Inhibition of SCFKDM2A/USP22-dependent nuclear β-catenin ubiquitylation mediates cerebral ischemic tolerance

Zuo, Yunyan; Xue, Jiahui; Wen, Haixia; Zhan, Lixuan; Chen, Meiyan; Sun, Weiwen; Xu, En

doi:10.1038/s42003-025-07644-5

Download PDF

Article
Open access
Published: 11 February 2025

Inhibition of SCF^KDM2A/USP22-dependent nuclear β-catenin ubiquitylation mediates cerebral ischemic tolerance

Yunyan Zuo^1,2^na1,
Jiahui Xue¹^na1,
Haixia Wen^1,3^na1,
Lixuan Zhan¹,
Meiyan Chen¹,
Weiwen Sun¹ &
…
En Xu ORCID: orcid.org/0000-0003-4874-6373¹

Communications Biology volume 8, Article number: 214 (2025) Cite this article

1787 Accesses
1 Citations
1 Altmetric
Metrics details

Subjects

Abstract

Hypoxic postconditioning (HPC) was reported to stabilize nuclear β-catenin by inhibiting lysine (K)-specific demethylase 2 A (KDM2A) in hippocampal CA1 against transient global cerebral ischemia (tGCI). Herein we investigate how HPC inhibits the K48-linked poly-ubiquitination (K48-Ub)-related degradation of nuclear β-catenin in CA1 after tGCI. We confirmed that SCF^KDM2A complex targets nuclear β-catenin for degradation via ubiquitin proteasome pathway in vitro. HPC reduced SCF^KDM2A complex and the K48-Ub of β-catenin, and increased ubiquitin-specific peptidase 22 (USP22) in nucleus after tGCI. Furthermore, KDM2A knockdown decreased the K48-Ub of nuclear β-catenin and nuclear β-catenin-SCF^KDM2A complex interaction after tGCI. Moreover, β-catenin knockdown suppressed nuclear survivin expression and attenuated neuroprotection induced by HPC. In contrast, the overexpression of USP22 promoted nuclear β-catenin deubiquitination and enhanced the neuroprotective effects offered by HPC. Taken together, this study supports that HPC downregulated the K48-Ub of nuclear β-catenin through suppressing SCF^KDM2A and increasing USP22, thereby inducing cerebral ischemic tolerance.

KDM3A controls postnatal hippocampal neurogenesis via dual regulation of the Wnt/β-catenin signaling pathway

Article Open access 03 March 2025

PFKFB3 ameliorates ischemia-induced neuronal damage by reducing reactive oxygen species and inhibiting nuclear translocation of Cdk5

Article Open access 21 October 2024

USP8 positively regulates hepatocellular carcinoma tumorigenesis and confers ferroptosis resistance through β-catenin stabilization

Article Open access 13 June 2023

Introduction

Acute ischemic stroke is a major health hazard that causes physical disability, cognitive impairment and even death, affecting millions of people worldwide each year¹. However, the available treatment strategies for stroke are limited. Therefore, it is of great significance to search for potential brain protectors or initiate endogenous neuroprotective mechanisms against acute cerebral ischemia. Accumulating studies have shown that β-catenin, a key component of the canonical Wingless/Int (Wnt) /β-catenin signaling pathway, plays an essential role in ischemic neuronal survival^2,3. Our previous study revealed that hypoxic postconditioning (HPC) with 8% O₂ activates the Wnt/β-catenin pathway in the hippocampal CA1 subregion, thereby restoring the level of nuclear β-catenin and alleviating neuronal damage after transient global cerebral ischemia (tGCI) in Wistar rats⁴. Recently, we demonstrated that HPC increases the methylation of nuclear β-catenin and promotes the stabilization of β-catenin in CA1 through downregulating tGCI-induced expression of lysine (K)-specific demethylase 2 A (KDM2A), which catalyzes the demethylation of nuclear β-catenin⁵. However, the underlying mechanism by which the demethylation of nuclear β-catenin catalyzed by KDM2A affects the stability of nuclear β-catenin in HPC-mediated ischemic tolerance remains unclear.

Previous research has shown that the stability of nuclear β-catenin is regulated through the ubiquitin-proteasome system (UPS)⁶. In a series of enzymatic reactions involved in ubiquitination, ubiquitin ligase (E3) is not only a key enzyme in determining substrate specificity, but also capable of generating various types of ubiquitin chains through seven internal lysine (K) residues on ubiquitin⁷. It is recognized that the K48-linked poly-ubiquitination (K48-Ub) serves as the most prominent proteolytic marker for target proteins in UPS⁸. Importantly, the SKP1-CUL1-F-box (SCF) E3 ligase complex, composed of S-phase kinase-associated protein 1 (SKP1), cullin 1 (CUL1) and one F-box protein, promotes the K48-Ub of nuclear β-catenin for subsequent degradation via the ubiquitin proteasome pathway^9,10. Notably, KDM2A acts as a kind of F-box protein in the SCF E3 ligase (SCF^KDM2A) complex to guarantee substrate recognition^11,12. Its demethylase activity is required to mediate nuclear β-catenin degradation via UPS¹³. We previously demonstrated that tGCI promoted the degradation of nuclear β-catenin by the proteasome in the CA1 region, which was reversed by HPC, whereas adenovirus-mediated KDM2A overexpression abolished the effect of HPC on nuclear β-catenin degradation⁵. Thus, it is intriguing to explore whether KDM2A acts as an E3 ligase targeting nuclear β-catenin for ubiquitylation-related degradation in a SCF^KDM2A-dependent manner during the neuroprotection induced by HPC against tGCI.

In addition to E3 ligase, ubiquitination is under negative regulation of deubiquitinating enzymes (DUBs), which hydrolyzes the peptide bonds between ubiquitin and substrates to remove ubiquitin chains and reverses ubiquitination¹⁴. So far, a few ubiquitin-specific peptidases (USPs), which belong to the family with the most members of DUB, have been identified to deubiquitinate β-catenin^15,16. Among them, USP22 has been reported strongly expressed in brain of mice, which contains a nuclear localization signal (NLS) allowing itself to shuttle between cytoplasm and nucleoplasm^17,18. Also, USP22 increases nuclear β-catenin expression in several types of cancers^19,20,21, indicating the involvement of USP22 in regulating the stability of nuclear β-catenin. There are evidences that the downregulation of USP22 is closely linked to poor prognosis in cerebral, intestinal and myocardial ischemia-reperfusion injury^22,23,24. Besides, USP22 expression was upregulated under hypoxic condition²⁵. Hence, it is worth investigating whether HPC induces USP22 expression in CA1 to catalyze nuclear β-catenin deubiquitination, thereby promoting nuclear β-catenin stabilization and mediating neuroprotection against tGCI.

Herein we aim to explore the mechanisms by which HPC regulates β-catenin ubiquitination to stabilize nuclear β-catenin in CA1 after tGCI. Specifically, HPC suppresses the formation of SCF^KDM2A E3 ligase complex after tGCI to reduce nuclear β-catenin ubiquitination. On the other hand, HPC increases USP22 expression to induce the deubiquitination of nuclear β-catenin, thereby inhibiting the degradation of nuclear β-catenin to enhance nuclear β-catenin stability and finally promoting neuronal survival after tGCI.

Results

SCF^KDM2A E3 ligase complex targets nuclear β-catenin for ubiquitylation and degradation in vitro

To reconfirm the subcellular expression pattern of β-catenin of rats after tGCI in our previous studies⁴, the in vitro experiments were conducted on primary rat hippocampal neurons. In accordance with the previous study in hippocampal CA1⁴, a progressive decline of nuclear β-catenin was observed compared with the control group, whereas no differences were found in total and cytoplasmic β-catenin at 2-24 h after oxygen-glucose deprivation/reoxygenation (OGD/R) (Fig. 1A). Next, the proteasome inhibitor MG132 was used to investigate whether OGD/R promotes nuclear β-catenin degradation through the ubiquitin-proteasome pathway. As expected, the OGD/R-induced downregulation of nuclear β-catenin was completely blocked by MG132 (Fig. 1B). Consistently, OGD/R treatment significantly increased the K48-Ub of nuclear β-catenin in primary hippocampal neurons (Fig. 1C).

**Fig. 1: KDM2A assembles the SCF^KDM2A E3 ligase complex and targets nuclear β-catenin for ubiquitylation through the F-box domain.**

In view of the regulation of KDM2A in nuclear β-catenin stability in CA1 after tGCI and the ubiquitin ligase activity of KDM2A F-box domain⁵, we investigated whether KDM2A functions as a potential ubiquitin ligase of nuclear β-catenin both in SH-SY5Y and HEK-293T cells. The immunofluorescent assay showed that the cells with Flag-KDM2A overexpression reduced the fluorescent intensity of nuclear β-catenin compared with adjacent cells without ectopic KDM2A, which was reversed by MG132. Moreover, compared to WT-KDM2A, Flag-KDM2A-∆F-box failed to affect nuclear β-catenin. Additionally, there was an enhanced signal of nuclear β-catenin when MG132 and Flag-KDM2A-∆F-box overexpression were combined in SH-SY5Y cells (Fig. 1D). Flag-KDM2A, but not the Flag-KDM2A-∆F-box, reduced nuclear β-catenin expression both in HEK-293T cells and SH-SY5Y cells. These results were further confirmed by western blot (Fig. 1E). To further determine whether the effect of KDM2A on β-catenin stability depends on its E3 ligase activity, we assessed the ubiquitination level of β-catenin in HEK-293T cells over-expressing WT-KDM2A or the F-box-deficient KDM2A mutant. As shown in Fig. 1F, WT KDM2A rather than KDM2A-∆F-box mutant significantly increased the ubiquitination of ectopic β-catenin in HEK-293T cells. To clarify the role of F-box domain of KDM2A in the assembly of SCF^KDM2A E3 ligase complex, we examined the interaction among endogenous SKP1, CUL1 and ectopic KDM2A by co-immunoprecipitation assay. The results revealed the interactions between exogenous FLAG-KDM2A and endogenous SKP1, and between exogenous FLAG-KDM2A and endogenous CUL1 in HEK-293T cells with MG132 treatment. Unlike wild-type KDM2A, KDM2A-∆F-box mutant does not interact with the endogenous SKP1 and CUL1 (Fig. 1G)

HPC reduces the K48-Ub of nuclear β-catenin and alleviates neuronal damage by inhibiting the SCF^KDM2A E3 ligase complex in CA1 after tGCI

To determine whether SKP1 and CUL1 together with KDM2A participate in HPC-mediated ischemic tolerance in rats, firstly we detected the expressions of SKP1 and CUL1 in CA1 after tGCI with or without hypoxia. As shown in Fig. 2A, SKP1-positive cells were concentrated in the pyramidal cell layer with the typical neuron-like morphology of sham-operated brain. The number of SKP1-positive neuron-like cells increased at 26 h after tGCI, while HPC inhibited this increase of neuron-like cells at the same time points of reperfusion after tGCI (Fig. 2B). Also, western blot analysis showed that HPC obviously attenuated the tGCI-induced upregulation of SKP1 in the early stage of reperfusion (Fig. 2C). However, the morphology of SKP1-positive cells markedly changed in the late stage of reperfusion. At 168 h of reperfusion after tGCI, SKP1 was expressed mainly in glia-like cells with polymorphic somata and processes. Notably, HPC reversed the increase of SKP1-positive glia-like cells and the reduction of SKP1-positive neuron-like cells induced by tGCI in the late stage of reperfusion (Fig. 2A, B). As shown in Fig. 2D, almost all SKP1-positive cells in Sham rats were neuronal nucleus (NeuN) -positive (Fig. 2D, a-h). Notably, at 168 h after tGCI, most of SKP1-positive cells were colocalized with glial fibrillary acidic protein (GFAP) (Fig. 2D, i-p), while mainly with NeuN in the HPC group (Fig. 2D, q-x).

**Fig. 2: Effects of HPC on the level and distribution of SKP1 in CA1 after tGCI.**

As shown in Fig. 3A, CUL1 immunopositive cells were seen to be distributed predominantly in the pyramidal cell layer in CA1 with a round and clear appearance. In line with SKP1, the number of CUL-positive cells increased at 26 h, while decreased markedly at 168 h after tGCI. However, when compared with tGCI groups at corresponding time points of reperfusion, the expression of CUL1 reduced in the HPC groups (Fig. 3B). The above results were further confirmed by western blot analysis (Fig. 3C). Immunofluorescent assay demonstrated that CUL1 in CA1 of Sham animals were colocalized with NeuN, only a few were colocalized with ionized calcium-binding adaptor molecule-1 (Iba-1), but not with GFAP (Fig. 3D). We also confirmed that the trend of SKP1 expression in the cytoplasmic fraction was similar to that of whole cell lysate in CA1, whereas CUL1 was less expressed in cytoplasm. There were no significant differences in cytoplasmic CUL1 between tGCI and HPC groups (Fig. 3E). Subsequently we measured SKP1 and CUL1 levels in the nucleus. In line with the expressions of total SKP1 and CUL1, the expressions of nuclear SKP1 and CUL1 were significantly increased after tGCI compared with the Sham group. However, HPC markedly reduced the tGCI-induced elevation of nuclear SKP1 and CUL1 in CA1 (Fig. 3F). Co-immunoprecipitation assay showed that the interactions of KDM2A-SKP1 and KDM2A-CUL1 were increased within the nucleus in CA1 after tGCI, which was inhibited by HPC (Fig. 3G).

**Fig. 3: Effects of HPC on the levels of CUL1 and SCF^KDM2A E3 ligase complex in CA1 after tGCI.**

Further, we observed an obvious increase of K48-Ub of nuclear β-catenin in tGCI group at 26 h and 50 h after reperfusion via co-immunoprecipitation assay. Conversely, in HPC group, the increased K48-Ub of nuclear β-catenin was reversed (Fig. 4A). To investigate the role of KDM2A in mediating the recognition of substrate β-catenin by SCF^KDM2A E3 ligase complex and subsequently catalyzing the K48-Ub of nuclear β-catenin in CA1 after tGCI, KDM2A small-interfering RNA (siKDM2A) was then utilized. The validity in inducing KDM2A silence, the maintenance for nuclear β-catenin stabilization after tGCI and the safety for CA1 neurons of siKDM2A administration had been previously confirmed⁵. As shown in Fig. 4B, nuclear KDM2A was analyzed after siKDM2A administration and the result was consistent with our previous studies⁵. There was no significant difference on nuclear CUL1 with or without siKDM2A administration. Interestingly, siKDM2A administration inhibited nuclear SKP1 in tGCI rats when compared to NC group (Fig. 4B). As expected, the increase of K48-Ub level of nuclear β-catenin and the interactions among KDM2A, CUL1, SKP1 and nuclear β-catenin in CA1 induced by tGCI were counteracted by siKDM2A administration (Fig. 4C). To clarify the relation between KDM2A-mediated demethylation and K48-Ub of nuclear β-catenin, daminozide, a potent small-molecule inhibitor of demethylase activity of KDM2A, was utilized. Daminozide at 20 μM and 40 μM up-regulated total lysine methylation of Sham rats when compared to vehicle, and the effect at 40 μM on total lysine methylation was more significant (Supplementary Fig. 1). However, no effects on total KDM2A level were observed after daminozide administration. Thus, 40 μM of daminozide was applied for subsequent studies. Further experiments confirmed that daminozide treatment reversed the tGCI-induced reductions of nuclear β-catenin and methylated β-catenin, as well as the elevation of the K48-Ub of nuclear β-catenin in CA1 at 26 h of reperfusion, whereas there were no significant differences in CA1 of Sham rats between daminozide and vehicle treatments (Fig. 4D, E).

**Fig. 4: Effects siKDM2A and daminozide on the K48-Ub of nuclear β-catenin after tGCI with or without hypoxia.**

To further support the involvement of β-catenin in HPC-mediated cerebral ischemia tolerance, the adeno-associated viruses (AAV) containing Ctnnb1 small interfering RNA (AAVi-Ctnnb1) to inhibit the expression of β-catenin was injected into bilateral CA1 region. First, the effective transfection of AAVi-CON or AAVi-Ctnnb1 in CA1 was confirmed by fluorescent images (Fig. 5A). The expression of β-catenin significantly decreased after AAVi-Ctnnb1 administration at the dosage of 7.92 × 10⁹ v.g or 15.84 × 10⁹ v.g in Sham rats, which was more effective at the higher dosage (Fig. 5B). Thus, the dosage of 15.84 × 10⁹ v.g was selected in the following experiments. As expected, AAVi-Ctnnb1 administration dramatically aggravated neuronal damage in CA1 with HPC, whereas AAVi-Ctnnb1 or AAVi-CON did not alter the numbers of surviving and NeuN-positive cells in Sham rats (Fig. 5C–E). Besides, compared with the AAVi-CON group, AAVi-Ctnnb1 significantly reduced nuclear β-catenin and survivin in CA1 of Sham and HPC rats (Fig. 5F, G).

**Fig. 5: Effects of AAVi-*Ctnnb1* administration on neuronal cell damage and survivin in CA1 after tGCI with or without hypoxia.**

HPC promotes nuclear β-catenin deubiquitination and neuronal survival through increasing nuclear USP22 in CA1 after tGCI

With immunohistochemical assay we observed that USP22-poitive cells mainly existed in the pyramidal cell layer with a neuron-like appearance in Sham and ischemic rats at 26 h of reperfusion after tGCI with or without hypoxia. However, at 168 h after reperfusion, the majority of USP22-positive cells exhibited elongated and irregular nuclei with polymorphic processes (Fig. 6A). Compared with sham-operated rats, the number of USP22-positive cells presented a sustained decrease during 26-168 h after reperfusion of tGCI. Conversely, HPC reversed tGCI-induced reductions of USP22-positive cells to a certain extent (Fig. 6B). Double-fluorescent labeling immunohistochemistry confirmed the predominant neuronal location of USP22 in Sham rats, as evidenced by the colocalization of USP22 with NeuN, but not GFAP and Iba-1. Nevertheless, at 168 h of reperfusion after tGCI, the fluorescence of USP22 was reduced. They were mainly co-labelled with GFAP, only a few with NeuN, but did not with Iba-1. Conversely, with HPC treatment, the fluorescence of USP22 was enhanced. They were mainly located in hippocampal microglia, as shown by the co-localization with Iba-1. Parts of them located in neurons, as shown by the co-localization with NeuN. Few of USP22-positive cells were astrocytes, as shown by the co-localization with GFAP (Fig. 6C). Also, the reduction of USP22 in CA1 at 26 and 50 h of reperfusion after tGCI was confirmed by western blot. Inconsistently, no statistical differences were observed in the level of total USP22 between tGCI and HPC groups (Fig. 6D). In line with total USP22, tGCI significantly down-regulated cytoplasmic and nuclear USP22 in CA1. However, HPC remarkably inhibited the reduction of nuclear USP22 induced by tGCI, but had no effect on cytoplasmic USP22 (Fig. 6E, F).

**Fig. 6: Effects of HPC on the level and distribution of USP22 in CA1 after tGCI.**

Next, we examined the interaction between USP22 and β-catenin within the nucleus after tGCI with or without hypoxia by co-immunoprecipitation assay. The results showed that the interaction between USP22 and β-catenin in the nucleus was significantly weakened at 50 h after tGCI. In contrast, HPC completely reversed this reduction induced by tGCI (Fig. 6G). Next, USP22-carried AAV vector (AAV-USP22) or AAV-Con was administrated into the bilateral CA1 (Fig. 7A). Notably, AAV-Con only carries a single mCherry without USP22. As shown in Fig. 7B, in Sham group with AAV-Con administration, the red fluorescence (mCherry) represents the effectiveness of AAV transfection, whereas in Sham group with AAV-USP22, mCherry represents the exogenous expression of USP22, which located dominantly in the nucleus of the CA1 pyramidal cells. Western blot analysis showed that USP22 expression was augmented significantly after AAV-USP22 administration in Sham rats (Fig. 7C). Similar change was observed in total β-catenin level (Fig. 7D). AAV-USP22 or AAV-Con had no impact on the neuronal number of Sham rats. Obviously, AAV-USP22 treatment markedly ameliorated neuronal damage in CA1 after tGCI, which was demonstrated by an increase in the number of surviving and NeuN-positive cells as well as a decrease in Fluoro-Jade B (F-JB)-positive cells. Additionally, an additive neuroprotective effect was observed in HPC group with AAV-USP22 administration (Fig. 7E-H).

**Fig. 7: Effects of AAV-*USP22* administration on USP22 expression and neuronal cell damage in CA1 after tGCI with or without hypoxia.**

Further, Morris water maze (MWM) test was performed to measure learning and memory functions (Fig. 8A). The swimming path tracings during the training period (learning) and probe trial (memory) in each group were shown as Fig. 8B. The escape latency and path length of rats in six groups decreased in a time-dependent manner over 5 d hidden-platform training sessions. For the rats injected with AAV-Con, the path length and escape latency in the tGCI group were significantly prolonged compared with Sham group. Inversely, HPC improved the spatial learning ability of rats at 4rd to 6th day after tGCI (Fig. 8C, D). In the probe phase, the percentage of time that rats spent in the target quadrant after removing the platform was recorded to assess memory function. As shown in Fig. 8E, HPC partially reversed the reduction induced by tGCI in target quadrant occupancy. These results were consistent with our previous study in the absence of AAV intervention⁵. Compared with AAV-Con administration, USP22 overexpression significantly enhanced the spatial learning ability and long-term memory of tGCI rats, as presented by the shorter time in the swimming path length and escape latency as well as the longer time in the target quadrant occupancy (Fig. 8B-E). Hence, the spatial learning and memory functions of rats after tGCI were effectually improved by AAV-USP22 administration.

**Fig. 8: Effects of AAV-*USP22* administration on cognitive function, the K48-Ub and methylation of β-catenin, and the expressions of β-catenin and survivin in CA1 after tGCI with or without hypoxia.**

Considering that mCherry representing exogenous USP22 mainly localized in the nucleus, we further analyzed cytoplasmic and nuclear USP22 expressions after AAV-USP22 administration and the effects of USP22 overexpression on β-catenin and downstream survivin. As shown in Fig. 8F, there was a slight increase in cytoplasmic USP22 of CA1 after treatment with AAV-USP22, but the difference was not statistically significant. Additionally, AAV-USP22 did not alter cytoplasmic β-catenin expression. Consistent to our previous study, no survivin expression could be observed in cytoplasmic fraction of CA1⁴. As expected, compared to AAV-Con group, AAV-USP22 significantly upregulated the nuclear USP22 and β-catenin in CA1 of Sham, tGCI and HPC groups. Moreover, AAV-USP22 reversed the tGCI-induced reduction of survivin in CA1 (Fig. 8G). Furthermore, the elevation of K48-Ub of β-catenin and the reduction of methylated β-catenin within nucleus in CA1 after tGCI were counteracted with AAV-USP22 treatment) (Fig. 8H).

Discussion

We previously reported that HPC reverses tGCI-induced upregulation of KDM2A, which inhibits nuclear β-catenin demethylation and promotes nuclear β-catenin stabilization, thus reducing ischemic neuronal death in CA1. In this study, we further demonstrated that HPC inhibited nuclear β-catenin degradation via the negative regulation on its ubiquitylation in two ways. Concretely, HPC suppressed the formation of SCF^KDM2A E3 ligase complex within the neuronal nucleus in CA1 after tGCI to inhibit ubiquitylation of demethylated β-catenin. On the other hand, HPC increased the expression of USP22 within the neuronal nucleus in CA1 after ischemia to promote nuclear β-catenin deubiquitination. As a result, the co-effects of HPC on SCF^KDM2A and USP22 significantly hindered nuclear β-catenin degradation through the ubiquitin-proteasome pathway, leading to nuclear β-catenin stabilization and cerebral ischemic tolerance (Fig. 9).

Fig. 9: Schematic depicting mechanism by which HPC stabilizes nuclear β-catenin and mediates anti-neuronal apoptosis via SCF^KDM2A/USP22-dependent reversible ubiquitination against transient global cerebral ischemia in rats.

As a core factor of the canonical Wnt signaling pathway, β-catenin is widely expressed in various cells of the central nervous system and plays a neuroprotective role against cerebral ischemia²⁶. For example, β-catenin is able to inhibit apoptosis, alleviates oxidative stress, hinders excessive autophagy in neurons and promotes the differentiation of neural progenitor cells toward mature neurons, thereby attenuating ischemia-induced brain damage^27,28,29,30. Astrogial β-catenin facilitate reprogramming of reactive astrocytes into neurons, inhibit astrogliosis and repair damaged blood-brain barrier^31,32,33. In this study, the administration of AAVi-Ctnnb1 significantly reduced nuclear survivin and abolished HPC-mediated neuroprotection against tGCI. These results demonstrated that β-catenin plays an essential role in the neuroprotection offered by HPC after tGCI through upregulating the expression of survivin. Growing evidences showed distinct expression patterns of subcellular β-catenin across different cerebral ischemic models and regions of interest^34,35,36. In line with our previous results in vivo⁴, β-catenin expression was decreased in the nucleus instead of the cytoplasm after OGD/R in primary hippocampal neurons. Moreover, MG132 treatment significantly reversed the downregulation of nuclear β-catenin induced by OGD/R, suggesting that OGD/R mainly promoted nuclear β-catenin degradation via the proteasome pathway. As K48-Ub is a key signal marker mediating β-catenin degradation by the proteasome in the canonical Wnt signaling pathway⁶, we further investigated whether the UPS is involved in nuclear β-catenin degradation induced by OGD/R. As expected, the K48-Ub of nuclear β-catenin was increased. Our studies in vitro and in vivo are consistent with the notion that ubiquitin-protein conjugates were increased obviously under pathological stress such as cerebral ischemia^37,38,39. On the contrary, HPC attenuated tGCI-induced elevation of the K48-Ub of nuclear β-catenin in CA1. Although hypoxia is an undisputed cellular stressor that regulates the activity and level of β-catenin⁴⁰, the mechanism by which HPC regulates the K48-Ub of nuclear β-catenin after tGCI remains unexplored.

As aforementioned, KDM2A is a potential E3 ubiquitin ligase¹¹. Our previous study showed that KDM2A overexpression promoted nuclear β-catenin degradation by the proteasome and eliminated the neuroprotection induced by HPC after tGCI⁵. The current study illustrates that KDM2A forms the SCF^KDM2A E3 ligase complex through its F-box domain and mediates the ubiquitination and following proteasome degradation of nuclear β-catenin. Notably, the increase of SCF^KDM2A complex induced by tGCI was reversed by HPC. Moreover, KDM2A silencing significantly inhibited the K48-Ub increase of nuclear β-catenin mediated by tGCI, accompanied by the decreased interaction among nuclear β-catenin and three subunits of the SCF^KDM2A complex in CA1. Although KDM2A has been reported to regulate the ubiquitination of nuclear β-catenin¹³, few studies focused on the function of SCF^KDM2A complex as a whole. Our study revealed that KDM2A regulates the K48-Ub and degradation of nuclear β-catenin in an SCF-dependent manner after cerebral ischemia.

It was documented that the UPS was activated in response to cerebral ischemia, thereby disrupting protein homeostasis and leading to neuronal death⁴¹.The generation and accumulation of a large number of ubiquitin-protein conjugates in neurons lead to the overload and functional decompensation of proteasome, which would induce neurotoxic effect and aggravate cerebral ischemic injury³⁸. As two invariant subunits of SCF complex, SKP1 and CUL1 can bind to a variety of F-box proteins in addition to KDM2A^11,42. In this study, we confirmed that tGCI significantly induced the expressions of both SKP1 and CUL1 in CA1, which were offset by the administration of HPC. Notably, the cells that expressed SKP1 and CUL1 in CA1 were predominantly neurons in the early stage after tGCI. These results suggest that tGCI promotes the generation of SCF complexes by increasing neuronal SKP1 and CUL1 in CA1, thus leading to the ubiquitination of excess substrate proteins and the decompensation of the proteasome. Conversely, HPC inhibits the formation of SCF complexes through downregulating SKP1 and CUL1, thereby protecting the proteasome from overload and mediating the neuroprotection. In addition to the UPS, astrocytes were activated after cerebral ischemia⁴³. At 168 h of reperfusion after tGCI, the predominant expression of SKP1 in astrocytes was observed, which was reversed by HPC. In view of the fact that SKP1 is an important part of UPS, we speculate that the activation of UPS might be involved in the activation of astrocytes after cerebral ischemia. While HPC inhibits astrocytic activation through hindering the formation of SCF E3 ligase complexes. Additionally, silencing KDM2A inhibited nuclear SKP1 in tGCI rats, but there was no any effect on the expression of CUL1, suggesting that KDM2A positively regulates SKP1 expression without affecting CUL1 in cerebral ischemia. After a complete literature search, we did not find relevant studies on the positive regulation of SKP1 by KDM2A. It is known that the demethylation of H3K36me2/3 mediated by KDM2A plays a role in inhibiting the transcription and expression of target gene⁴⁴. Equally important, KDM2A could negatively regulate the expression of specific substrates through the E3 ubiquitin ligase activity⁸. For this reason, SKP1 might be not a direct target of KDM2A and KDM2A indirectly up-regulates SKP1 expression through other unknown intermediate mediators. Further studies are needed to elucidate the role and regulatory mechanism of SKP1 in HPC-mediated cerebral ischemic tolerance.

USP22, a deubiquitination enzyme containing an NLS and positively regulating β-catenin^19,45, has been reported to stabilize the substrate protein through deubiquitinating enzyme activity²³. So far, the expression and exact role of USP22 in cerebral ischemia remains controversial^22,46. Xie et al. revealed that the upregulation of USP22 alleviates inflammation and hinders apoptosis caused by cerebral ischemia-reperfusion in vivo and in vitro²². Another study showed that USP22 was upregulated in OGD/R-induced pheochromocytoma-12 cells and in mouse brain tissues after middle cerebral artery occlusion/reperfusion. Conversely, USP22 knockdown exerts neuroprotective effects in cerebral ischemia/reperfusion injury⁴⁶. Our results exhibited that the overexpression of USP22 markedly ameliorated neuronal apoptosis in CA1 and improved the neurological outcome of ischemic rats. HPC enhanced the neuroprotective effects of USP22. The discrepancies in the expression and function of USP22 after ischemic stimuli may be related to different cerebral ischemia models and the duration of ischemic stimuli. The implication for the increase of USP22 in microglia in HPC group is not fully understood. Di et al. reported that USP22 could promote nuclear factor-kappa-B (NF-κB)/oligomerization domain-like receptors protein (NLRP) 3 inflammasome degradation and inhibit NLRP3 inflammasom activation in mouse peritoneal macrophages and human THP-1cells⁴⁷. Previously, we also identified that HPC alleviated microglia activation through inhibiting NLRP3 inflammasome activation after tGCI⁴⁸. Therefore, we speculate that the increase of USP22 in microglia in the HPC group at late phase of tGCI may contribute to the inhibition of NLRP3 inflammasome activation, thus suppressing the microglia activation. Further investigations are necessary to understand this interesting phenomenon.

To date, the role of USP22 subcellular localization remains controversial. It is known that the localization and function of proteins are closely related to its domains. USP22 contains an ubiquitin hydrolase domain at the carboxy-terminal, a zinc finger motif domain at the amino-terminal, and two different sequences of NLS⁴⁵. USP22 catalyzes the deubiquitylation of histone H2A and H2B in the nucleus, thus participating in gene regulation and cell-cycle progression⁴⁹. It has been demonstrated that cytoplasmic USP22 promotes nuclear translocation of key transcription factors⁵⁰. Considering that USP22 does not possess any nuclear export signals⁴⁵, it is reasonable to speculate that USP22 mainly plays a role in the nucleus, and the final destination of cytoplasmic USP22 also be cellular nucleus during mediating nuclear translocation of the substrate proteins. Despite that USP22 was detectable in both nucleus and cytoplasm of CA1 cells, cytoplasmic USP22 exhibited no significant change in our ischemic model, whereas HPC restored the tGCI-induced downexpression of nuclear USP22. These results suggested that nuclear USP22 rather than cytoplasmic, plays a major role in HPC-mediated cerebral ischemic tolerance.

Herein, we also noted that the expression of USP22 was line with the trend of β-catenin in nucleus⁴. Previous researches indicated that USP22 is a positive regulator of nuclear β-catenin in several types of cancers^19,20,21. In line with those findings, HPC reduces the K48-Ub of nuclear β-catenin and maintains the stability of nuclear β-catenin by increasing nuclear USP22 in CA1 after tGCI, thereby promoting the survival of neurons. Besides, survivin has been identified as a potential target protein of USP22. It was reported that USP22 silence by small interfering RNA reduced the expression of survivin in oral squamous cell carcinoma⁵¹. Lin et al. confirmed that USP22 could regulate survivin via deubiquitination, thereby promoting the proliferation of renal cell carcinoma⁵². Consistently, our results uncovered that USP22 overexpression significantly increased nuclear survivin in CA1 after tGCI. Hence, the expression of survivin might be regulated by β-catenin transcriptionally and USP22 post-translationally in HPC-mediated cerebral ischemic tolerance.

Actually, the intercellular function of β-catenin is regulated by the posttranslational modifications (PTMs) on its lysine residues, including ubiquitination, methylation, acetylation, and glycation. A characteristic feature of PTMs at lysine residue is the competitive relationship between different types of modification⁵³. It was reported that β-catenin methylation catalyzed by enhancer of zeste homolog 2 (EZH2) prevents β-catenin from being ubiquitinated and ultimately stabilizes β-catenin in liver cancer cells⁵⁴. Lei et al. found that methyltransferases EZH2 regulates β-catenin stability via recruiting USP7, a well-studied deubiquitinating enzyme, to mediate neuronal gene expression in neural progenitor cells⁵⁵. It follows that methylation regulates nuclear β-catenin turnover by interfering with β-catenin ubiquitination. To better understand the regulation of nuclear β-catenin stability in the neuroprotection induced by HPC after tGCI, we further studied the nature of cross-talk between KDM2A-mediated demethylation and ubiquitination of nuclear β-catenin. Treatment with daminozide, a selective demethylase inhibitor of KDM2A, significantly increased methylated β-catenin and inhibited the K48-Ub of nuclear β-catenin in CA1 after tGCI, thus promoting the accumulation of nuclear β-catenin. These findings indicates that the demethylation of β-catenin catalyzed by KDM2A is a requisite for KDM2A-mediating the K48-Ub of β-catenin in nucleus of CA1 after tGCI. Another characteristic feature of PTMs at lysine residue is reversibility, such as methylation/demethylation and ubiquitination/deubiquitination⁵³. Our data revealed that nuclear β-catenin deubiquitination induced by USP22 overexpression significantly increased the methylation of nuclear β-catenin after tGCI. Therefore, USP22 may couple with KDM2A to mediate the crosstalk between ubiquitination/deubiquitination and methylation/demethylation of nuclear β-catenin in HPC-offered neuroprotection against cerebral ischemia.

Finally, the limitations of our study should be mentioned. Although we demonstrated that β-catenin was involved in HPC-mediated neuroprotection against tGCI as a substrate of KDM2A for ubiquitination, we could not completely rule out whether KDM2A modulated other downstream factors besides β-catenin in such situation. Therefore, β-catenin might not be alone as the direct mediator of neuroprotection against tGCI after removal of KDM2A. In addition, considering that the ubiquitination of β-catenin could be reduced by the inhibition of demethylase activity of KDM2A and the methylation of β-catenin increased by USP22, we speculate that there may be a competition between the methylation and ubiquitination modification of β-catenin. However, no direct results were available to confirm whether KDM2A and USP22 regulate methylation and ubiquitination on the same lysine residue of β-catenin. Future studies will be needed to focus on the high-throughput analyses of protein methylation and ubiquitination and the identification of specific substrate subsets of KDM2A and USP22.

In conclusion, our findings uncovered the regulatory mechanisms of nuclear β-catenin ubiquitylation in the neuroprotection mediated by HPC against tGCI and the relation between ubiquitylation and methylation in HPC-induced nuclear β-catenin stabilization. Briefly, HPC inhibits the K48-Ub of nuclear β-catenin in CA1 through suppressing the assembly of the SCF^KDM2A complex and upregulating nuclear USP22 after tGCI. Further, the upregulation of nuclear USP22 induced by HPC promotes the methylation of nuclear β-catenin after USP22-mediated deubiquitination, which enhances the stability of nuclear β-catenin in CA1 and protects ischemic neuron against cerebral ischemia. Elucidation of the molecular mechanism underlying nuclear β-catenin PTMs mediated by SCF^KDM2A complexes and USP22 may provide novel therapeutic targets for ischemic stroke.

Methods

Culture of primary hippocampal neurons and cell lines

For isolation and culture of primary hippocampal neurons, the hippocampi was isolated from embryos at 18 day (E18) of gestational Wistar rats provided by Southern Medical University, Guangzhou, China. Embryonic hippocampal tissues were gently minced into pieces using a sterile scalpel and incubated with 0.25% trypsine (Gibco, Cat# 25200-072) at 37 °C for 15 min. The plating medium prepared from Dulbecco’s Modified Eagle’s Medium (DMEM) (Gibco, New York, USA, Cat# C11995500BT), 10% F12 (Gibco, New York, USA, Cat# 11765-054), 10% newborn calf serum (Gibco, Cat# 16000-044) and 50 μg/mL of penicillin and streptomycin (Gibco, Cat# 15140-122) was used to stop the enzymatic reaction. Following 5 min of centrifugation at 1000 rpm, supernatant was discarded. The precipitate was mixed with 1 mL plating medium mentioned above. After standing for 1 min, the upper cell suspension was collected. Then, the steps of suspension and collection were repeated twice. For the immunoblotting, the cells were seeded onto Poly-D-Lysine (Pricella, Wuhan, China, Cat# PB180523) coated 6-well plates (Corning) at a density of 1×10⁶ cells/well. For fluorescence assays, cells were seeded on PolyD-Lysine coated 24-well plates (Corning) at a density of 2×10⁵ cells/well. After 4 h, the plating medium was replaced with neurobasal feeding medium, which was composed of neurobasal medium (Gibco, Cat# 21103-049), B-27 (Gibco, Cat# 17504-044) and 0.5% L-glutamine (Gibco, Cat# 25030081) and 50 μg/mL of penicillin and streptomycin (Gibco, Cat# 15140-122). The hippocampal cells were cultured in a 37 °C normoxic incubator with 5% CO₂ and 95% air. To reduce the fibroblasts and the glial cells, cytarabine (Sigma-Aldrich, USA, Cat# C1768) was dissolved in DMSO to form a 5 mM stock solution which was diluted at 1:1000 with neurobasal feeding medium prior to supplementation at 5 µM for 24 h incubation. The neurons were fed every 2 days by removing half of the old media and replacing it with the same volume of fresh neurobasal feeding medium. After 7 days of culture, primary hippocampal neurons were subjected to OGD/R to mimic cerebral ischemia-reperfusion injury.

For cell cultures, human neuroblastoma SH-SY5Y cells and human embryonic kidney HEK-293T cell lines were obtained from the American Type Culture Collection (ATCC). Then, these cells were fed with Dulbecco’s Modified Eagle’s Medium (Gibco, New York, USA, Cat# 8121336) supplemented with 10% newborn calf serum (Gibco, Cat# 16000- 044), 50 μg/mL of penicillin and streptomycin (Gibco, Cat# 15070063) and cultured in a 37°C incubator with 5% CO₂.

OGD/R model construction and drug treatment

For the OGD/R procedure, hippocampal neurons were gently washed with phosphate-buffered saline (PBS, pH7.4) (Gibco, Cat# 10010-023) for 3 times and then were cultured with glucose-free and serum-free DMEM (Gibco, Cat# RPMI-1640) medium in a sealed chamber (Billups-rothenberg, USA) pre-flushed with a mixture of 95% N₂ and 5% CO₂ for 5 min at a flow rate of 30 L/min. The anaerobic chamber was placed in an incubator for 90 min at 37 °C in 5% CO₂. Subsequently, the cultures were replaced with the regular neurobasal feeding medium and returned to a normoxic incubator for reoxygenation. The samples were collected at certain indicated time for following experiments. Normal controls were obtained from the neurons that were kept in medium containing glucose and under normoxic condition throughout the experiment. To inhibit proteasome, the cultures were treated with 20 μM MG132 (Sigma-Aldrich, USA, Cat# C2211) for 6 h before cell collection.

Plasmids construction and transfection

The plasmids carrying the sequence of rat KDM2A, β-catenin and the corresponding negative control sequence were constructted by Genechem (Shanghai, China). As previously described⁵, the fusion gene containing rat KDM2A (GenBank accession number NM_001108515) and N-terminal NLS sequence was cloned into the CMV-MCS-3FLAG-SV40-EGFP (GV314) vector. The KDM2A-∆F-box mutant deleted for the amino acids 888-935 was generated and subcloned into GV314 vector containing a N-terminal Flag tag and a NLS. Besides, full-length Rat β-catenin (GenBank accession number NM_053357) was cloned into the CMV-MCS-Myc-SV40-mcherry (GV230) vector, which containing a NLS.

Cells were implanted in a 6-well plate and were transfected with different plasmids after reaching 80% confluence. For each well transfection, 3 ug plasmids and 9 ug transfection reagents were dissolved in 125 uL Opti-MEM (Gibco, Cat# 31985-070) for 5 min, mixed for 20 min and then added to cell medium. Notably, SH-SY5Y cells transfection was mediated by Lipofectamine 2000 transfection reagent (Invitrogen, Cat# 11668019) according to the manufacturer’s instruction and the medium was DMEM (Gibco, New York, USA, Cat# 8121336) during transfection. After 6 h of transfection, medium was replaced with fresh complete medium prepared with 40% DMEM, 10% newborn calf serum, 50 μg/mL of penicillin and streptomycin. For HEK-293T cells transfection, polyethylenimine (MilliporeSigma, Cat# 408727) was used as transfection reagent and cells was in incubated with fresh complete medium during transfection. The corresponding empty plasmid was used as a supplement to ensure that cells from different pores were transfected the same number of plasmids in the same experiment.

Immunocytochemistry

The cultured cells were fixed with 4% cold paraformaldehyde (PFA) prepared in PBS for 10 min, and then permeabilized with 0.2% triton X-100 for 15 min and blocked with 5% normal serum for 1 h. Cells were incubated overnight at 4 °C with mouse anti-Flag (1:200; MilliporeSigma, Cat# F4049, RRID: AB_439701) and rabbit anti-β-catenin (diluted 1:200). After that, the cells were incubated with the following secondary antibodies: goat anti-rabbit IgG H&L (Alexa Fluor^TM 4647) (1:200; Cat# A21244, Invitrogen) and Cy3-conjugated goat anti-mouse IgG antibody (1:200; Cat# AP124C; MilliporeSigma). Next, slides were mounted with mounting medium containing 4’, 6-diamidino-2-phenylindole (DAPI). Fluorescent images were captured and analyzed with a confocal laser microscope (SP8, Leica Microsystems).

In vivo ubiquitination assay

For in vivo ubiquitylation assay, at 24-48 h after transfection, HEK-293T cells were treated with MG132 for 6 h to avoid polyubiquinated β-catenin degradation and thus increase the sensitivity of detection. HEK-293T cells were collected and separated using a NE-PER nuclear cytoplasmic extraction reagent kit (Pierce, Rockford, IL, USA) according to the manufacturer’s protocol. For immunoprecipitation, 20% of nuclear lysates was mixed directly with 2x Laemmli sample buffer (Bio-RAD, Cat# 1610737) and used as input on western blot. The rest were incubated with a mouse monoclonal antibody against Myc (1:50; Abcam, Cat# ab32) for immunoprecipitation. The ubiquitylation levels of exogenetic β-catenin were determined by western blot with rabbit anti-HA (1:2000; Abcam, Cat# ab9110) and mouse anti-Myc (1:1000) antibody.

Animals

Adult male Wistar rats (weighing 220–280 g, 7–8 wk old) were obtained from Southern Medical University, Guangzhou, China. Before the experiment, these rats were kept in a specific-pathogen-free and temperature-controlled (21–23°C) environment with a relative humidity of 50-60%, a light/dark cycle of 12-h/12-h, as well as allowed free access to water and food for at least 1 week. All animal procedures were conducted in strict accordance with the Animal Research: Reporting In Vivo Experiments (ARRIVE) guidelines. Experiments involving animals were approved by the Animals Care and Use Committee of Guangzhou Medical University (Guangzhou, China). All relevant ethical regulations for animal use were complied. Every effort had been made to reduce the amount, suffering and distress of the animals on the basis of ensuring the needs of the experiments.

In total, 497 rats were used. Four rats in the tGCI and 3 in the HPC groups died during the tGCI procedure. Three rats in the tGCI and 3 in the HPC groups died after the tGCI procedure. In addition, 4 rats died during HPC process and 4 died during anesthesia. Eighteen rats that presented with convulsion and dyspnea after ischemia were also excluded.

Experimental models

An improved four-vessel occlusion method was used to establish tGCI model. Briefly, animal anesthesia was induced with 3-4% isoflurane in a box flowing with air at 2 L/min and maintained with 1.5-2.5% isoflurane in air at 800 mL/min, delivered through a nasal mask (SurgiVet, Waukesha, WI, United States) during the whole operation. After cauterizing bilateral vertebral arteries, a teflon/silastic occluding device was assembled loosely around the two carotid arteries to separate the common carotid arteries without blocking blood flow. At 24 h after operation, global cerebral ischemia was induced by blocking the blood flow of both common carotid arteries in awake rats for 10 min. Rats that had mydriasis and lost righting reflex within 1 min were enrolled for the following experiments. The sham-operated (Sham) rats received the same surgical procedures without the interruption of common carotid arteries for 10 min. All operations are performed under aseptic conditions by mature technicians.

Then, rats were treated with the HPC process by exposure to flowing mixed gas (8% O₂ + 92% N₂) in a sealed chamber of 9000 cm³ for 120 min at 24 h after 10-min ischemia. For hypoxia treated groups, rats were exposed to 120-min hypoxia at 24 h after sham-operation without tGCI.

Western blot

Cultured cells were collected at 2, 6, 12 and 24 h after OGD/R or 24-48 h after transfection by immersing in cold PBS for 3 times and then centrifuging at 3000 rpm at 4 °C for 3 min. To obtain tissue samples, rats were sacrificed at 0, 4, 26, and 50 h after reperfusion with or without hypoxia, respectively. Bilateral hippocampal CA1 subregions of each group were immediately dissected under the stereomicroscope. Total, cytosolic, and nuclear proteins were extracted as previously described^4,56. The nuclear and cytosolic proteins of cell and tissue samples were extracted with NE-PER nuclear cytoplasmic extraction reagent kit (Pierce, Rockford, IL, USA). According to the manufacturer’s protocol, cytoplasmic protein lysate (composed of cytoplasmic protein lysate CERI, protein phosphatase inhibitor, and protease inhibitor phenylmethylsulfonyl fluorid (PMSF) at a ratio of 100:1:1was added to cell or tissue samples. Next, samples were homogenized on ice and left for 10 min. After swirling for 5 s, cytoplasmic protein lysate CERII was added and continued vortexing for 5 s, and then left for 1 min on ice. The homogenate was centrifuged at 16000 g/min in a 4 °C centrifuge for 5 min, and the supernatant was collected carefully as cytoplasmic fraction. Afterwards, the pellets were re-suspended with nucleolysis solution (which was composed of nucleolysis solution NER, protein phosphatase inhibitor and protease inhibitor PMSF at a ratio of 100:1:1) on the ice for 50 min, during which oscillation was carried out for 15 s every 10 min. After centrifuging for 10 min at 16000 g/min at 4 °C, the supernatant was saved as nuclear fraction. The purity of each fraction was guaranteed by detecting the expression of corresponding reporters, including Lamin B1, glyceraldehyde 3-phosphate dehydrogenase (GAPDH), β-tubulin, and proliferating cell nuclear antigen (PCNA). Western blot was performed as described previously⁵⁷ with the primary antibodies, including rabbit anti-β-catenin (1:4000; Abcam, Cambridge, MA, USA, Cat# ab32572, RRID: AB_725966), rabbit anti-K48 Ub (1:4000; Abcam, Cambridge, MA, USA, Cat# ab14060, RRID: AB_2783797), rabbit anti-Flag (1:2000; Abcam, Cat# ab205606), KDM2A (1:2000; Abcam, Cat# ab191387), rabbit anti-SKP1 (1:2000; Abcam, Cambridge, MA, USA, Cat# ab76502, RRID: AB_1524396), rabbit anti-CUL1 (1:6000; Abcam, Cambridge, MA, USA, Cat# ab75817, RRID: AB_1310103), rabbit anti-USP22 (1:4000; Abcam, Cambridge, MA, USA, Cat# ab195289, RRID: AB_2801585), rabbit anti-survivin (1:2000; Abcam, Cat# ab76424, RRID: AB_1524459), rabbit anti-methylated lysine (1:2000; Abcam, Cat# ab76118, RRID: AB_1523945), rabbit anti-Lamin B1 (1:2000; Proteintech Group, Cat# 12987-1-AP, RRID: AB_2136290), mouse anti-GADPH (1:10000; Proteintech Group, Cat# 60004-I-Ig, RRID: AB_2107436), rabbit anti-PCNA (1:2000; Abcam, Cat# ab29, RRID: AB_303394) and mouse anti-β-tubulin (1:10,000; Proteintech Group, Wuhan, China, Cat# 10094-1-AP, RRID: AB_2210695). Optical densities analysis for the quantification of the bands was performed with ImageJ (NIH, Bethesda, MD, United States) and then calibrated with Lamin B1, GAPDH or PCNA as well as normalized to those in negative control (NC) cells or Sham rats.

Immunoprecipitation

To determine the K48-Ub of nuclear β-catenin, the interaction among KDM2A, SKP1 and CUL1, as well as the binding of β-catenin to three subunits of the SCF^KDM2A complex in vitro and in vivo, an amount of 0.2 mg of nuclear proteins from each group was incubated with indicated antibodies, including a rat anti-β-catenin (diluted 1:75) or a rat anti-Flag (diluted 1:50) or a rat anti-KDM2A (diluted 1:50) overnight at 4 °C. Next, the protein/antibody complexes were added to protein A/G agarose beads (MilliporeSigma, Cat# IP05) with agitation for 4 h at 4 °C. The immuno-complexes were eluted with cold PBS containing 1% Tween by centrifugation at 10000 rpm at 4°C for 3 min, and then replaced carefully PBS. After repeating centrifugation steps described-above 5 times, bound proteins were collected and eluted via boiling in 15 uL of 2x Laemmli sample buffer (Bio-RAD, Cat# 1610737) prior to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The eluted proteins were analyzed by western blot with indicated antibodies. Densitometric analysis for the quantification of the relative precipitated protein bands were calibrated with the bands of β-catenin or KDM2A and normalized to those in NC cells or Sham rats.

Immunohistochemistry

Rats were perfused intracardially with normal saline (NS), followed by a cold PBS mixture of 4% PFA and 1% glutaraldehyde at 0, 4, 26, 50, and 168 h after reperfusion of tGCI with or without hypoxia, respectively. Next, brain tissues were postfixed with 10%, 20% and 30% sucrose with the above fixation as the solvent. Brains specimens were sliced into 30-μm-thick coronal sections with cryotome (Leica, Wetzlar, Hessen, Germany) at -22 °C. The slices containing dorsal hippocampus (between anterior-posterior (AP) 4.8 and 5.8 mm, interaural or AP-3.3 to 3.4 mm, bregma) were collected for immunohistochemistry.

Single-label immunohistochemistry was undertaken with the avidin-biotin complex (ABC) peroxidase method as described previously⁵⁸. In short, brain slices were incubated with 3% hydrogen peroxide for 30 min at room temperature, followed by 5% normal serum for 1 h. Meanwhile, primary antibodies including rabbit anti-SKP1 (1:200), rabbit anti-CUL1 (1:2000), rabbit anti-USP22 (1:100) and mouse against neuronal nucleus (NeuN) (1:600; MilliporeSigma, Cat# MAB377, RRID: AB_2298772) were prepared with PBS containing 0.2% Triton and 5% BSA. Then, primary antibody incubation was performed in chromatography freezer (Cat# GYCX-890) overnight and the secondary antibody was incubated with biotinylated IgG at room temperature for 2 h. After incubation of primary and secondary antibodies, the sections were washed with PBS for 6 times. Subsequently, the sections were incubated with the ABC peroxidase for 30 min at room temperature. Eventually, DAB substrate kit (Abcam, Cat# ab64238) was applied to visualization of the peroxidase reaction according to the instructions. The light microscope (Leica Microsystems, Wetzlar, Hessen, Germany) was adopted for observation and capture. For semi-quantitative assessment, immunopositive cells were counted within 3 non-repeated random fields (0.037mm²/field×3 = 0.111mm² in total) in CA1 and data were quantified bilaterally in 4 sections from each rat with double-blind method.

Double-fluorescent labeling immunohistochemistry was utilized to observe cell types and the subcellular location of SKP1 and CUL1 in CA1. As described previously⁵⁹, NeuN, glial fibrillary acidic protein (GFAP) and ionized calcium binding adaptor molecule-1 (Iba-1) were used to confirm neuron, astrocytes and microglia, respectively. Antibodies used in this part of experiments included rat anti-SKP1 (1:100) and rat anti-CUL1 (1:200), rabbit anti-USP22 (1:50; Cat# HPA044980, Sigma), mouse anti-NeuN (1:1000), mouse anti-GFAP (1:3000; MilliporeSigma, Cat# MAB360, RRID: AB_2109815), mouse anti-Iba-1 (1:500, Millipore, Cat# MABN92), goat anti-rabbit IgG H&L (Alexa Fluor® 488) (1:100; Cat# ab150077, Abcam) and Cy3-conjugated goat anti-mouse IgG antibody (1:100; Cat# AP124C; MilliporeSigma).

KDM2A RNAi knockdown

To inhibit KDM2A expression, three sequences of KDM2A small-interfering RNAs (siKDM2A) were designed by BlueLife Biotechnology (Guangzhou, Guangdong, China), as described previously⁵. The best-performing siKDM2A, whose sequence was GCCAACGAATTGAGCTCAA, was purchased from RIB Bio (Guangzhou, Guangdong, China) and dissolved with normal RNase free water for following experiments. Then, hemagglutinating virus of Japan HVJ-E vector kit (CosmoBio, Tokyo, Japan, Cat# 808920) were utilized for effective delivery of siRNA to CA1 region by membrane-fusion activity of fusion protein. On the basis of manufacturer’ protocols, the HVJ-E siKDM2A complex or NC vector was a blend of HVJ-E and equivalent siKDM2A solution (10 μL; 2 μg/μL) or equivalent sterilized RNase free water. Twenty-four hours before tGCI, the above complexes at 5-μL were delivered to the bilateral CA1 region (3.5 mm posterior to bregma, both 2.3 mm lateral to bregma, and 2.5 mm below the dura) of rats by stereotaxic injection using a 25-μL Hamilton syringe with a 34-gauge needle and micro-injection pump (No. D-306370, Harvard Apparatus) at a flow rate of 0.5 μL/min. Rats were sacrificed at 50 h after injection of vectors in Sham or 26 h after reperfusion in tGCI group.

Pharmacologic interventions

To inhibit KDM2A demethylase activity, daminozide (Cat# HY-13643, MedChemExpress) or vehicle (isometric normal saline) was intracerebrally injected into the right ventricle (1.0 mm posterior, 1.5 mm lateral, and 3.6 mm dorsal with respect to bregma) at 48 h before tGCI (at 48 h before ischemia in tGCI rats and at 24 h after sham-operation in Sham rats). The stereotaxic injection was performed via a 25 μL Hamilton syringe at a speed of 1 μL/min.

Adeno-associated virus construction and administration

Plasmids containing the sequence of rat USP22 (GenBank accession number NM_001191644) were designed by Genechem (Shanghai, China). Briefly, USP22 sequence was inserted into KpnI and BamHI sites of CMV bGlobin-MCS-mCherry-3FLAG-WPRE-hGH polyA (GV389) adeno-associated virus (AAV) vector. The titers were approximately 1.13×10¹³v.g./mL. As mentioned above, a 2-μL volume containing 1×10¹⁰ v.g./mL particles of scrambled AAV vector (AAV-control, AAV-Con)/AAV-USP22 was respectively injected into bilateral hippocampal CA1 region using a 25-μL Hamilton syringe with a 34-gauge needle and micro-injection pump at a speed of 0.5 μL/min.

Three small-interfering RNA sequences targeted rat β-catenin (Ctnnb1, GenBank accession number NM_053357.2) and a negative control vector were designed by Genechem (Shanghai, China). The sequences for Ctnnb1-RNAi 1, 2, 3 were ACCGGGCAGTTTGATGCCGCTCATCCTTCAAG AGAGGATGAGCGGCATCAAACTGCTTTT; ACCGGGCTGCATAATCTCCTGCTACATTCAAG AGATGTAGCAGGAGATTATGCAGCTTTT and ACCGGGCTTACGGCAATCAGGAAAGCTT CAAGAGAGCTTTCCTGATTGCCGTAAGCTTTT, respectively. Briefly, RNAi was inserted into the U6-MCS-CAG-EGFP (GV478) AAV8 vector according to the manufacture’s instruction. The shuttle vector and viral packaging system were cotransfected into AAV-293 cells, which derived from HEK293 cells, to produce recombinant AAV particles. The best-performing Ctnnb1-RNAi sequence was Ctnnb1-RNAi 3. Therefore, Ctnnb1 RNAi 3 was used for subsequent experiments. The titers were ~1.98 × 10¹²v.g/mL. To select the best inhibitory dose, 1 or 2 or 4-ul AAV was injected into rat hippocampal CA1, respectively. Subsequently, two 4-μL volume containing 15.84 ×10⁹v.g of particles was bilaterally injected into CA1 region.

After the AAV treatment, rats were allowed to recover for up to 14 days to ensure the overexpression of target gene before being used for the following experiments.

Assessment of cellular damage

Nissl, NeuN and F-JB staining were conducted to evaluate the effects of AAV on neuronal damage in the CA1 region at 168 h after reperfusion of tGCI with or without hypoxia. Details of cresyl violet and F-JB powders as well as specific procedures are available from our previous study⁶⁰. NeuN staining was performed with the single-label immunohistochemistry described above using anti-NeuN primary antibody. Then, Nissl-, NeuN- and F-JB-stained images were captured with an inverted fluorescent microscope (Leica Microsystems, Wetzlar, Hessen, Germany). Immunoreactive cells in CA1 were analyzed as above-mentioned.

Morris water maze test

Morris water maze (MWM) test was performed as previously described⁵. In brief, the maze consists of a circular black pool with a diameter of 210 cm and a height of 60 cm (Taimeng Technology Co., Ltd, Chengdu, China) which was pre-filled with clear water (23 ± 1 °C, 20 cm in depth). The pool was divided into four equal-sized quadrants (Q1, Q2, Q3 and Q4), and a transparent platform (escape platform) with a diameter of 10 cm was placed 2.0 cm below the water surface of Q1. The MWM test includes two periods of the training period and probe trial. During the training period, the platform remained in the same location. For 5 consecutive days from the 2^nd day after tGCI, rats were placed in the water pool facing toward the wall and the fixed starting point of every quadrant was used in a different order each day. All rats completed the training to find the platform within 120 s and then stayed on the platform for 15 s. When failed to find the hidden platform, rats were guided to there, an escape latency of 120 s was recorded. Rats were subjected to 4 sequential trains per day with a 10-min interval between each session. The path length and the escape latency for each trial were recorded. At 7^nd day after tGCI, a 30-sec probe trial was conducted without the platform. Rats were put into a maze at a fixed starting point farthest from the platform position during training. The time and percentage in the target quadrant occupancy were recorded. To minimize variability in the performance of rats, the experiment place should be keep quiet, the location of various experimental equipment is fixed, and all the experiments are conducted at the same time each day. Data from each trial was recorded using a video tracking system (SMART, Polyvalent video-tracking system, 35B73-C6C, PANLAB, Spain).

Statistics and Reproducibility

Statistical analyses were performed with Statistical Package for Social Sciences Software for Windows, version 25.0 (SPSS, Inc., Chicago, IL, USA). The group size “n” simply refers to biologically independent cell/animal experiments rather than technical replications. The evaluation of sample size was based on our and others published studies and the results from our preliminary experiments in this study. All data represent at least 3 independent experiments. For comparison between two groups conforming to the normal distribution, the unpaired two-tailed Student’s t-test was applied. Multiple comparisons were conducted using one-way ANOVA when the data between Sham and tGCI groups were normally distributed. Analyses were followed by a Bonferroni or Tamhane’s T2 post hoc test according the results of homogeneity of variance test. When the data did not conform to normal distribution, nonparametric tests were used, including Mann-Whitney’s U test for the comparison between two groups and Kruskal-Wallis’ for multiple comparisons. As the data from path length, escape latency, and swimming speed are repeatedly measured and time-dependent variables, these data were treated with Mauchly’s test of sphericity and Multivariate Analysis of Variance (MANOVA). Data graphing was performed with GraphPad Prism version 6.0. All variables were expressed as mean ± standard deviation (SD) and represented by scatter plots. Values of p < 0.05 were considered statistically significant. The exact p value was also described in the figure legends.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

The underlying source data for this study can be found in the Supplementary Data file and DRYAD repository at https://doi.org/10.5061/dryad.q573n5tt0. The uncropped and unedited blot images are available in the Supplementary Figs. The numerical source data for the graphs are available in the file Supplementary Data 1. All other data are available from the corresponding author on reasonable request.

Code availability

The analyzing code for the integration data set is available from DRYAD repository at https://doi.org/10.5061/dryad.q573n5tt0.

References

Martin, S. S. et al. 2024 Heart Disease and Stroke Statistics: A Report of US and Global Data From the American Heart Association. Circulation 149, e347–e913 (2024).
Article PubMed Google Scholar
He, X. et al. Role of Wnt/beta-catenin in the tolerance to focal cerebral ischemia induced by electroacupuncture pretreatment. Neurochem Int 97, 124–132 (2016).
Article CAS PubMed Google Scholar
Zhang, B., Zheng, G., Han, Y., Chen, X. & Jiang, Q. Ilexonin A Promotes Neuronal Proliferation and Regeneration via Activation of the Canonical Wnt Signaling Pathway after Cerebral Ischemia Reperfusion in Rats. Evid. Based Complement Altern. Med. 2016, 9753189 (2016).
Article Google Scholar
Zhan, L. et al. Hypoxic postconditioning activates the Wnt/beta-catenin pathway and protects against transient global cerebral ischemia through Dkk1 Inhibition and GSK-3beta inactivation. FASEB J. 33, 9291–9307 (2019).
Article CAS PubMed Google Scholar
Zuo, Y. et al. Stabilization of nuclear beta-catenin by inhibiting KDM2A mediates cerebral ischemic tolerance. FASEB J. 37, e22796 (2023).
Article CAS PubMed Google Scholar
Paul, D. et al. F-box protein FBXO16 functions as a tumor suppressor by attenuating nuclear beta-catenin function. J. Pathol. 248, 266–279 (2019).
Article CAS PubMed PubMed Central Google Scholar
Kud, J. et al. Functional Characterization of RING-Type E3 Ubiquitin Ligases In Vitro and In Planta. J. Vis. Exp. 5, 154 (2019).
Google Scholar
Lim, K., Song, M. & Baek, K. Decision for cell fate: deubiquitinating enzymes in cell cycle checkpoint. Cell Mol. Life Sci. 73, 1439–1455 (2016).
Article CAS PubMed PubMed Central Google Scholar
Xue, J. et al. (2015) Tumour suppressor TRIM33 targets nuclear beta-catenin degradation. Nat. Commun. 6, 6156 (2015).
Article CAS PubMed Google Scholar
Chitalia, V. et al. c-Cbl, a ubiquitin E3 ligase that targets active beta-catenin: a novel layer of Wnt signaling regulation. J. Biol. Chem. 288, 23505–23517 (2013).
Article CAS PubMed PubMed Central Google Scholar
Gorelik, M. et al. A Structure-Based Strategy for Engineering Selective Ubiquitin Variant Inhibitors of Skp1-Cul1-F-Box Ubiquitin Ligases. Structure 26, 1226–1236 (2018).
Article CAS PubMed PubMed Central Google Scholar
Liu, X. et al. KDM2A Targets PFKFB3 for Ubiquitylation to Inhibit the Proliferation and Angiogenesis of Multiple Myeloma Cells. Front Oncol. 11, 653788 (2021).
Article CAS PubMed PubMed Central Google Scholar
Lu, L. et al. Kdm2a/b Lysine Demethylases Regulate Canonical Wnt Signaling by Modulating the Stability of Nuclear beta-Catenin. Dev. Cell 33, 660–674 (2015).
Article CAS PubMed Google Scholar
Kowalski, J. R. & Juo, P. The role of deubiquitinating enzymes in synaptic function and nervous system diseases. Neural Plast. 2012, 892749 (2012).
Article PubMed PubMed Central Google Scholar
Yang, B. et al. Deubiquitinase USP9X deubiquitinates beta-catenin and promotes high grade glioma cell growth. Oncotarget 7, 79515–79525 (2016).
Article PubMed PubMed Central Google Scholar
Ma, P. et al. The ubiquitin ligase RNF220 enhances canonical Wnt signaling through USP7-mediated deubiquitination of beta-catenin. Mol. Cell Biol. 34, 4355–4366 (2014).
Article PubMed PubMed Central Google Scholar
Lee, H. J. et al. The expression patterns of deubiquitinating enzymes, USP22 and Usp22. Gene Expr. Patterns 6, 277–284 (2006).
Article CAS PubMed Google Scholar
Melo-Cardenas, J., Zhang, Y., Zhang, D. & Fang, D. Ubiquitin-specific peptidase 22 functions and its involvement in disease. Oncotarget 7, 44848–44856 (2016).
Article PubMed PubMed Central Google Scholar
Ning, Z. et al. USP22 promotes the G1/S phase transition by upregulating FoxM1 expression via beta-catenin nuclear localization and is associated with poor prognosis in stage II pancreatic ductal adenocarcinoma. Int J. Oncol. 45, 1594–1608 (2014).
Article CAS PubMed Google Scholar
Jiang, S. et al. MiR-30-5p suppresses cell chemoresistance and stemness in colorectal cancer through USP22/Wnt/beta-catenin signaling axis. J. Cell Mol. Med. 23, 630–640 (2019).
Article CAS PubMed Google Scholar
Xin, R., Li, W., Hu, Z., Wu, Z. & Sun, W. MiR-329-3p inhibits hepatocellular carcinoma cell proliferation and migration through USP22-Wnt/beta-Catenin pathway. Eur. Rev. Med. Pharm. Sci. 24, 9932–9939 (2020).
Google Scholar
Xie, X., Cao, Y., Dai, L. & Zhou, D. Bone marrow mesenchymal stem cell-derived exosomal lncRNA KLF3-AS1 stabilizes Sirt1 protein to improve cerebral ischemia/reperfusion injury via miR-206/USP22 axis. Mol. Med. 29, 3 (2023).
Article CAS PubMed PubMed Central Google Scholar
Ma, S. et al. USP22 Protects Against Myocardial Ischemia-Reperfusion Injury via the SIRT1-p53/SLC7A11-Dependent Inhibition of Ferroptosis-Induced Cardiomyocyte Death. Front Physiol. 11, 551318 (2020).
Article PubMed PubMed Central Google Scholar
Ji, A. et al. Ubiquitin-specific protease 22 enhances intestinal cell proliferation and tissue regeneration after intestinal ischemia reperfusion injury. World J. Gastroenterol. 25, 824–836 (2019).
Article CAS PubMed PubMed Central Google Scholar
Qiu, G. et al. Hypoxia-induced USP22-BMI1 axis promotes the stemness and malignancy of glioma stem cells via regulation of HIF-1alpha. Life Sci. 247, 117438 (2020).
Article CAS PubMed Google Scholar
Mo, Z. et al. Activation of Wnt/Beta-Catenin Signaling Pathway as a Promising Therapeutic Candidate for Cerebral Ischemia/Reperfusion Injury. Front Pharm. 13, 914537 (2022).
Article CAS Google Scholar
Pan, W. & Xu, Z. Triptolide mediates Wnt/beta-catenin signalling pathway to reduce cerebral ischemia-reperfusion injury in rats. Folia Neuropathol. 58, 324–333 (2020).
Article PubMed Google Scholar
Mu, Q. et al. NPD1 inhibits excessive autophagy by targeting RNF146 and wnt/beta-catenin pathway in cerebral ischemia-reperfusion injury. J. Recept Signal Transduct. Res. 40, 456–463 (2020).
Article CAS PubMed Google Scholar
Hu, Z. et al. Momordica charantia polysaccharides modulate the differentiation of neural stem cells via SIRT1/Beta-catenin axis in cerebral ischemia/reperfusion. Stem Cell Res. Ther. 11, 485 (2020).
Article PubMed PubMed Central Google Scholar
Kaga, S., Zhan, L., Altaf, E. & Maulik, N. Glycogen synthase kinase-3beta/beta-catenin promotes angiogenic and anti-apoptotic signaling through the induction of VEGF, Bcl-2 and survivin expression in rat ischemic preconditioned myocardium. J. Mol. Cell Cardiol. 40, 138–147 (2006).
Article CAS PubMed Google Scholar
Fan, H. et al. IRES-mediated Wnt2 translation in apoptotic neurons triggers astrocyte dedifferentiation. NPJ Regen. Med. 7, 42 (2022).
Article CAS PubMed PubMed Central Google Scholar
Yuan, Y. et al. p-hydroxy benzaldehyde revitalizes the microenvironment of peri-infarct cortex in rats after cerebral ischemia-reperfusion. Phytomedicine 105, 154379 (2022).
Article CAS PubMed Google Scholar
Garcia-Martin, G., Alcover-Sanchez, B., Wandosell, F. & Cubelos, B. Pathways Involved in Remyelination after Cerebral Ischemia. Curr. Neuropharmacol. 20, 751–765 (2022).
Article CAS PubMed PubMed Central Google Scholar
Cappuccio, I. et al. Induction of Dickkopf-1, a negative modulator of the Wnt pathway, is required for the development of ischemic neuronal death. J. Neurosci. 25, 2647–2657 (2005).
Article CAS PubMed PubMed Central Google Scholar
Zhang, Q., Wang, R., Khan, M., Mahesh, V. & Brann, D. W. Role of Dickkopf-1, an antagonist of the Wnt/beta-catenin signaling pathway, in estrogen-induced neuroprotection and attenuation of tau phosphorylation. J. Neurosci. 28, 8430–8441 (2008).
Article CAS PubMed PubMed Central Google Scholar
Zhao, B. et al. JLX001 attenuates blood-brain barrier dysfunction in MCAO/R rats via activating the Wnt/beta-catenin signaling pathway. Life Sci. 260, 118221 (2020).
Article CAS PubMed Google Scholar
Hayashi, T., Takada, K. & Matsuda, M. Changes in ubiquitin and ubiquitin-protein conjugates in the CA1 neurons after transient sublethal ischemia. Mol. Chem. Neuropathol. 15, 75–82 (1991).
Article CAS PubMed Google Scholar
Hochrainer, K. Protein Modifications with Ubiquitin as Response to Cerebral Ischemia-Reperfusion Injury. Transl. Stroke Res. 9, 157–173 (2018).
Article CAS PubMed Google Scholar
Hu, B. R. Protein aggregation after focal brain ischemia and reperfusion. J. Cereb. Blood Flow. Metab. 21, 865–875 (2001).
Article CAS PubMed Google Scholar
Liu, L. et al. Activation of beta-catenin by hypoxia in hepatocellular carcinoma contributes to enhanced metastatic potential and poor prognosis. Clin. Cancer Res. 16, 2740–2750 (2010).
Article CAS PubMed Google Scholar
Caldeira, M. V., Salazar, I. L., Curcio, M., Canzoniero, L. M. & Duarte, C. B. Role of the ubiquitin-proteasome system in brain ischemia: friend or foe? Prog. Neurobiol. 112, 50–69 (2014).
Article CAS PubMed Google Scholar
Zhou, W., Wei, W. & Sun, Y. Genetically engineered mouse models for functional studies of SKP1-CUL1-F-box-protein (SCF) E3 ubiquitin ligases. Cell Res. 23, 599–619 (2013).
Article CAS PubMed PubMed Central Google Scholar
Shen, X. et al. Activation and Role of Astrocytes in Ischemic Stroke. Front Cell Neurosci. 15, 755955 (2021).
Article CAS PubMed PubMed Central Google Scholar
Vacik, T., Ladinovic, D. & Raska, I. KDM2A/B lysine demethylases and their alternative isoforms in development and disease. Nucleus 9, 431–441 (2018).
Article CAS PubMed PubMed Central Google Scholar
Xiong, J., Wang, Y., Gong, Z., Liu, J. & Li, W. Identification of a functional nuclear localization signal within the human USP22 protein. Biochem Biophys. Res. Commun. 449, 14–18 (2014).
Article CAS PubMed Google Scholar
Li, Y. et al. USP22 knockdown protects against cerebral ischemia/reperfusion injury via destabilizing PTEN protein and activating the mTOR/TFEB pathway. Naunyn Schmiedebergs Arch. Pharm. 396, 3163–3175 (2023).
Article CAS Google Scholar
Di, Q. et al. USP22 suppresses the NLRP3 inflammasome by degrading NLRP3 via ATG5-dependent autophagy. Autophagy 19, 873–885 (2023).
Article CAS PubMed Google Scholar
Lu, X. et al. Hypoxic Preconditioning Attenuates Neuroinflammation via Inhibiting NF-kappaB/NLRP3 Axis Mediated by p-MLKL after Transient Global Cerebral Ischemia. Mol. Neurobiol. 61, 1080–1099 (2024).
Article CAS PubMed Google Scholar
Stanek, T. J. et al. The SAGA complex regulates early steps in transcription via its deubiquitylase module subunit USP22. EMBO J. 40, e102509 (2021).
Article CAS PubMed PubMed Central Google Scholar
Cai, Z. et al. USP22 promotes IRF3 nuclear translocation and antiviral responses by deubiquitinating the importin protein KPNA2. J. Exp. Med. 217, e20191174 (2020).
Article CAS PubMed PubMed Central Google Scholar
Liu, T. et al. Expression of USP22 and the chromosomal passenger complex is an indicator of malignant progression in oral squamous cell carcinoma. Oncol. Lett. 17, 2040–2046 (2019).
CAS PubMed Google Scholar
Lin, Y. et al. USP22 promotes proliferation in renal cell carcinoma by stabilizing survivin. Oncol. Lett. 20, 246 (2020).
Article PubMed PubMed Central Google Scholar
Balmik, A. A. & Chinnathambi, S. Methylation as a key regulator of Tau aggregation and neuronal health in Alzheimer’s disease. Cell Commun. Signal 19, 51 (2021).
Article CAS PubMed PubMed Central Google Scholar
Zhu, P. et al. lnc-beta-Catm elicits EZH2-dependent beta-catenin stabilization and sustains liver CSC self-renewal. Nat. Struct. Mol. Biol. 23, 631–639 (2016).
Article CAS PubMed Google Scholar
Lei, A. et al. EZH2 Regulates Protein Stability via Recruiting USP7 to Mediate Neuronal Gene Expression in Cancer Cells. Front Genet 10, 422 (2019).
Article CAS PubMed PubMed Central Google Scholar
Zhan, L. et al. Activation of Akt/FoxO and inactivation of MEK/ERK pathways contribute to induction of neuroprotection against transient global cerebral ischemia by delayed hypoxic postconditioning in adult rats. Neuropharmacology 63, 873–882 (2012).
Article CAS PubMed Google Scholar
Zhan, L. et al. Activation of Akt/FoxO signaling pathway contributes to induction of neuroprotection against transient global cerebral ischemia by hypoxic pre-conditioning in adult rats. J. Neurochem 114, 897–908 (2010).
Article CAS PubMed Google Scholar
Wen, H. et al. Hypoxic postconditioning promotes mitophagy against transient global cerebral ischemia via PINK1/Parkin-induced mitochondrial ubiquitination in adult rats. Cell Death Dis. 12, 630 (2021).
Article CAS PubMed PubMed Central Google Scholar
Zhan, L., Lu, X., Xu, W., Sun, W. & Xu, E. Inhibition of MLKL-dependent necroptosis via downregulating interleukin-1R1 contributes to neuroprotection of hypoxic preconditioning in transient global cerebral ischemic rats. J. Neuroinflammation 18, 97 (2021).
Article CAS PubMed PubMed Central Google Scholar
Wen, H. et al. Hypoxic postconditioning restores mitophagy against transient global cerebral ischemia via Parkin-induced posttranslational modification of TBK1. Neurobiol. Dis. 179, 106043 (2023).
Article CAS PubMed Google Scholar

Download references

Acknowledgements

This work was supported by the National Natural Science Foundation of China (Grant 82071281, 82471309) and Basic and Applied Basic Research Foundation of Guangdong Province (Grant 2021A1515011269). The authors express their gratitude to Dr. Shanshan Duan for the experimental assistance during the article revising stage. They also thank the reviewers for their useful comments on an earlier version of this article.

Author information

These authors contributed equally: Yunyan Zuo, Jiahui Xue, Haixia Wen.

Authors and Affiliations

Department of Neurology, Institute of Neuroscience, Key Laboratory of Neurogenetics and Channelopathies of Guangdong Province and the Ministry of Education of China, the Second Affiliated Hospital, Guangzhou Medical University, Guangzhou, Guangdong, China
Yunyan Zuo, Jiahui Xue, Haixia Wen, Lixuan Zhan, Meiyan Chen, Weiwen Sun & En Xu
Department of Neurology, Guangzhou Red Cross Hospital of Jinan University, Guangzhou, China
Yunyan Zuo
Department of Neurology, Guangzhou First People’s Hospital, School of Medicine, South China University of Technology, Guangzhou, Guangdong, China
Haixia Wen

Authors

Yunyan Zuo
View author publications
Search author on:PubMed Google Scholar
Jiahui Xue
View author publications
Search author on:PubMed Google Scholar
Haixia Wen
View author publications
Search author on:PubMed Google Scholar
Lixuan Zhan
View author publications
Search author on:PubMed Google Scholar
Meiyan Chen
View author publications
Search author on:PubMed Google Scholar
Weiwen Sun
View author publications
Search author on:PubMed Google Scholar
En Xu
View author publications
Search author on:PubMed Google Scholar

Contributions

En Xu, Yunyan Zuo, and Lixuan Zhan designed the research. Yunyan Zuo collected and analyzed the data. Yunyan Zuo, Jiahui Xue and Meiyan Chen performed all the experiments with assistance from Weiwen Sun. The manuscript was written by En Xu, Yunyan Zuo and Haixia Wen. All authors read and approved the final manuscript.

Corresponding author

Correspondence to En Xu.

Ethics declarations

Competing interests

The authors declare no competing interests.

Peer review

Peer review information

Communications Biology thanks the anonymous reviewers for their contribution to the peer review of this work. Primary Handling Editor: Christina Karlsson Rosenthal. A peer review file is available.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Supplementary Information

Description of Additional Supplementary Files

Supplementary Data 1

Reporting Summary

Transparent Peer Review file

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

About this article

Cite this article

Zuo, Y., Xue, J., Wen, H. et al. Inhibition of SCF^KDM2A/USP22-dependent nuclear β-catenin ubiquitylation mediates cerebral ischemic tolerance. Commun Biol 8, 214 (2025). https://doi.org/10.1038/s42003-025-07644-5

Download citation

Received: 14 April 2024
Accepted: 31 January 2025
Published: 11 February 2025
DOI: https://doi.org/10.1038/s42003-025-07644-5