Table 1 List of the significant variants found after the IPTG-induction of KS1 in strain C5 at passage three (sample p3IPTG).

From: A genetic toolkit and gene switches to limit Mycoplasma growth for biosafety applications

POS	QUAL	TOT	REFN	ALTN	FRAC	REF	ALT	IMPACT	AFF	MUT	EFF	INFO
566053	1.95E-13	559	446	113	25.3	CGCAAA	TGCTAT	HIGH	LacI4	LR208*	stop gained	Expression of Nter fragment of LacI; Intact DNA-binding domain
569125	0.00E+00	534	463	71	15.3	ATCAAACT	GTCAACC	HIGH	cas9B	K896fs	frameshift variant	Expression of truncated Cas9; Deletion of RuvCIII domain (affecting the Nuc lobe) and PAM-Interacting (PI) domain. The deletions of PI domain abolish cleavage activity
566053	0.00E+00	271	224	47	21.0	CGCAA	CACAT	MODERATE	LacI4	LR208MC	missense variant	Mutation of a critical residue in the LacI protein for IPTG binding. It does not affect LacI structure
566419	1.17E-13	609	571	38	6.7	G	A	MODERATE	LacI4	A87V	missense variant	Mutation that affects the hydrophobic surface of the IPTG binding pocket in the LacI protein
566416	3.47E-14	281	255	26	10.2	GGTGCGT	CGTTCTT	MODERATE	LacI4	HAP86QER	missense variant	Mutation that affects the hydrophobic surface of the IPTG binding pocket in the LacI protein
569127	8.08E-15	235	210	25	11.9	CAAACT	CAACT	HIGH	cas9B	P897fs	frameshift variant	Expression of truncated Cas9; Deletion of RuvCIII domain (affecting the Nuc lobe) and PAM-Interacting (PI) domain. The deletions of PI domain abolish Cas9 cleavage activity
571681	0.00E+00	481	469	12	2.6	ATTTTTTTTGATA	ATTTTTTTGATA	HIGH	cas9B	N46fs	frameshift variant	Loss of reading frame that prevents expression of Cas9; The mutation affects the protein from its first domain RuvCI
566420	0.00E+00	607	596	11	1.8	C	A	MODERATE	LacI4	A87S	missense variant	Mutation that affects the hydrophobic surface of the IPTG binding pocket in the LacI protein
566423	9.10E-15	616	606	10	1.7	G	A	MODERATE	LacI4	H86Y	missense variant	Mutation that affects the hydrophobic surface of the IPTG binding pocket in the LacI protein
571681	7.90E-15	191	182	9	4.9	ATTTTTTTTGATACT	ATTTCTTTAGAAACA	HIGH	cas9B	SIKK42*	stop gained	Expression of a small Nter fragment of the Cas9 that has only a portion of the RuvCI domain
566193	7.10E-15	291	284	7	2.5	CACGTCGAGAAAT	TATGACGAAAAAA	MODERATE	LacI4	LFLDV158FFFVI	missense variant	Mutation of a critical residue in the LacI protein for IPTG binding. It does not affect LacI structure
566423	1.70E-14	292	285	7	2.5	G	A	MODERATE	LacI4	H86Y	missense variant	Mutation that affects the hydrophobic surface of the IPTG binding pocket in the LacI protein
568288	0.00E+00	231	225	6	2.7	ATTTTTTTCAAAGGA	ATTTTTTTCTATGGT	MODERATE	cas9B	SF1173TI	missense variant	Mutation in the PAM-recognition domain of the Cas9 protein; Deletion of the PI domain abolish Cas9 cleavage activity
565983	2.26E-16	299	293	6	2.0	C	A	MODERATE	LacI4	W232C	missense variant	Mutation that affects the hydrophobic surface of the IPTG binding pocket in the LacI protein
569609	0.00E+00	206	201	5	2.5	ATACCTTTTTTAATAG	TTACTTTTTTTAATAG	MODERATE	cas9B	GI736SN	missense variant	Mutation in the mid helix A in RuvCII domain on Nuc lobe of the Cas9 that may affect the interaction with gRNA
569662	1.25E-15	207	202	5	2.5	ACTATCG	TCTTTCG	MODERATE	cas9B	DS718ER	missense variant	Mutation in the RuvCII domain of Cas9
565929	6.21E-15	232	227	5	2.2	AACAATCCCCTCATTTAA	AACAATCCCCTTTTTTTA	HIGH	LacI4	LNE245*	stop gained	Expression of Nter fragment of LacI; Intact DNA-binding domain
570703	0.00E+00	237	232	5	2.2	AAA	GAT	MODERATE	cas9B	F372I	missense variant	Mutation in the domain REC1 of Cas9
566136	0.00E+00	243	238	5	2.1	TAAGCGGGTCCCATCTTCGT	TTAGCCGGTCCCATCTTCGT	HIGH	LacI4	RL180*	stop gained	Expression of Nter fragment of LacI; Intact DNA-binding domain
571104	0.00E+00	193	189	4	2.1	CAAATAAGCCA	CTATTAAGCCA	MODERATE	cas9B	F238I	missense variant	Mutation in the domain REC2 of Cas9
565908	0.00E+00	246	242	4	1.7	CGCCACGAG	TGCCTCGTG	MODERATE	LacI4	LV255HE	missense variant	Mutation next to a Hotspot point mut Is phenotype; LacI incapable of induction
568065	0.00E+00	200	197	3	1.5	TATCTT	CATCAT	MODERATE	cas9B	EDN1250DDD	missense variant	Mutation in the PI domain of Cas9
568703	5.38E-15	200	197	3	1.5	TAAAAG	CAATAC	MODERATE	cas9B	FFY1037LYC	missense variant	Mutation in the RuvCIII domain of Cas9

Columns correspond to genome loci (base pair position in the C5 genome; POS); Estimate of the probability of a polymorphism at the loci described by the record (QUAL). This value is presented in phred scale and takes into consideration both mapping and genotype quality for a specific variant; total number of reads obtained for the loci (TOT); Total number of reads matching the reference (REFN); number of reads presenting a variant (ALTN); Frequency of the variant normalised by the total reads found mapping that specific loci (FRAC); Reference sequence in the genome (REF); variant sequence (ALT); Degree of impact of the variant (IMPACT), which is classified as 'LOW' (synonymous mutations), 'MODERATE' (missense), “HIGH” (nonsynonymous mutations, start or stop loss), or MODIFIER (variant found in an intergenic region); gene affected (AFF, in case the mutation is found intergenic, it is reported the closest downstream gene); Mutation or variant (MUT; an asterisk indicating stop codon); potential effect of the variant as given by snpeff¹⁰² (EFF); and, in last column (INFO), short explanation of the expected effect of the variant in the mechanism of the kill-switch based on the literature (see references ^{48 and 81}). The full list of variants is provided in Supplementary Data 3.

Back to article page

Table 1 List of the significant variants found after the IPTG-induction of KS1 in strain C5 at passage three (sample p3IPTG).

Search

Quick links