Introduction

Non-small Cell Lung Cancer (NSCLC), comprising both squamous and non-squamous subtypes, constitutes 80–85% of all lung cancer cases and remains the leading cause of tumor-associated mortality1. Over the past decade, the five-year overall survival rate for patients with metastatic NSCLC remained below 5%2. A retrospective, real-world observational study involving over 9000 patients with metastatic NSCLC reported a median overall survival of under one year following initial diagnosis3. Although targeted therapies and immunotherapies have transformed the treatment landscape, their efficacy is often limited by the persistent challenge of metastatic progression. Therefore, novel effective therapy that can effectively target and suppress metastasis of lung cancer merits further investigation.

Oncolytic viruses (OVs) represent a promising class of cancer therapeutics that exert antitumor effects through selective oncolysis and activation of anti-tumor immune responses4. Recent reports indicate that at least five clinical trials are actively evaluating OV-based therapies in lung cancer5. We have developed a recombinant oncolytic herpes simplex virus type 2 (HSV2), known as OH26. This virus has undergone comprehensive preclinical evaluation, including pharmacodynamic, pharmacokinetic, and safety assessments, leading to the initiation of clinical trials in both the United States (FDA, IND 27137) and China (NMPA, NCT03866525)7,8. In phase I/II clinical studies, OH2 was well-tolerated and demonstrated sustained anti-tumor efficacy in patients with advanced melanoma, sarcoma, metastatic esophageal and rectal cancers9,10,11. Currently, OH2 is undergoing phase III clinical evaluation in China.

Talimogene laherparepvec (T-VEC), a recombinant oncolytic herpes simplex virus type 1 (HSV1), became the first FDA-approved oncolytic virus in 2015 for the treatment of recurrent melanoma4. Since its approval, T-VEC has been investigated in a range of malignancies, including in neoadjuvant settings. A phase II trial reported enhanced responses when T-VEC was combined with neoadjuvant chemotherapy in patients with high-risk initial-stage triple-negative breast cancer (TNBC), with a potential reduction in distant recurrences12. Preclinical studies further suggest that HSV-based therapies can eradicate both primary tumors and distant metastases by eliciting an antitumor immune response13. In addition, HSV has been shown to reduce metastasis of A549 cells in immunocompromised mouse models14. These findings support the hypothesis that OH2, our recombinant oncolytic HSV2, may also impede tumor metastasis through mechanisms extending beyond immune activation. While OH2 shares similar engineering strategy with T-VEC, it is based on the distinct HSV-2 backbone, which confers a distinct immunogenic profile that may enhance immune evasion and antitumor efficacy. Comparative preclinical data indicate that modified HSV-2 exhibits stronger antitumor activity than engineered HSV-1 in several tumor models15,16,17. Although T-VEC is approved for melanoma, OH2 has demonstrated promising clinical activity in gastrointestinal cancers and sarcoma in early-phase trials besides melanoma9,10,11, and is now being evaluated in the context of lung cancer. Given the limited clinical exploration of HSV-2-based virotherapy, OH2 represents a novel and potentially superior addition to the field.

Since the discovery of the first Wnt family member in 1982 as an oncogenic viral integration site in murine breast cancer, the aberrant activation of the Wnt/β-catenin pathway has been identified across a broad spectrum of human tumors, with its inhibition demonstrating substantial antitumor effects18,19. Consequently, various strategies targeting this pathway are actively being explored in both academic research and clinical trials for cancer therapy 20. Upon stimulation by Wnt ligands, β-catenin accumulates in the cytoplasm and translocates to the nucleus, where it activates downstream genes through TCF/LEF-1. Among its downstream targets are matrix metalloproteinases (MMP221, MMP722, and MMP921), which are well-established mediators of tumor invasion and progression. Notably, constitutive Wnt/β-catenin activation has been reported in approximately 50% of human NSCLC cell lines23, playing a significant role in lung tumor metastasis24. Additionally, β-catenin overexpression has been associated with resistance of NSCLC to EGFR tyrosine kinase inhibitors (TKIs)25,26. Despite its clinical significance, there has been a notable gap in research concerning the potential of OVs to modulate the β-catenin/MMP axis.

This study aimed to determine whether the oncolytic herpes simplex virus OH2 could suppress NSCLC cell migration and invasion, thereby unveiling a previously uncharacterized anti-tumor mechanism of OVs. Our results demonstrate that OH2 degrades β-catenin mRNA through its tegument protein UL41, which disrupts the β-catenin/MMPs signaling pathway. These findings highlight the therapeutic potential of OH2 in targeting metastatic pathways in NSCLC and other aggressive malignancies.

Results

OH2 inhibited migration and invasion of NSCLC by downregulating MMP-2, MMP-7, and MMP-9

The effectiveness of OH2 in inhibiting the invasion and migration of NSCLC cells was evaluated using the lung cancer cell lines A549 and H1299. Figure 1a, b demonstrates that through wound healing and transwell invasion assays, OH2 markedly inhibited both migration and invasion of these cells. Specifically, 24 h post-infection, a dose-dependent reduction in cell migration was noted for both A549 and H1299 (Fig. 1a). Similarly, a significant dose-dependent decrease in the invasion capabilities was observed upon treating the cells with OH2 (Fig. 1b). These results indicate that OH2 effectively blocks the migration and invasion of NSCLC cells.

Fig. 1: OH2 can inhibit migration and invasion of NSCLC cell lines through MMP2, MMP7, and MMP9.
figure 1

a Wound healing assay was performed on A549 and H1299 cells treated with or without OH2. Images shown are representative at time 0 h and 24 h post-treatment (left) and migration was quantified from images using ImageJ software, and graphs show means ± SEM from three independent experiments (right). b Transwell invasion assay was performed on A549 and H1299 cells treated with or without OH2 by the 24-transwell system. Representative photomicrographs of invading cells stained with crystal violet (left) and the number of invading cells and graphs show means ± SEM from three independent experiments (right). Scale bars, 100 μm. c A549 and H1299 cells were infected with or without OH2. Cells were lysed at 24 h post-infection and the samples were analyzed by western blotting. Western blot analysis (left) and quantification show means ± SEM from three independent experiments (right) of MMP2, MMP7, and MMP9 were performed. d Wound healing assay was performed on H1299 cells treated with or without GM6001. Data shown are means ± SEM from three independent experiments. e Transwell invasion assay was performed on H1299 cells treated with or without GM6001. Scale bars, 100 μm. Data shown are means ± SEM from three independent experiments. Statistical analysis was performed using one-way ANOVA with Tukey’s post hoc test in (a–e). *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001. f A549 and H1299 were incubated with or without OH2 and analyzed by CCK8 assay at various time points. Data are presented as means ± SD.

Full size image

MMP2, MMP7, and MMP9 are zinc-dependent endopeptidases that play critical roles in the degradation of extracellular matrix components. The upregulation of these MMPs has been significantly linked to increased migration and invasion in NSCLC, and is associated with a poor prognosis27,28. To assess the impact of OH2 on these MMPs, we conducted western blot analyses to measure the levels of MMP2, MMP7, and MMP9 following OH2 infection. The results indicated that OH2 infection leads to decreased expression of these MMPs (Fig. 1c). To further explore the role of MMPs in the invasive phenotype of NSCLC cells within our experimental framework, we conducted migration and invasion assays in the presence of the MMPs inhibitor GM6001. Treatment with GM6001 significantly blocked the cancer cells migration and invasion (Fig. 1d, e). Taken together, OH2 may inhibit NSCLC cells migration and invasion through downregulating MMP2, MMP7, and MMP9.

To confirm that the anti-migratory effects observed were not merely due to cytotoxicity, we assessed the viability of the cells using the CCK8 assay. At 24 h (the same time point used for the wound healing and transwell invasion assays), OH2 did not significantly affect the proliferation of H1299 and A549 cells (Fig. 1f). Additionally, OH2 also inhibited the migration and invasion of PC-9 cells, which were resistant to OH2-induced cytotoxicity (Supplementary Fig. S1). These results indicate that the anti-tumor activity of OH2 extends beyond direct cytotoxicity and immune activation, encompassing the inhibition of tumor cell migration and invasion.

Proteomic analysis of secretomes of OH2 infected A549 further confirmed the involvement of the MMPs

To investigate the anti-metastatic mechanisms of OH2, we performed a proteomic analysis on A549 cells treated with OH2 and compared them to mock-treated controls. We collected and analyzed the supernatants from both groups using LC-MS/MS with TMT-6plex labeling method29 to quantitatively profile the secreted proteins. This approach identified 25,191 unique peptides across the samples. Principal-component analysis (PCA) revealed a shift along principal component 1 (PC1) and 2 (PC2) between the OH2-treated and mock-treated cells (Fig. 2a). As depicted in Fig. 2b, differentially expressed proteins were identified. Relative to the mock treatment group, 120 proteins showed significant changes in expression following OH2 infection: 50 proteins were downregulated (OH2 treatment vs. control ratio <0.5) and 70 were upregulated (OH2 treatment vs. control ratio > 2) (Supplementary Tables S1, S2). MMP9 is absent from Supplementary Table S2 because it was not detected by the proteomic workflow, likely due to its extremely low abundance in the OH2-treated cell secretome and the inherent detection limits of the mass spectrometry approach. Information about these proteins, including database accession numbers, descriptions, quantitative ratios, and gene names is provided in Supplementary Tables S1, S2. Additionally, the analysis detected the expression of GM-CSF (GM-CSF was engineered into OH2 to enhance tumor-specific immune responses) and several viral proteins (Supplementary Table S1).

Fig. 2: Gene ontology analysis of differently expressed proteins in OH2 infected A549 cells.
figure 2

a A549 of proteomic with or without OH2 treatment represented in a two-dimensional space. b Volcano plot showed the proteins that were differentially secreted between OH2-treated and mock treated A549 cells. The proteins with the largest and most statistically significant absolute fold-change between OH2 treatment and control are those at the upper left (green dots) and right corners (red dots). c The GO enrichment analyses of the significantly downregulated proteins by OH2 treatment compared to control. d The protein-protein interaction analysis of down-regulated proteins in OH2 treated A549 cells by STRING.

Full size image

Enrichment analysis of the biological process category revealed distinct profiles for proteins secreted by OH2-treated A549 cells. Proteins secreted at higher levels in OH2-treated cells were predominantly involved in ion transmembrane transport (Supplementary Fig. S2). In contrast, proteins secreted at lower levels compared to the mock-treated group were significantly enriched in the biological process of extracellular matrix disassembly (Fig. 2c). Key proteins involved in this process include MMP2 (0.50-fold downregulation), MMP1 (0.41-fold downregulation), TIMP1 (0.43-fold downregulation), TIMP2 (0.42-fold downregulation), LCP1 (0.42-fold downregulation), MMP10 (0.48-fold downregulation), highlighting their roles in extracellular matrix disassembly. To further elucidate the functions of these downregulated proteins, we employed the STRING database for protein-protein interaction analysis. And unconnected proteins were removed (Fig. 2d).

OH2 reduces β-catenin levels and its transcriptional activity

Given the regulatory role of the transcriptional co-activator β-catenin in MMP-mediated migration and invasion of lung cancer cells21,22, we examined whether OH2 modulates β-catenin expression in NSCLC cell lines. In A549 and H1299 cells, an inverse correlation was observed between OH2 infection and β-catenin levels (Fig. 3a). A significant reduction in β-catenin mRNA was noted following OH2 infection (Fig. 3b). These results suggest that OH2 may suppress β-catenin expression at the mRNA level. This finding was consistent across other lung cancer cell lines, including H3122, H460, SKMES-1, H292, H358, H520, and H2030 (Supplementary Fig. S3). Further evidence supporting this mechanism was obtained from experiments using the proteasome inhibitor MG132, which did not reverse the reduction of β-catenin induced by OH2 (Fig. 3c). MG132 is a proteasome inhibitor commonly used to assess whether protein downregulation is mediated by ubiquitin-proteasome degradation. In this context, the inability of MG132 to restore β-catenin levels suggests that OH2-induced downregulation of β-catenin occurs independently of proteasomal degradation, and is more likely due to mRNA inhibition.

Fig. 3: OH2 reduces β-catenin levels and transcriptional activity.
figure 3

a H1299 and A549 cells were infected with or without OH2. Cells were lysed and the samples were subjected to western blot analysis (left). The quantification data shown are means ± SEM from three independent experiments (right). Statistical analyses were performed using one-way ANOVA with Tukey’s post hoc test. *p < 0.05; **p < 0.01. b H1299 and A549 cells were infected with or without OH2. And the samples were subjected to qRT-PCR analysis. Data shown are means ± SEM from three independent experiments. Statistical analyses were performed using one-way ANOVA with Tukey’s post hoc test. **p < 0.01, ***p < 0.001, ****p < 0.0001. c MG132 does not affect the β-catenin inhibition of OH2. H1299 were treated with OH2 in the absence or presence of MG132 (10 μM). Western blot analysis (left) and quantification (right) of β-catenin were performed. The quantification data shown are means ± SEM from three independent experiments (right). d OH2 reduces β-catenin protein levels in both cytoplasmic and nuclear fractions: H1299 cells were infected with OH2 or mock infection, followed by treatment with Wnt3a for 6 h, followed by nuclear fractionation and immunoblotting. The band density was quantified using ImageJ software. Data are represented as means ± SEM from three independent experiments. e The effects of OH2 on the expression and distribution of β-catenin were explored by IF labeling in the indicated cells with or without Wnt3a (100 ng/mL) stimulation. Magnification ×1000. f OH2 inhibited the transcriptional activity of β-catenin. H1299 and A549 cells infected with OH2 were transfected with TOP-Flash or FOP-Flash. Transfection efficiency was normalized by co-transfection with pRL-TK. Luciferase activity was measured 48 h post transfection by the dual-luciferase assay. Data are shown as the mean ± SEM. g OH2 negatively regulates the expression of MMPs by qRT-PCR analysis. Data shown are mean ± SEM of three independent experiments. Statistical analyses were performed using one-way ANOVA with Tukey’s post hoc test. **p < 0.01; ***p < 0.001; ****p < 0.0001. h Overexpression of UL41 blocks the transcriptional activity of wild type β-catenin: H1299 cells were transfeted with OH2 viral proteins, followed by dual-luciferase assay. Data are represented as means ± SEM from three independent experiments. Statistical analyses were performed using Student’s t test in (c, d, f, h). ns not significant; *p < 0.05; ***p < 0.001; ****p < 0.0001.

Full size image

The activation of the β-catenin pathway typically involves its upregulation and subsequent translocation to the nucleus. We analyzed the nuclear and cytosolic levels of endogenous β-catenin in cells infected with OH2. Compared to control cells, both nuclear and cytosolic fractions of β-catenin were reduced (Fig. 3d, e), suggesting that the decrease in nuclear β-catenin may be due to reduced cytoplasmic levels. To determine whether the diminished nuclear β-catenin retains its transcriptional activity, we utilized paired TOP-Flash and FOP-Flash control luciferase reporters. The results indicated that OH2 significantly inhibited the transactivation activity of β-catenin in both its normal and activated states (Fig. 3f). Furthermore, OH2 treatment led to a notable suppression of β-catenin signaling-related genes, specifically MMP2, MMP7, and MMP9 (Fig. 3g). Consistent with these molecular changes, would-healing assays showed that H1299 cells with β-catenin knockdown (sh-β-catenin) exhibited reduced migration compared to controls (Fig. 4a). Our western blot and RT-qPCR analyses showed that the knockdown efficiency of β-catenin protein and mRNA was around 50% (Supplementary Fig. S4). And overexpressing wild-type and mutant β-catenin (β-catenin-S552D) in H1299 cells enhanced migration, with the mutant form showing the most significant increase (Fig. 4b). β-catenin-S552D (β-catenin phosphorylated at serine 552), a phospho-mimetic form activated by AKT1, is known to robustly enhance migration and invasion27. qRT-PCR analysis indicated that β-catenin knockdown reduced MMP2, MMP7, and MMP9 mRNA levels, while overexpression of β-catenin increased their levels (Fig. 4c, d). Furthermore, we transfected MMP2, MMP7, MMP9, and β-catenin alone, or in combination with OH2 infection and found that OH2 infection suppressed cells migration and invasion, which can be antagonized by simultaneous transfection of MMPs and β-catenin (Supplementary Fig. S5).

Fig. 4: β-catenin was positively correlated with lung cancer migration and MMPs transcription.
figure 4

a β-catenin knockdown suppressed H1299 cell migration. sh-β-catenin H1299 cells stably expressing shRNA targeting β-catenin. Images shown are representative at time 0 h and 24 h post-treatment (left) and migration was quantified from images, and graphs show means ± SEM from three independent experiments (right). ***p < 0.001 (Student’s t test). b H1299 cells were transfected with indicated plasmids of β-catenin-S552D and β-catenin, followed by wound-healing assay. Images shown are representative at time 0 h and 24 h post-treatment (left) and migration was quantified from images, and graphs show means ± SEM from three independent experiments (right). c H1299 cells transfected with si-β-catenin, followed by qRT-PCR analysis. Data are shown as mean ± SEM of three independent experiments. d H1299 cells were transfected with indicated plasmids of β-catenin-S552D and β-catenin, followed by qRT-PCR analysis to detect the mRNA expression of CTNNB1 and MMPs as indicated. Data are shown as mean ± SEM of three independent experiments. Statistical analysis was performed using one-way ANOVA with Tukey’s post hoc test in (b–d). *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001.

Full size image

To explore the potential of OH2-encoded proteins in modulating β-catenin signaling pathway, a screening assay was conducted to identify specific viral proteins that exert inhibitory effects. Plasmids encoding various OH2 proteins were transfected into H1299 cells for 24 h. Subsequently, the cells were treated with or without LiCl for an additional 24 h, luciferase activity was measured to evaluate β-catenin activation. As shown in Fig. 3h, among the tested proteins, OH2 UL41 significantly reduced LiCl-induced β-catenin activation, while UL2, US1, UL54, UL12, UL23, UL50, and UL42 had no significant inhibition effect. UL41, a herpes simplex virus (HSV) tegument protein known for its mRNA-specific RNase activity, facilitates virus infection by selectively degrading host mRNA30. Previous studies have documented UL41’s involvement in suppressing various cellular pathways, including the cytosolic DNA-Sensing pathway, IRE1/XBP1 signal pathway, and innate dsRNA antiviral pathway 30,31,32. However, its role in inhibiting β-catenin signaling has not been reported. Given these findings, we focused our subsequent research on exploring the mechanism by which OH2 UL41 inhibits the β-catenin pathway.

In summary, these results collectively suggest that the observed reduction in β-catenin expression and transcriptional activity is, at least in part, mediated by the UL41 protein.

OH2 UL41 protein degraded β-catenin mRNA and downregulated its expression

The aforementioned data indicates that UL41 functions as an inhibitor of β-catenin signaling. UL41, an endoribonuclease with substrate specificity similar to RNase A, has been shown to selectively degrade specific host mRNAs featuring an AU-rich element (ARE) in their 3’-untranslated regions, including those of zinc finger antiviral protein, tetherin, and cig533,34,35,36. This specificity led us to hypothesize that UL41 mediates the reduction in β-catenin levels by degrading its mRNA via RNase activity. To explore the molecular basis of β-catenin suppression by UL41, H1299 cells were transfected with an UL41-HA plasmid and analyzed using western blot and qRT-PCR. The results confirmed that UL41 effectively reduced endogenous β-catenin at both the protein and mRNA levels (Fig. 5a). Furthermore, when 293T cells were co-transfected with Flag-β-catenin and HA-UL41, a dose dependent decrease in the levels of ectopically expressed β-catenin was observed, corroborated by qRT-PCR results (Fig. 5b). To determine if degradation of β-catenin mRNA by UL41 relies on its enzymatic activity, we engineered three UL41 mutants with alterations in the nuclease motif (D34N, D82N, and D217N). Post-transfection analyses using western blot and qRT-PCR indicated these loss-of-function mutants, unlike the wild-type UL41, did not reduce β-catenin levels (Fig. 5c).

Fig. 5: UL41 abrogates the activity of β-catenin by degrading its mRNA.
figure 5

a Ectopic expression of UL41 decreased the expression of endogenous β-catenin in H1299 cells. H1299 cells were transfected with HA-UL41 plasmid for 48 h, and then the cells were harvested and analyzed by western blotting (left) or qRT-PCR analysis (right). The band density was quantified using ImageJ software (middle). Data are represented as means ± SEM from three independent experiments. *p < 0.05, **p < 0.01, ***p < 0.001 (Student’s t test). b OH2 tegument protein UL41 inhibits the ectopic expression of β-catenin. HEK293T cells were cotransfected with Flag-β-catenin and HA-UL41 plasmids. At 48 h posttransfection, the cells were harvested and subjected to western blot analysis (left) or qRT-PCR analysis (right). The band density was quantified using ImageJ software (middle). Data are represented as means ± SEM from three independent experiments. *p < 0.05, **p < 0.01, ***p < 0.001 (Student’s t test). c 293T cells cotransfected with Flag-β-catenin and HA-UL41 or mutants. At 48 h posttransfection, the cells were harvested and subjected to western blot analysis (left) or qRT-PCR analysis (right). Data are represented as means ± SEM from three independent experiments. *p < 0.05 (Student’s t test). d UL41 reduces β-catenin protein levels in both cytoplasmic and nuclear fractions: H1299 cells transfected with HA-UL41 were treated with (right) or without Wnt3a (left), followed by immunofluorescence in the indicated cells. e Overexpression of HA-UL41 blocks the transcriptional activity of β-catenin: H1299 cells transfected with HA-UL41 plasmids were treated with or without LiCl, followed by TCF/β-catenin reporter dual-luciferase assay. Date are shown as the mean ± SEM of three independent experiments. f H1299 cells transfected with HA-UL41, followed by qRT-PCR analysis. Data are shown as mean ± SEM of three independent experiments. g H1299 cells were transfected with indicated plasmid of HA-UL41, followed by wound-healing assay. Data are shown as mean ± SEM of three independent experiments. ***p < 0.001 (Student’s t test). h H1299 cells were transfected with indicated plasmid of UL41-HA, followed by invasion assay. Data are shown as mean ± SEM of three independent experiments. ***p < 0.001 (Student’s t test). i RIP-qPCR confirmed UL41 binding to CTNNB1 mRNA. 18S rRNA and c-FOS served as negative and positive controls, respectively. Data are shown as mean ± SEM of three independent experiments. ***p < 0.001 (Student’s t test). Statistical analysis was performed using one-way ANOVA with Tukey’s post hoc test in (a, b, e, f). *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001.

Full size image

The impact of UL41 on β-catenin expression in both nuclear and cytosolic fractions was investigated in cells transfected with UL41. The analysis showed a reduction in β-catenin levels in both compartments irrespective of whether the cells were active with WNT3a or in a quiescent state (Fig. 5d). These findings align with the patterns observed for OH2 treatment, suggesting a consistent inhibitory effect on β-catenin by UL41. Further examination of β-catenin’s transcription activity revealed a significant suppression of its transactivation activity in the presence of UL41 (Fig. 5e). Moreover, UL41 significantly reduced the expression of downstream genes critical for metastatic processes, including MMP2, MMP7, and MMP9 (Fig. 5f). This regulatory effect extended to cellular behavior, as ectopic expressed UL41 inhibited migration and invasion of H1299 cells (Fig. 5g, h). RIP-qPCR was used to investigate whether UL41 directly interact with β-catenin mRNA. We found that UL41 protein significantly enriched β-catenin mRNA comparing with control (Fig. 5i).

In conclusion, our findings demonstrate that the OH2 tegument protein UL41 downregulates β-catenin by degrading its mRNA, resulting in reduced transcriptional activity and impaired migration and invasion of H1299 cells.

Potent inhibition of A549 tumor metastasis by OH2

In the subcutaneous A549 xenograft tumor model, intratumoral injection of OH2 was observed to significantly inhibit tumor growth (Fig. 6a, b). Immunohistochemistry analysis of the tumor tissues from this model revealed a decrease in β-catenin levels in tumors treated with OH2, indicating effective suppression of β-catenin expression in vivo (Fig. 6c). Western blot analysis of tumor lesions revealed the reduction of β-catenin and MMPs in the OH2 treated tumors (Supplementary Fig. S6). Furthermore, the efficacy of OH2 in preventing tumor metastasis was evaluated using a well-established A549 metastasis model37,38. A549 cells, either mock-infected or OH2-infected, were intravenously injected into nude mice. Mice injected with mock-treated A549 cells developed extensive lung and liver metastases. Conversely, those received OH2-infected A549 cells exhibited a markedly reduced number of metastatic nodules, substantiated by tissue examination and hematoxylin and eosin (H&E) staining (Fig. 6d–f).

Fig. 6: Inhibition of lung cancer metastasis by OH2 treatment in vivo.
figure 6

a A549 cells were inoculated into the right flanks of nude mice. OH2 or PBS (mock) was injected into the tumors. The elements in this image were created using Adobe Photoshop software. Macroscopic appearance of mice and isolated tumors was observed on day 16 after treatment. b Tumor volume growth curves of the OH2 and mock-treated groups. Data are expressed as mean ± SEM (n = 3 per group). c Histologic analysis of A549 tumors. Paraffin-embedded sections of A549 tumors were stained with anti-β-catenin antibody. Data are represented as means ± SEM (n = 3). d 5 ×106 disaggregated A549 cells premixed with PBS or OH2 at MOI = 1 in PBS were injected i.v. by tail vein into BALB/c nude mice. Representative pictures of fixed lungs and livers at 3 weeks after injection were shown. e Representative H&E staining pictures of lung (left). Arrows, metastasis nodules. metastasis nodules were quantified (right). f Representative H&E staining pictures of liver (left). Arrows, metastasis nodules. metastasis nodules were quantified (right). Data are represented as means ± SEM (n = 3). Statistical analyses were performed using Student’s t test in (c, e, f). **p < 0.01; ***p < 0.001.

Full size image

Discussion

The high mortality rate in patients with NSCLC is predominantly due to its tendency for distant metastasis39, which significantly hampers therapeutic efficacy. This underscores the urgent need for novel treatments that can effectively curtail tumor migration and invasion. Notably, the role of OVs in regulating lung cancer metastasis remains underexplored, positioning our study to address a critical gap in this field. Our results demonstrate that oncolytic virus OH2 significantly inhibit migration and invasion of A549 and H1299 cells in both in vitro and in vivo models. These findings are particularly promising for clinical translation, suggesting that preoperative administration of OH2 could reduce distant micrometastases and potentially improve surgical outcomes and prognosis in patients with NSCLC.

β-catenin serves as a major component of the Wnt/β-catenin pathway and functions as a key oncogene involved in the pathogenesis and progression of malignancies, including NSCLC40. Aberrant activation of this pathway is a key oncogenic driver in numerous cancers and has been associated with lymph node metastasis, resistance to radiotherapy and chemotherapy, and poor clinical outcomes41,42. As such, the Wnt/β-catenin axis has become an important target in cancer drug development. For instance, FOG-001, a direct inhibitor of β-catenin, is currently being evaluated in a phase I/II multicenter trial involving patients with advanced tumors, including NSCLC (NCT05919264). Additionally, a phase Ib trial is evaluating the efficacy and safety of osimertinib combined with tegavivint (which promotes β-catenin degradation) as a first-line therapy in patients with metastatic EGFR-mutant NSCLC (NCT04780568). However, a major hurdle in the clinical application of pharmacological inhibitors targeting this pathway is the difficulty in achieving tumor-specific selectivity, often resulting in adverse effects such as gastrointestinal toxicity. In contrast, OH2 offers a distinct advantage through its capacity for selective replication within tumor cells, thereby minimizing off-target effects. Our findings reveal a novel tumor-suppressive mechanism by which OH2 inhibits cancer cell invasion and metastasis through UL41-mediated degradation of β-catenin mRNA.

Current neoadjuvant clinical trials for NSCLC have primarily targeted resectable stages, with limited exploration in more advanced cases. In the CheckMate 816 trial, neoadjuvant treatment with nivolumab plus chemotherapy achieved a pathological complete response in 24% of patients with stage IB to IIIA resectable NSCLC43. However, surgical resection was not performed in 15.6% of patients in the combination arm, mainly due to disease progression43, highlighting the need for additional interventions to suppress metastatic spread. Our findings suggest that OH2 may be a valuable addition to the neoadjuvant setting by targeting tumor-intrinsic drivers of metastasis. Additionally, OH2 could be explored in combination with immune checkpoint inhibitors to enhance antitumor immune response, or with targeted agents to circumvent pathway-specific resistance in advanced NSCLC. Supporting the clinical potential of oncolytic virotherapy, a phase II trial combining T-VEC with neoadjuvant chemotherapy demonstrated promising results in patients with early-stage high-risk triple-negative breast cancer (TNBC)12.

Elucidating the regulatory mechanisms of OH2 enhances our understanding of its antitumor potential in NSCLC. Our findings are supported by multiple lines of evidence: (1) OH2 reduced NSCLC cell migration and invasion by downregulating β-catenin, as validated in both in vitro cell-based models and an in vivo lung metastasis model; (2) ectopic expression of β-catenin in H1299 cells enhanced migratory capacity, whereas siRNA-mediated knockdown attenuated this effect; (3) OH2 reduced β-catenin mRNA, leading to lower protein expression and diminished transcriptional activity. The use of the proteasome inhibitor MG132 further confirmed this regulation at the transcriptional level. Moreover, the β-catenin-S552D variant, known for its enhanced activity upon AKT1 activation, further promoted cell migration and invasion27, and upregulated key metastasis-associated genes including MMP2, MMP7, and MMP927. Our transfection results aligned with these observations (Fig. 4b, d). Together, these findings underscore OH2 as a promising therapeutic candidate and reinforce the potential of oncolytic virotherapy in the treatment of NSCLC.

Our previous studies in syngeneic mouse tumor models with intact immune systems demonstrated that OH2 treatment enhances intratumoral infiltration of CD8+ T cells and dendritic cells (DCs), upregulating immune-stimulatory cytokines, and enhances antitumor efficacy, particularly when combined with immune checkpoint blockade44. The current study extends beyond the known cytotoxic and immunomodulatory effects of OH2, positioning it as promising agents for anti-invasive strategies. Notably, primary tumor-derived NSCLC cells or patient-derived models were not employed in this study. Future investigations incorporating such clinically relevant models will be essential to further validate the translational relevance of our findings.

Extracellular matrix (ECM) degradation plays an important role in promoting cancer metastasis45. MMPs, a family of zinc-dependent endopeptidases, are pivotal in ECM degradation, facilitating tumor invasion. Several studies have linked MMP-2, MMP7, and MMP-9 expression to increased metastasis potential and poor prognosis in a variety of cancers46,47,48,49,50, including lung cancer51,52,53. Consequently, blocking β-catenin-induced transactivation of MMPs has emerged as a promising strategy to inhibit lung cancer cells migration and invasion27. Our results indicate that OH2 reduces the β-catenin expression and its downstream targets, including MMPs. This effect was substantiated through modulation of β-catenin expression and employing the MMPs inhibitor GM6001. These results align with previous reports demonstrating that FBXW2 overexpression suppresses cell migration and invasion by inhibiting β-catenin-mediated MMPs transcription27. Further insights were gained through proteomic analysis, which characterized the secretome of OH2-infected A549 cells, revealing significant reductions in MMPs associated with ECM disassembly. These proteomic data were corroborated by western blot and qRT-PCR analyses. Consistent with prior studies showing that HSV-1 RH2 promotes the release of viral proteins and danger-associated molecular pattern (DAMP) proteins while reducing the release of ECM components54. In our experiment, viral structural components such as the envelope, nucleocapsid, and tegument were identified (Supplementary Table S1). Additionally, GM-CSF, which is genetically encoded within OH2, was also detected (Supplementary Table S1).

OVs have been reported to suppress tumor growth through altering cytoskeletal dynamics or inhibiting pathways such as ERK signaling38,55. However, current understanding of how OV interact with the β-catenin/MMPs signaling pathway remains nascent, and no direct link between viral proteins and β-catenin regulation has been previously established. In this study, we discovered that the herpes simplex virus tegument protein UL41 can target and degrade β-catenin mRNA, leading to reduced β-catenin levels and impaired NSCLC cell migration and invasion. Previously, UL41 was reported to suppress the expression of innate immune sensors, including TLR2, TLR3, Mda-5, and RIG-132, as well as components of IFN-γ signaling, such as IFNGR156. These effects are attributed to the protein’s nuclease activity, which is dependent on key amino acid residues D32, D82, and D21733. Our results corroborate that the mutants of UL41 lacking these critical residues lose its nuclease activity (Fig. 5c). To further investigate the specificity of UL41-mediated mRNA degradation, we examined the presence of AU-rich element (ARE) in the 3’ untranslated region (UTR), a known motif targeted by UL4136. Using the ARE database (http://rna.tbi.univie.ac.at/AREsite), we identified that an ARE core motif (ATTTA) within the 3’ UTR of β-catenin mRNA, providing a plausible mechanism for UL41-mediated targeting. Thus, these results reveal that HSV tegument protein UL41 reduces β-catenin levels by degrading its mRNA, thereby inhibiting nuclear transcriptional activity and limiting NSCLC cell migration and invasion. Transcriptomic profiling would be performed to explore the possible off-targets effects of OH2 on other cellular signaling pathways in future studies.

Conclusion

This study reveals a previously unrecognized counterregulatory effect of oncolytic virus OH2 on β-catenin, a known driver of cancer metastasis. Our findings elucidate the mechanisms by which OH2 inhibits tumor invasion and metastasis through suppression of the β-catenin/MMPs signaling pathway. This regulatory activity extends beyond lung cancer and may be relevant to other aberrant β-catenin activation malignancies, including melanoma, colorectal, breast cancer, et al. By targeting a central hallmark associated with metastatic progression, OH2 offers a promising therapeutic strategy with broad translational potential. Furthermore, its anti-invasive efficacy may be especially beneficial in the treatment of aggressive tumors where surgical options are not feasible.

Materials and methods

Cells culture

HEK293T (human embryonic kidney), NSCLC cell lines H1299, A549, H3122, H460, SK-MES-1, H292, H358, H520, and H2030 were obtained from American Type Culture Collection (ATCC) (Virginia, USA). The PC-9 cell line was obtained from Procell Biotechnology Company (Wuhan, China). These cell lines were cultured in DME/F12 medium containing 10% Fetal bovine serum (FBS). Identity of each cell line was confirmed by STR profiling, and regular testing was conducted to ensure they were free from mycoplasma contamination. The oncolytic virus OH2 was constructed from the herpes simplex virus type II wild strain HG528.

Plasmids, siRNAs, and reagents

The plasmid pEnCMV-FLAG-β-catenin-SV40-Neo was obtained from MiaoLingBio (Wuhan, China). To construct expression plasmids containing UL41, UL2, US1, UL54, UL12, UL23, UL50, and UL42 genes, these were PCR amplified using OH2 DNA isolated from infected cells as templates. Detailed primer sequences used are listed in Supplementary Table S3. The amplified DNA fragments were digested using HindIII and XhoI and subsequently ligated into pCMV-N-Flag and/or pCMV-N-HA vectors (Beyotime, Shanghai, China) that had been similarly digested. All plasmids underwent sequencing to confirm the absence of unintended mutations during the cloning process. UL41 mutants (D34N, D82N, D217N) and human β-catenin mutant (S552D) were established with Mut Express® II Fast Mutagenesis Kit V2 (Vazyme, C214). These mutants were confirmed through DNA sequencing. The specific primer sequences utilized were as follows: UL41D34N, (forward) 5’-CGCCGTGAACCTGTGGAATGTCATGTATACCCTGG-3’ and (reverse) 5’-CACAGGTTCACGGCGATGGGGGTAAAG-3’; UL41D82N, (forward) 5’-CGTGACCAACCGCGGGGTCGAGTGTACC-3’ and (reverse) 5’-CCGCGGT TGGTCACGAAGATGGGGAACAGG-3’; UL41D217N, (forward) 5’-GGATACCA ACCTCCTGCTGATGGGCTGC-3’ and (reverse) 5’-AGGAGGTTGGTATCCGTG GTATGCACG-3’ β-cateninS552D, (forward) 5’-CCGTACGGACATGGGTGGGACACAGCAGC-3’ and (reverse) 5’-CCCATGTCCGTACGGCGCTGGGTATCC-3’. The siRNA oligos targeting β-catenin were obtained from Tsingke Biotech (Beijing, China). The siRNA oligos and short hairpin RNA (shRNA) used for constructing lentivirus silencing vectors were: siRNA for β-catenin was 5ʹ-AACAGTCTTACCTGGACTCTG-3ʹ; shRNA for β-catenin was 5ʹ-CCGGAA CAGTCTTACCTGGACTCTGCTCGAGCAGAGTCCAGGTAAGACTGTTTTTTTG-3ʹ.

Recombinant Wnt3a (#5036-WN) was obtained from R&D Systems. β-catenin signaling pathway activator LiCl (#7447-41-8) was purchased from Sangon Biotech. MMPs inhibitors GM6001 (#HY-15768) and proteasome inhibitor MG132 (#HY-13259) were obtained from MCE.

Cell growth assay

Tumor cells in 100 μL of medium were seeded into the 96-well tissue culture plates (BIOFIL, China). Cell viability was determined using the CCK8 assay (SEVEN Biotech, SC119, China). After the specified incubation period, the culture medium was removed and 100 μL of 10% CCK8 solution was inoculated. The plates were then incubated for an additional 2 h. The absorbance was then measured through Varioskan LUX multimode microplate reader (Thermo Fisher Scientific, USA).

Transfection and lentiviral infection

Cells were transfected with plasmids or siRNA oligonucleotides utilizing Lipo8000 transfection reagent. Assays were conducted 48 hous after transfection to assess the effects. Human CTNNB1 short hairpin RNAs (shRNAs) in the pLKO.1-puro vector (Sigma, 8453) were purchased from Tsingke Biotech (Beijing, China). To establish stable cell lines expressing either cDNA or shRNA, the vectors were transfected into 293T cells using Lipo8000. For lentivirus production, lentiviral vectors were co-transfected with packaging plasmids pMD2.G and psPAX2 into 293T cells plated in 10 cm dishes. The lentivirus-containing supernatants were collected 48 h post-transfection, filtered, and utilized to infect target cells in the presence of 10 μg/mL polybrene (Merck, USA, TR-1003). Following infection, stable cell lines were established using puromycin. The effectiveness of overexpression and knockdown was confirmed by immunoblotting.

Quantitative reverse transcription PCR (qRT-PCR)

Total RNA was extracted by the FastPure Cell/Tissue Total RNA Isolation Kit (Vazyme, China)57. Genomic DNA was digested after RNA extraction. cDNA was acquired by reverse transcription with the HiScript® III All-in-one RT SuperMix (Vazyme, China). qRT-PCR was conducted using the SYBR Green qPCR Master Mix Kit (Vazyme, China) and the process was performed with StepOne Real-Time PCR System (Applied Biosystems, USA). Following primers were utilized for qRT-PCR: CTNNB1, (forward) 5’-CATCTACACAGTTTGATGCTGCT-3’ and (reverse) 5’-GCAGTTTTGTCAG TTCAGGGA-3’; MMP2, (forward) 5’-CTGAAGGACACACTAAAGA-3’ and (reverse) 5’-CGATGGTATTCTGGTCAA-3’; MMP7, (forward) 5’-GCTCAGGACT ATCTCAAG-3’ and (reverse) 5’-ACATTCCAGTTATAGGTAGG-3’; MMP9, (forward) 5’-GGCAGATTCCAAACCTTT-3’ and (reverse) 5’-GCAAGTCTTCCG AGTAGT-3’. The results were analyzed utilizing the 2−ΔΔCT method, normalized to 18s rRNA.

Western blotting

The Western blot protocol used in this study was described previously57. Total protein was extracted from cells and tumor tissues lysed in RIPA lysate buffer (Beyotime, China). Following lysis, the mixture was centrifuged at 12,000 rpm for 15 min, and the resulting supernatant was harvested. Protein concentrations were detected with a protein quantitative kit. For protein separation, the samples underwent SDS-PAGE and were subsequently transferred onto nitrocellulose membranes (Beyotime, China). Details regarding the antibodies used for detecting specific proteins are as follows: anti-β-catenin (Proteintech, 51067-2-AP, 1:5000 for immunoblotting, 1:500 for immunohistochemistry, 1:200 for immunofluorescence), anti-MMP2 (Proteintech, 66366-1-Ig, 1:1000 for immunoblotting), anti-MMP7 (Proteintech, 10374-2-AP, 1:1000 for immunoblotting), anti-MMP9 (Proteintech, 10375-2-AP, 1:1000 for immunoblotting), anti-Flag tag (Abmart, M2008, 1:5000 for immunoblotting), anti-HA-tag (Abmart, M2003, 1:5000 for immunoblotting 1:1000 for immunofluorescence), HRP-conjugated AffiniPure Goat Anti-Mouse (IgG) secondary antibody (Proteintech, SA00001-1, 1:10000 for immunoblotting), HRP-conjugated Affinipure Goat Anti-Rabbit (IgG) secondary antibody (Proteintech, SA00001-2, 1:10000 for immunoblotting).

The signals were visualized by ECL luminescence solution (Biosharp, China) with exposing to G:BOX Chemi XRQ (Syngene, UK). The density of western blotting results was quantified by ImageJ.

The β-catenin/TCF luciferase reporter assays

The TOP/FOP flash luciferase experiment was conducted as previously detailed58. For this experiment, H1299 cells were transfected with M50 Super 8×TOP-Flash (Addgene, 12456) and M51 Super 8×FOP-Flash (TOP-Flash mutant, Addgene, 12457) plasmids. These were co-transfected with the Renilla luciferase plasmid, which served as an internal control to normalize the results. 48 h post-transfection, the luminescence generated by the Firefly luciferase reporter (from the TOP-Flash and FOP-Flash plasmids) was measured and compared to the luminescence from the Renilla luciferase reporter. The ratio of Firefly to Renilla luminescence provides a quantitative measure of the transcriptional activity modulated by the β-catenin signaling pathway. pRL-TK, TOP-Flash, and FOP-Flash were provided by Dr. Cefan Zhou (Hubei University of Technology, Hubei).

Wound healing assay

Cells from each experimental group were seeded in 24-well plate using DME/F12 medium supplemented with 2% FBS. Once cells reached 90% confluence, a sterile 200 μL pipette tip was used to create a straight scratch across the cell monolayer. After making the scratch, the cells were gently washed with PBS. Then, the plates refilled with fresh culture media were incubated in a 37 °C and 5% CO2 environment. The progression of cell migration to close the scratch was photographed at 0 h and again at 24 h utilizing a Nikon inverted microscope.

Transwell assay

For cell invasion assay, 1 ×104 cells in 100 μL of serum-free medium were seeded into an 8.0 μm, 24-well Matrigel-coated plate-chamber insert (Corning Life Sciences, #354483). The 10% FBS medium was then added to the lower chamber of the wells. After 24 h, cells were then fixed with 4% paraformaldehyde and washed with PBS for three times. 0.5% crystal violet blue was utilized to stain the cells. Subsequently, cells on the upper side of the insert were eliminated with a swab. Then, invaded cells were imaged and counted.

Immunofluorescent staining

The immunofluorescence staining assay was conducted according to the protocol described before59. After undergoing different treatments, adherent cells were fixed with 4% paraformaldehyde, followed by washing with PBS and permeabilization with Triton X-100. Cells were then incubated with 1% BSA before overnight incubation at 4 °C with primary antibodies. The primary antibodies used were anti-β-catenin (Proteintech, 51067-2-AP, 1:200 for immunofluorescence) and anti-HA (Abmart, M2003, 1:1000 for immunofluorescence) in 1% BSA. Following another PBS wash, appropriate fluorophore-conjugated secondary antibodies were applied. Nuclear DNA was stained using DAPI staining solution (Biosharp, BL105A). Leica TCS-SP8 SR confocal laser scanning microscopy (Leica Microsystems, TCS-SP8 SR, Germany) was used for immunofluorescence imaging.

RIP-qPCR

RNA-protein complexes were isolated for qRT-PCR using immunoprecipitation following the manufacturer’s protocol (Geneseed, P0101). In brief, tissues were homogenized in immunoprecipitation lysis buffer containing ANasin and protease inhibitors, then divided into two groups: one treated with anti-HA-UL41 and the other with anti-IgG as a negative control. Protein A/G magnetic beads were added to capture the target proteins at 4 °C overnight. The associated RNA was subsequently extracted from the beads and analyzed by qPCR.

Quantitative proteome analysis

A549 cells were treated with OH2 (MOI = 1) or PBS for 24 h53. Following treatment, samples were harvested and analyzed with TMT technology at PTM Biolabs Inc (Hangzhou, China). The quantitative proteome analysis encompassed six consecutive steps: protein extraction, SDS-PAGE separation, filter-aided sample preparation, TMT labeling, peptide fractionation with reversed-phase chromatography, and mass spectrometry analysis. Each of the six samples was labeled consecutively from 126 to 131. The MS/MS raw data were processed with Maxquant search engine (v.1.5.2.8). Tandem mass spectra were searched in human UniProt database concatenated with a reverse decoy database. Principal component analysis (PCA) was performed using all proteins, with the results being visualized in a two-dimensional coordinate space based on the two major principal components. Proteins with |log2FC|>1 and a false discovery rate (FDR), determined through Student’s t test followed by multiple test correction using the Benjamini-Hochberg method, less than 0.05 were regarded as differentially expressed. The top downregulated proteins (FDR < 0.05) were chosen for pathway and process enrichment analysis. Additionally, protein-protein interaction enrichment was conducted with Metascape. The process was executed with the default configuration.

In vivo study

BALB/c nude female mice (4-6 weeks, female, 18–22 g) and NOD/SCID female mice (4–6 weeks, female, 18–22 g) were obtained from Hubei Food and Drug Safety Evaluation Center (Wuhan, China) and Hunan SJA Laboratory Animal (Changsha, China), respectively. The mice were raised in a specific pathogen-free (SPF) facility, given ad libitum access to water and food, and maintained on a 12-h light/dark cycle. Experiments were performed after a one-week acclimation period. The animal experiments were approved by the Hubei University of Technology Animal Care and Use Committee (HBUT No. 2021028). The committee stipulated a maximum allowable tumor volume of 2000 mm3, which was not exceeded in any experiments. We have complied with all relevant ethical regulations for animal use. Every effort was made to minimize the number of animals used, as well as their pain and distress, while ensuring the scientific integrity of the experiments.

2 ×106 A549 cells were subcutaneously inoculated into the flank of the NOD/SCID mice to establish subcutaneous xenograft models. Upon the tumors reaching an average volume of 100 ~ 150 mm3, each mouse received an intratumoral injection of either 1 ×106 CCID50 OH2 or equivalent volume of PBS (100 μL). Mice were randomly assigned to either treatment or control groups. Researchers were blinded to the treatment groups. Tumor growth was monitored by measuring the tumor diameters with a caliper, and tumor volume was calculated using the formula: [(major axis) × (minor axis)2 × 0.5]. For histological evaluation, tumors were excised from the euthanized mice. Mice were euthanized using carbon dioxide (CO2) inhalation.

In the in vivo lung cancer metastasis model, A549 cells were treated with either OH2 (MOI = 1) or PBS, suspended in a total volume of 2 mL immediately before intravenous (i.v.) injection. Each BALB/c nude mouse received an intravenous injection of 2 ×106 cells. At three weeks post-injection, the mice were euthanized, and their lungs and livers were collected for metastasis analysis.

Hematoxylin and eosin (H&E) staining and immunohistochemical (IHC) analysis

The excised lung and liver tissues from the mice were fixed in 4% paraformaldehyde, embedded in paraffin, and sectioned into 5 μm slices. These sections were then dewaxed, and H&E staining was performed following the standard histopathological protocol60. At least three regions of each sample were randomly photographed under an optical microscope. The number of metastatic lesions in each mouse’s lung and liver was quantified.

For the IHC analysis, the primary and peroxidase (HRP)-conjugated secondary antibodies utilized were anti-β-catenin antibody (Proteintech, 51067-2-AP, 1:500 for immunohistochemistry) and HRP conjugated Goat Anti-Rabbit IgG (Servicebio, GB23303, 1:500 for immunohistochemistry). Immunohistochemical staining quantification was performed by assessing both the proportion and intensity of staining, as per established protocols61. Five representative fields from each tumor section were captured using a microscope. These images were then analyzed using ImageJ software, which provided measurements for the area, mean, and integrated optical density (IOD). The average optical density (AOD) values across these fields were calculated using the formula AOD = IOD/area.

Statistics and reproducibility

Statistical analyses were performed using unpaired t-test for comparisons between two independent groups. For comparisons involving more than two groups, one-way analysis of variance (ANOVA) with Tukey’s post hoc test was applied. Sample sizes are indicated in the figure legends. Differences were considered statistically significant at P < 0.05. All analyzes were conducted using GraphPad Prism (La Jolla, CA, USA) and data were presented as means ± SEM from at least three experiments.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.