Table 1 List of antibodies, Drosophila lines, oligonucleotides and reagents used in this study
From: A GABAergic Maf-expressing interneuron subset regulates the speed of locomotion in Drosophila
Primary antibodies | Species | Dilution | Source |
|---|---|---|---|
Antibodies list | |||
Anti-TJ | Guinea Pig | 1:4000 | Gift from D. Godt18 |
Anti-Engrailed 4D9 | Mouse | 1:50 | Development Studies Hybridoma Bank, University of Iowa |
Anti-pMad | Rabbit | 1:500 | |
Anti-GFP | Chicken | 1:2000 | Abcam Ab13970 |
Anti-GFP | Rabbit | 1:4000 | Invitrogen A6455 |
Anti-RFP | Rabbit | 1:8000 | Gift from S. Heidmann46 |
Anti-myc 9E10 | Mouse | 1:40 | Development Studies Hybridoma Bank, University of Iowa |
Anti-eve 3C10 | Mouse | 1:40 | Development Studies Hybridoma Bank, University of Iowa |
Anti-eve | Rabbit | 1:200 | Gift from M. Frasch47 |
Anti-vGlut (C-ter) | Rabbit | 1:1000 | Gift from H. Aberle48 |
Anti-Gad1 818 | Rabbit | 1:500 | Gift from F.R. Jackson49 |
Anti-Repo 8D12 | Mouse | 1:40 | Development Studies Hybridoma Bank, University of Iowa |
Anti-Prospero | Mouse | 1:40 | Development Studies Hybridoma Bank, University of Iowa |
Anti-FasII 1D4 | Mouse | 1:80 | Development Studies Hybridoma Bank, University of Iowa |
Anti-5-HT | Rabbit | 1:2000 | Immunotech ref. 0601 |
Anti-Jumu | Rabbit | 1:800 | Gift from J. Enriquez50 |
Secondary antibodies | Species | Dilution | Source |
|---|---|---|---|
Anti-guinea pig A488 | Goat | 1:1000 | Alexa FluorTM (Invitrogen) |
Anti-guinea pig A555 | Goat | 1:2000 | |
Anti-guinea pig A647 | Donkey | 1:1000 | |
Anti-chicken A488 | Goat | 1:1000 | |
Anti-mouse A488 | Donkey | 1:1000 | |
Anti-mouse A405 | Goat | 1:1000 | |
Anti-mouse A555 | Donkey | 1:2000 | |
Anti-mouse A647 | Donkey | 1:1000 | |
Anti-rabbit A488 | Donkey | 1:1000 | |
Anti-rabbit A555 | Donkey | 1:2000 | |
Anti-rabbit A647 | Donkey | 1:1000 | |
Other reagents | |||
Phalloïdin-FluoProbes 647 | NA | 1:25 | FP-BA0320, Interchim |
Drosophila lines | Source | Identifier |
|---|---|---|
Drosophila stocks | ||
TJ-Gal4 | Tokyo Stock Center | DGRC # 104055 |
TJ-Flp | Generated by the lab | NA |
Isl − Ƭmyc | ||
Gad1-LexA | Bloomington Stock Center | BL # 60324 |
vGlut-LexA | Bloomington Stock Center | BL # 60314 |
ChAT-LexA | Bloomington Stock Center | BL # 60319 |
UAS-TrpA1 | Bloomington Stock Center | BL # 4308 |
UAS-shi ts | NA | |
lexAop > stop > dTrpA1 (2 lines on IId and IIId chromosomes) | Obtained from the Rubin lab (Janelia Research Campus) | NA |
Per-LexA | Tokyo Stock Center | DGRC # 116999 |
Per-Gal4 | Bloomington Stock Center | BL # 7127 |
FkhGFP | Bloomington Stock Center | BL # 43951 |
Tsh-LexA | Gift from J. Simpson (UC Santa Barbara)41 | NA |
Tsh-Gal80 | Gift from G. Miesenböck (University of Oxford)22 | NA |
lexAop-IVS-tdTomato.nls | Bloomington Stock Center | BL # 66680 |
UAS-H2AGFP | NA | |
20XUAS-6XGFP | Bloomington Stock Center | BL # 52262 |
Act»Gal4 | Bloomington Stock Center | BL # 4779 |
UAS-CD8GFP | Bloomington Stock Center | BL # 5137 |
CQ2-LexA | Gift from C. Doe (University of Oregon)13 | NA |
sim-Gal4 (or sim3.7-Gal4) | Bloomington Stock Center | BL # 9150 |
Hlh3bGFP | Gift from P. Tomancak (Max Planck Institute) (unpublished) | NA |
Grain-lacZ | NA | |
Gad1 AD | Bloomington Stock Center | BL # 60322 |
UAS-LexA DBD | Bloomington Stock Center | BL # 56528 |
UAS-myrGFP | Bloomington Stock Center | BL # 32198 |
B-H1-Gal4 | NA | |
JRC-SS00863 (split Gal4 for Ladder-d) | ||
Tdc2-Gal4 | Bloomington Stock Center | BL # 9313 |
Dimm-Gal4 | Bloomington Stock Center | BL # 25373 |
TH-Gal4 (also called ple-Gal4) | Bloomington Stock Center | BL # 8848 |
vmatGFP | Bloomington Stock Center | BL # 60263 |
UAS»TrpA1 myc | Bloomington Stock Center | BL # 66871 |
lexAop-Flp | Bloomington Stock Center | BL # 55820 |
lexAop > stop > CsChrimsonVenus | Obtained from Rubin lab (Janelia Research Campus) | NA |
GMR47G08-LexA | Bloomington Stock Center | BL # 52793 |
Components | Plasmid of origin | Source |
|---|---|---|
Generation of the TJ-Flippase | ||
kanR | 2xTY1-kanR | Gift from P. Tomancak (Max Planck Institute)23 |
Late SV40 pA | pCAGGS-Ires2-eGFP-linkerPacI-sv40pA | Gift from J.F. Brunet (ENS Paris) |
nlsFlpO | pPGK FlpO bpA | Gift from S. Bourane, Goulding lab (Salk Institute) |
pFly-fosmid-TJ | NA | Gift from P. Tomancak23 |
pRed-Flp4 | NA | |
Oligonucleotide name | Sequence | Use |
|---|---|---|
recTJsens | 5′ATGTGAGACCCGTAATCGACCCTC TCCGGTCCCTGGTCGATCCAATGAA AATGGCTCCTAAGAAGAAGAGG (TJ 5′ homologous sequence) (FlpO 5′ sequence) ATG: start codons in tj | Amplification of FlpO-lateSV40pA-kanR cassette to add homologous recombination arms to it |
recTJantisens | 5′ATTCATTAATTTAGATTTATTTAT TACTAAATTGTTTTATGCACACTTA TAACTCAGAAGAACTCGTCAAG (TJ 3′ homologous sequence) (KanR 3′ sequence) | Amplification of FlpO-lateSV40pA-kanR sequence to add homologous recombination arms to it |