Muscovy ducklings.

Materials and methods

Animal study

As previously described⁴, one-day-old healthy Muscovy ducklings were collected and randomly separated into groups (n = 10 for each group). Ducklings were administered 500 μl of the HN10 strain at a titer of 10^6.4 TCID50/ml for NDRV infection, whereas sterile DMEM was used as a negative control (NC). The bursa of Fabricius specimens was harvested at 72 hours postinfection (hpi) for subsequent experiments. All experiments were performed at the Institute of Animal Husbandry and Veterinary Sciences (IAHV), Zhejiang Academy of Agricultural Sciences (ZAAS). All animal samples were treated in accordance with the Regulations of the Administration of Affairs Concerning Experimental Animals approved by the State Council of China. The bird protocol used in this study was approved by the Research Ethics Committee of ZAAS (permit number 2021ZAASLA09). We have complied with all relevant ethical regulations for animal use.

Cell culture

DEF CCL-141 cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS) (Gibco), 100 IU/ml penicillin and 100 μg/ml streptomycin at 37 °C in a 5% CO₂ incubator. CCL-141 cells were transfected with the pGL6-TA-luc2-G418 vector (Beyotime, Shanghai, China), and the cell line with stable luciferase expression was screened with G418. The following drug treatment conditions were used: 0.5 mM sodium arsenite for 1 h; 20 nM working concentration of cycloheximide (CHX) (HY-12320, MCE, Shanghai, China) for 12 h; 50 nM bortezomib (BTZ) (HY-10227, MCE) for 2 h; twelve coding fragments (L1, λA; L2, λB; L3, λC; M1, μA; M2, μB; M3, μNS; S1, σC, p10, p18; S2, σA; S3, σB; and S4, σNS) of NDRV HN10 with a fused 3× Flag tag at the 5′ terminus inserted into the plasmid (pSecTag) were transiently transfected into CCL-141 cells using Lipofectamine 3000 (Thermo Fisher Scientific, Waltham, MA, USA); the empty vector (EV) was used as a blank control; and siRNA for YTHDF1 (5′-GACTGATCCTTATCTGTCCAGTTAT-3′) or YTHDF3 (5′-GCCTAGTTATTATGCTCCATCCATT-3′) of Muscovy ducklings was designed and synthesized by Tsingke Biotech. A 1 μM working concentration of siRNA was used for transfection with Lipofectamine RNAiMAX (Thermo Fisher Scientific).

Ribosome footprint profiling (Ribo)

Some steps were adjusted as previously described⁴¹. A total of 5 × 10⁷ cells were added to 500 μl of ice-cold lysis buffer (20 mM Tris pH 7.4, 150 mM NaCl, 5 mM MgCl₂, 1 mM DTT, 100 μg/ml cycloheximide, 1% Triton X-100 and Turbo DNase I 25 U/ml) and pipetted gently on ice for 30 min. Then, the supernatant was recovered after centrifugation at 20,000 × g for 15 min. Then, 300 μl of the lysate was transferred to a 13 × 51 mm² polycarbonate ultracentrifuge tube, and 0.9 ml of a 1 M sucrose cushion was added by carefully positioning a pipette tip at the very bottom of the tube and slowly dispensing the sucrose solution. Ribosomes were clarified by centrifugation at 70,000 rpm for 4 h and transferred to a new tube. Ribosome-enriched RNA was isolated by TRIzol. The RNA was subjected to sodium dodecyl sulfate-polyacrylamide gel (SDS‒PAGE) electrophoresis at 200 V for 1 h, and RNA in the 30 nt range was extracted and isolated using a Zymoclean Gel RNA Recovery Kit (Zymo Research, Orange, CA, USA). RNA was converted into cDNA using a HiScript III 1^st Strand cDNA Synthesis Kit (Roche, Basel, Kanton Basel, Switzerland) to construct a library for sequencing.

The TPM was generated for the normalization of the data via \({{{\rm{TPM}}}}={10}^{6}* \frac{\frac{{{{\rm{reads}}}}\; {{{\rm{mapped}}}}\; {{{\rm{to}}}}\; {{{\rm{transcript}}}}}{{{{\rm{transcript}}}}\; {{{\rm{length}}}}}}{{{{\rm{Sum}}}}\left(\frac{{{{\rm{reads}}}}\; {{{\rm{mapped}}}}\; {{{\rm{to}}}}\; {{{\rm{transcript}}}}}{{{{\rm{transcript}}}}\; {{{\rm{length}}}}}\right)}\). For translational efficiency analysis, TPM values from Ribo-seq and RNA-seq of one gene were compared as translational efficiency index (TEI), then TEI of each gene were arranged in order to fit the cumulative curve. In particular, in the Ribo-seq of the infected group, viral RNAs were treated separately from eukaryotic mRNA. The whole transcripts of viral RNA were removed from the infected group, and normalized with the negative control.

RNA immunoprecipitation (RIP) and m6A-methylated RIP (MeRIP)

This experiment was conducted following the Abcam protocol. Briefly, tissues containing at least 1 × 10⁷ cells were harvested and resuspended in 2 ml of nuclear separation buffer (1.28 M sucrose, 40 mM Tris pH 7.5, 20 mM MgCl₂, and 4% Triton X-100) and kept on ice for at least 30 min with frequent mixing. The pelleted nuclei were centrifuged at 14,000 rpm for 15 min and resuspended in wash buffer (150 mM KCl, 25 mM Tris (pH 7.4), 5 mM EDTA, 0.5 mM DTT, 0.5% NP40, 100 U/ml RNase inhibitor (Solarbio, Beijing, China), and 1× protease inhibitor cocktail (Solarbio)). For MeRIP, total RNA was isolated using TRIzol.

Nuclei pullets or RNA were sheared via sonication at high power for 30 cycles of 5 s on and 30 s off. After that, the supernatant was incubated with 1 μg of antibodies against m⁶A (Cat. No. ab284130, Abcam) or G3BP1 (Cat. No. 13057-2-AP, Proteintech, Wuhan, Hubei, China) overnight and 40 μl of protein A/G beads (Thermo Fisher Scientific) for 2 h with gentle rotation at 4 °C, while the remaining 10% was harvested as input. The pellet beads were centrifuged at 3000 rpm for 3 min and washed three times. Both the input and pellet beads were purified by TRIzol, and reverse transcription was conducted using a HiScript III 1^st Strand cDNA Synthesis Kit (Roche). cDNA libraries were used for next-generation sequencing or qPCR. For sequencing, the concentration and quality of the purified RIP RNAs were measured with a Nanodrop 2000 (Thermo Fisher Scientific) and an Agilent Bioanalyzer 2100 (Agilent, Santa Clara, CA, USA). Four micrograms of RNA from each group were used for library preparation via the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (NEB, Ipswich, MA, USA) following the manufacturer’s instructions and sequenced on an Illumina HiSeq platform.

Firefly luciferase reporter gene assay

A total of 5 × 10⁴ CCL-141 cells stably expressing luciferase were subcultured into BeyoGold 96-well black opaque plates (FCP966, Beyotime). After replacing the 100 μl of fresh medium, another 100 μl of One-Lumi^TM II Firefly Luciferase Reporter Gene Assay Solution (RG056, Beyotime) was added for 5 min. An ELx808 Absorbance Reader (Lonza, Basel, Kanton Basel, Switzerland) was used to detect the signal fluorescein at a wavelength of 570 nm.

Quantitative polymerase chain reaction (qPCR)

Template cDNA was converted from total RNA or purified RIP RNA using a HiScript III 1^st Strand cDNA Synthesis Kit. cDNA (1 μg) was subjected to qPCR with ChamQ SYBR Color qPCR Master Mix (Vazyme, Nanjing, Jiangsu, China). The sequences of primers used were as follows: Flag (F: 5′- GACTACAAAGACCAT -3′, R: 5′- TGTCATCGTCATCCTT -3′); λA (F: 5′- ACCAATGATAATGATGCTTCTTC -3′, R: 5′- TCAACAGCACTGGTAGCTTTAG -3′); λB (F: 5′- GTATCCGTACTTCCTCTCCGTC -3′, R: 5′- GAGTTTCGCTAACCATTGACAC -3′); λC (F: 5′- TGTGTATGACCTGCGTTTTATG -3′, R: 5′- ACGTGAGTTCGACAAATTGGAG -3′); μA (F: 5′- TGCTTCAGCATTTGGAGTTGAC -3′, R: 5′- GAAAGACAGCGTTACCACGTCC -3′); μB (F: 5′- TAGCATGATGTTCGAGGTGAAC -3′, R: 5′- ACCTCAGCCACTTGAGCTATAC-3′); μNS (F: 5′- GCTGTGGAATTGTTGGCATCTG -3′, R: 5′- ATTTTCACCTTCAACACGG -3′); and σC (F: 5′- ACCTGCTGATGCTGTCTTC -3′, R: 5′- GCGAGGACATAAGCAACATGGTC-3′), β-actin (F: 5′- TACGCCAACACGGTGCTG -3′, R: 5′- GATTCATCATACTCCTGCTTGCTG-3′).

Mass spectrum

Immunoprecipitated Flag proteins were separated by C18 reversed-phase chromatography with a TSQ Fortis^TM system (Thermo Fisher Scientific) and analyzed with a Q Exactive Hybrid Quadrupole-Orbitrap mass spectrometer (Thermo Fisher Scientific). Peptide-to-spectrum matches (PSMs) were made using the Sequest algorithm within Proteome Discoverer (Thermo Fisher Scientific) compared to Muscovy ducklings forward and reverse protein databases (downloaded from UniProt on 07-04-2016; 20,154 sequences). The parent and fragment ion tolerances were 10 ppm and 0.02 Da, respectively. Carbamidomethylation of Cys was included as a static modification, and deamidation of Asn/Gln, oxidation of Met, and Gly/Gly on His was included as dynamic modifications in the search, along with up to two missed tryptic cleavages. The results were imported into Scaffold (Proteome Software; ver 4.8), and a subset database was reanalyzed using X! Tandem. Final peptide identification was determined at a ≤ 1% false discovery rate (FDR).

Coimmunoprecipitation (IP) assay

A total of 1 × 10⁷ cells were disintegrated using Pierce IP lysis buffer [25 mM Tris-HCl pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% NP-40 and 5% glycerol] (Thermo Fisher Scientific) containing 1% proteasome inhibitor cocktail and 1% PMSF on ice for 30 min. The supernatant was subsequently centrifuged, mixed with 1 μg of antibodies against Flag (Cat No. 66008-4-lg, Proteintech) or rabbit IgG (Cat No. 30000-0-AP, Proteintech) and gently rotated overnight at 4 °C, and 40 μl of flurry IgA beads (Thermo Fisher Scientific) was added for an additional 2-h incubation. Immunoprecipitates were washed with IP buffer [20 mM HEPES pH 7.9, 350 mM NaCl, 0.1% NP-40, 1 mM DTT, 0.2 mM PMSF, 2 mg/ml leupeptin, and 2 mg/ml aprotinin] three times and resuspended in 20 μl of lysis buffer. The protein lysate was subjected to SDS‒PAGE or MASS Spectrum.

Western blot

Tissues or cells were homogenized in Pierce IP lysis buffer and then centrifuged at 4 °C at 13,000 rpm for 10 min. The protein concentration in the supernatant was determined using a BCA protein assay kit (Well-bio, Changzhou, Jiangsu, China). Equal amounts of protein samples were separated by SDS‒PAGE and transferred to polyvinylidene fluoride membranes. The membranes were then blocked with 5% nonfat milk TBS for 90 min and incubated with primary antibodies against YTHDF1 (1:2,000, Cat No. 17479-1-AP, Proteintech), YTHDF3 (1:2,000, Cat No. 25537-1-AP, Proteintech), CAPRIN1 (1: 2,000, Cat No. 15112-1-AP, Proteintech), G3BP1 (1: 2,000), Flag (1: 1,500), β-lactamase (encoding ampicillin resistant protein)(1: 2,000, Cat No. ab12251, Abcam), β-Actin (1: 2,500, Cat No. 81115-1-RR, Proteintech), σB and λA (1: 1,500, both antibodies were lab-made from mouse serum)⁵ overnight at 4 °C. The membranes were washed in TBST and incubated with HRP-conjugated AffiniPure goat anti-rabbit IgG (1:10,000 dilution, Cat No. SA00001-2, Proteintech) at room temperature for 1 h. The membranes were then treated with an enhanced chemiluminescence detection kit (Pierce, Rockfold, IL, USA), and the intensity of each band was quantified by densitometry.

For in-house generation of antibodies againstσB and λA, NDRV mAb 2-C10 was produced previously in our laboratory using the prime-boost approach. Briefly, six-week-old female BALB/c mice were immunized subcutaneously with purified recombinant σB or λA protein (50 μg per mouse) emulsified with complete Freund’s adjuvant (Sigma-Aldrich, St Louis, MO, USA). Three booster immunization of the same dose were given at two-week intervals mixed with incomplete adjuvant. Three days after the final booster immunization, the spleen cells isolated from immunized mice were fused with SP2/0 myeloma cells by using 50% (wt/vol) polyethylene glycol 1500 (PEG1500; Boehringer Mannheim, IN, USA) at a ratio of 10:1. The hybridoma cells were screened by indirect enzyme-linked immunosorbent assay (ELISA) coated with purified σB protein. The positive hybridoma clones were subcloned 3× by limiting dilution method. One of the NDRV σB-specific MAbs, designated 2-C10, was selected and used in this study, and its subtype was classified using the Mouse MAb Isotyping Kit (Thermo Fisher Scientific). The hybridoma was injected into the peritoneal cavities of BALB/c mice, and subsequent ascites fluid was collected and purified by affinity chromatography using the HiTrap™ Protein G column (GE Healthcare Life Sciences, Pittsburgh, PA, USA).

Immunocytochemistry

Tissues or cells were fixed in 4% paraformaldehyde, washed with phosphate-buffered saline (PBS), permeabilized with 0.1% Triton-X-100 (Sigma-Aldrich), and blocked with 0.5% horse serum in PBS. Immunostaining of the samples was performed using antibodies against G3BP1 (1:250), Flag (1:200), YTHDF1 (1:500), and CAPRIN1 overnight at 4 °C. After washing with PBS 4 times (5 min per wash), the sections were incubated with donkey anti-rabbit secondary antibodies (1: 20000; Jackson ImmunoResearch, West Grove, PA, USA) for 30 min at room temperature, followed by further incubation with DAPI for 15 min and washing with PBS 4 times. After drying in air, the slices were removed, coated with mounting medium, and coated with cover glasses. Positive staining was statistically analyzed using ImageJ.

Immunogold labeling and transmission electron microscopy

The bursa of Fabricius specimens were subjected to transmission electron microscopy (TEM) and perfused with 0.9% saline, followed by 4% paraformaldehyde and 2% glutaraldehyde overnight at room temperature. After the samples were washed three times with PBS and placed in 10% sucrose/4% agarose for 2 h, they were fixed with 1% osmium tetroxide in water at 4 °C for another 1 h, dehydrated with ethanol and embedded in 812 epoxy resin (TAAB laboratories, Aldermaston, Berks, UK). Ultrathin 70-nm-thick sections were cut with an Ultracut E ultramicrotome (Leica Biosystems, Nussloch, Baden-Wurttemberg, Germany) and mounted on Formvar carbon-coated Cu/Pd 100-mesh grids; the sections were stained with uranyl acetate and lead citrate. A JEM1400 Flash (JEOL, Beijing, China) electron microscope was used at 80 kV, with a Oneview 4 K x4K CMOS camera (Gatan, Pleasanton, CA, USA).

Tissues were perfused with 2% paraformaldehyde/0.2% glutaraldehyde in PBS for postembedding immunogolding. Two hundred-micron-thick slices were cryoprotected in 30% glycerol and frozen in liquid ethane in a cryofixation unit (KF80, Leica). Frozen sections were immersed in 0.5% uranyl acetate in methanol at -90 °C in a freeze-substitution instrument (Leica AFS), infiltrated with Lowicryl HM 20 resin at -45 °C, and polymerized with ultraviolet light. Thin sections of the bursa of Fabricius (70 nm) were incubated with 0.15% glycine in PBS for 15 min to quench free aldehyde groups, followed by blocking buffer (1% BSA, 0.2% Tween 20 and 5% FBS in TBS [Tris 30 mM, NaCl 150 mM pH 8.2]) for 30 min at room temperature. Primary antibodies (rabbit anti-total G3BP1 and YTHDF1) were added to the incubation buffer for 1 h, followed by incubation three times in PBS. Protein A-gold (PAg) at 25 nm (for G3BP1) and 10 nm (for YTHDF1) (Shanghai Joey Biotech) was incubated for 45 min at room temperature. Finally, the sections were stained with uranyl acetate and lead citrate and observed under a JEM1400 Flash (JEOL) electron microscope.

Gel filtration

A gel filtration assay was performed as previously described⁴². In brief, hypotonic buffer supplemented with NP-40 was used to separate the cytoplasm and nuclei of 1 × 10⁸ cells. The cytoplasmic proteins were isolated by high salt extraction buffer [20 mM HEPES (pH 7.9), 420 mM NaCl, 25% glycerol, 1.5 mM MgCl₂, 0.2 mM EDTA, 0.5 mM dithiothreitol and protease inhibitors] and then directly applied to a Sepharose 6B column (Sigma‒Aldrich) equilibrated with column running buffer containing 20 mM HEPES (pH 7.9), 200 mM NaCl, 1 mM dithiothreitol, 0.1 mM phenylmethylsulfonyl fluoride and 10% glycerol. One milliliter of each fraction was collected to detect YTHDF1, YTHDF3, G3BP1, CAPRIN1, and Flag by Western blot analysis.

Statistics and reproducibility

The data are shown as the mean ± standard deviation. The student’s t-test was used to analyze the differences between the two groups of three replicates. Some special methods used for omics analysis included one-way ANOVA for identifying significant differences in the abundance of transcripts and ribosome-enriched transcripts in NDRV HN10-infected plants and two-tailed Wilcoxon rank-sum tests for identifying significant differences in the translational efficiency index between infected and control plants. A P value less than 0.05 was considered to indicate statistical significance.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

Raw data of RNA-seq, Ribo-seq and m6A seq were deposited in E-MTAB-12115 and 14565. Mass spectrum data was deposited in proteome Exchange Consortium by the PRIDE partner repository with ID PXD025093. Supplementary Data 1 contains information of the candidate proteins interacting with σB in Muscovy ducklings. Supplementary Data 2 contains a gene list of those RNAs highly enriched with G3BP1 and m6A. Supplementary Data 3 contains a gene list of those RNAs highly enriched with G3BP1 and σB. All the source data can be found in Supplementary Data 4. Uncropped western blots can be found in Supplementary Information. Any remaining information can be obtained from the corresponding author upon reasonable request.

References

Yu, K. et al. Novel duck reovirus exhibits pathogenicity to specific pathogen-free chickens by the subcutaneous route. Sci. Rep. 11, 11769 (2021).
Article CAS PubMed PubMed Central Google Scholar
Yang, H. et al. Characterization and pathogenicity evaluation of recombinant novel duck reovirus isolated from Southeast China. Front. Vet. Sci. 10, 1124999 (2023).
Article PubMed PubMed Central Google Scholar
Yun, T. et al. Comparative proteomic analysis revealed complex responses to classical/novel duck reovirus infections in the spleen tissue of Cairna moschata. J. Proteom. 193, 162–72 (2019).
Article CAS Google Scholar
Yun, T. et al. Distinct whole transcriptomic profiles of the bursa of fabricius in muscovy ducklings infected by novel duck reovirus with different virulence. Viruses; 15, 111 (2022).
Yun, T. et al. Development and evaluation of a monoclonal antibody-based blocking enzyme-linked immunosorbent assay for the detection of antibodies against novel duck reovirus in waterfowl species. Microbiol. Spectr. 10, e0258122 (2022).
Article PubMed Google Scholar
Gwon, Y. et al. Ubiquitination of G3BP1 mediates stress granule disassembly in a context-specific manner. Science 372, eabf6548 (2021).
Article CAS PubMed PubMed Central Google Scholar
Yang, C. et al. Stress granule homeostasis is modulated by TRIM21-mediated ubiquitination of G3BP1 and autophagy-dependent elimination of stress granules. Autophagy 19, 1934–51 (2023).
Article CAS PubMed PubMed Central Google Scholar
Yang, P. et al. G3BP1 is a tunable switch that triggers phase separation to assemble stress granules. Cell 181, 325–45.e28 (2020).
Article CAS PubMed PubMed Central Google Scholar
Liu, T. et al. The m6A reader YTHDF1 promotes ovarian cancer progression via augmenting EIF3C translation. Nucleic Acids Res. 48, 3816–31 (2020).
Article CAS PubMed PubMed Central Google Scholar
Sun, R. et al. The m6A reader YTHDF3-mediated PRDX3 translation alleviates liver fibrosis. Redox Biol. 54, 102378 (2022).
Article CAS PubMed PubMed Central Google Scholar
Reineke, L. C. & Lloyd, R. E. Animal virus schemes for translation dominance. Curr. Opin. Virol. 1, 363–72 (2011).
Article CAS PubMed PubMed Central Google Scholar
Jan, E., Mohr, I. & Walsh, D. A cap-to-tail guide to mRNA translation strategies in virus-infected cells. Annu. Rev. Virol. 3, 283–307 (2016).
Article CAS PubMed Google Scholar
Burgess, H. M., Vink, E. I. & Mohr, I. Minding the message: tactics controlling RNA decay, modification, and translation in virus-infected cells. Genes Dev. 36, 108–32 (2022).
Article CAS PubMed PubMed Central Google Scholar
Wu, Y. et al. Muscovy duck reovirus sigmaNS protein triggers autophagy enhancing virus replication. Virol. J. 14, 53 (2017).
Article PubMed PubMed Central Google Scholar
Wang, Q. et al. Muscovy duck reovirus p10.8 protein induces ER stress and apoptosis through the Bip/IRE1/XBP1 pathway. Vet. Microbiol. 228, 234–45 (2019).
Article CAS PubMed Google Scholar
Protter, D. S. W. & Parker, R. Principles and properties of stress granules. Trends cell Biol. 26, 668–79 (2016).
Article CAS PubMed PubMed Central Google Scholar
Grousl, T., Vojtova, J., Hasek, J. & Vomastek, T. Yeast stress granules at a glance. Yeast 39, 247–61 (2022).
Article CAS PubMed Google Scholar
Mateju, D. et al. Single-molecule imaging reveals translation of mRNAs localized to stress granules. Cell 183, 1801–12 e13 (2020).
Article CAS PubMed Google Scholar
Riggs C. L., Kedersha N., Ivanov P., Anderson P. Mammalian stress granules and P bodies at a glance. J. Cell Science. 133, jcs242487 (2020).
Khong, A. et al. The stress granule transcriptome reveals principles of mRNA accumulation in stress granules. Mol. Cell 68, 808–20.e5 (2017).
Article CAS PubMed PubMed Central Google Scholar
Montero, H. & Trujillo-Alonso, V. Stress granules in the viral replication cycle. Viruses 3, 2328–38 (2011).
Article CAS PubMed PubMed Central Google Scholar
Kedersha, N. et al. G3BP-Caprin1-USP10 complexes mediate stress granule condensation and associate with 40S subunits. J. Cell Biol. 212, 845–60 (2016).
Article CAS PubMed PubMed Central Google Scholar
Blazquez, A. B., Martin-Acebes, M. A., Poderoso, T. & Saiz, J. C. Relevance of oxidative stress in inhibition of eIF2 alpha phosphorylation and stress granules formation during Usutu virus infection. PLoS Neglected Trop, Dis. 15, e0009072 (2021).
Article CAS Google Scholar
Tauber, D. et al. Modulation of RNA condensation by the DEAD-Box protein eIF4A. Cell 180, 411–26.e16 (2020).
Article CAS PubMed PubMed Central Google Scholar
Slaine, P. D., Kleer, M., Smith, N. K., Khaperskyy, D. A., McCormick, C. Stress granule-inducing eukaryotic translation initiation factor 4A inhibitors block influenza A virus replication. Viruses. 9, 388 (2017).
Jin, G. et al. G3BP2: Structure and function. Pharmacol. Res. 186, 106548 (2022).
Article CAS PubMed Google Scholar
Matsuki, H. et al. Both G3BP1 and G3BP2 contribute to stress granule formation. Genes Cells 18, 135–46 (2013).
Article CAS PubMed Google Scholar
Scholte, F. E. et al. Stress granule components G3BP1 and G3BP2 play a proviral role early in Chikungunya virus replication. J. Virol. 89, 4457–69 (2015).
Article CAS PubMed PubMed Central Google Scholar
Kedersha, N. & Anderson, P. Mammalian stress granules and processing bodies. Methods Enzymol. 431, 61–81 (2007).
Article CAS PubMed Google Scholar
McCormick, C. & Khaperskyy, D. A. Translation inhibition and stress granules in the antiviral immune response. Nat. Rev. Immunol. 17, 647–60 (2017).
Article CAS PubMed Google Scholar
Emara, M. M. & Brinton, M. A. Interaction of TIA-1/TIAR with West Nile and dengue virus products in infected cells interferes with stress granule formation and processing body assembly. Proc. Natl Acad. Sci. USA 104, 9041–6 (2007).
Article CAS PubMed PubMed Central Google Scholar
White, J. P. & Lloyd, R. E. Poliovirus unlinks TIA1 aggregation and mRNA stress granule formation. J. Virol. 85, 12442–54 (2011).
Article CAS PubMed PubMed Central Google Scholar
Le Sage, V. et al. Ebola virus VP35 blocks stress granule assembly. Virology 502, 73–83 (2017).
Article PubMed Google Scholar
Reineke, L. C. & Lloyd, R. E. The stress granule protein G3BP1 recruits protein kinase R to promote multiple innate immune antiviral responses. J. Virol. 89, 2575–89 (2015).
Article PubMed Google Scholar
White, J. P., Cardenas, A. M., Marissen, W. E. & Lloyd, R. E. Inhibition of cytoplasmic mRNA stress granule formation by a viral proteinase. Cell Host Microbe 2, 295–305 (2007).
Article CAS PubMed Google Scholar
Kim, D. et al. Differential effect of SARS-CoV-2 infection on stress granule formation in Vero and Calu-3 cells. Front. Microbiol. 13, 997539 (2022).
Article PubMed PubMed Central Google Scholar
Hashem, Y. et al. Hepatitis-C-virus-like internal ribosome entry sites displace eIF3 to gain access to the 40S subunit. Nature 503, 539–43 (2013).
Article CAS PubMed PubMed Central Google Scholar
Wang, Q. et al. Regulation of hepatitis C virus translation initiation by iron: role of eIF3 and La protein. Virus Res. 167, 302–9 (2012).
Article CAS PubMed Google Scholar
Kastan J. P., et al. Enterovirus 2A(pro) cleavage of the YTHDF m(6)A readers implicates YTHDF3 as a mediator of type I interferon-driven JAK/STAT signaling. mBio. 12, (2021).
Li, N. et al. METTL3 regulates viral m6A RNA modification and host cell innate immune responses during SARS-CoV-2 infection. Cell Rep. 35, 109091 (2021).
Article CAS PubMed PubMed Central Google Scholar
Ingolia, N. T., Brar, G. A., Rouskin, S., McGeachy, A. M. & Weissman, J. S. The ribosome profiling strategy for monitoring translation in vivo by deep sequencing of ribosome-protected mRNA fragments. Nat. Protoc. 7, 1534–50 (2012).
Article CAS PubMed PubMed Central Google Scholar
Zhou, S., Shen, Y., Zang, S., Yin, X. & Li, P. The epigenetic role of HTR1A antagonist in facilitaing GnRH expression for pubertal initiation control. Mol. Ther. Nucleic acids 25, 198–206 (2021).
Article CAS PubMed PubMed Central Google Scholar

Download references

Acknowledgements

This project is supported by the Major Science and Technology Projects of Zhejiang (2015C02012), the Zhejiang Province “Three Rural and Nine Party” Science and Technology Cooperation Project (2023SNJF059), and the International Cooperation Project of Zhejiang Academy of Agricultural Sciences in 2023.

Author information

Authors and Affiliations

State Key Laboratory for Managing Biotic and Chemical Threats to the Quality and Safety of Agro-products, Institute of Animal Husbandry and Veterinary Sciences, Zhejiang Academy of Agricultural Sciences, Hangzhou, 310021, China
Tao Yun, Jionggang Hua, Liu Chen, Weicheng Ye, Zheng Ni, Yinchu Zhu & Cun Zhang

Authors

Tao Yun
View author publications
Search author on:PubMed Google Scholar
Jionggang Hua
View author publications
Search author on:PubMed Google Scholar
Liu Chen
View author publications
Search author on:PubMed Google Scholar
Weicheng Ye
View author publications
Search author on:PubMed Google Scholar
Zheng Ni
View author publications
Search author on:PubMed Google Scholar
Yinchu Zhu
View author publications
Search author on:PubMed Google Scholar
Cun Zhang
View author publications
Search author on:PubMed Google Scholar

Contributions

Jionggang Hua, Weicheng Ye and Zheng Ni optimized the code and analyzed the raw data. Liu Chen and Yinchu Zhu helped statistical analysis. Tao Yun and Cun Zhang provided the financial support. Tao Yun drafted manuscript. Tao Yun and Cun Zhang designed the project and revised the manuscript.

Corresponding authors

Correspondence to Tao Yun or Cun Zhang.

Ethics declarations

Competing interests

The authors declare no competing interests.

Ethics approval and consent to participate

The study was approved by the Ethics Committee of Zhejiang Academy of Agricultural Sciences.

Peer review

Peer review information

Communications Biology thanks the anonymous reviewers for their contribution to the peer review of this work. Primary Handling Editors: Kaliya Georgieva. A peer review file is available.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Transparent Peer Review file

Supplementary Information

Description of Additional Supplementary Materials

Supplementary Data 1

Supplementary Data 2

Supplementary Data 3

Supplementary Data 4

Reporting Summary

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

About this article

Cite this article

Yun, T., Hua, J., Chen, L. et al. Infection with novel duck reovirus induces stress granule and methylation-mediated host translational shutoff in Muscovy ducklings. Commun Biol 7, 1549 (2024). https://doi.org/10.1038/s42003-024-07259-2

Download citation

Received: 28 May 2024
Accepted: 13 November 2024
Published: 21 November 2024
DOI: https://doi.org/10.1038/s42003-024-07259-2