Table 2 Cases with known gene, novel mutation mechanisms described in this manuscript for the first time
Pedigree | ID number | Gene | Disease Name | Phenotype-specific OMIM ID | Variant | Zygosity | Known gene, novel mutation mechanism |
|---|---|---|---|---|---|---|---|
F141 | 08DG-00413 | OTX2 | OTX2-related inherited retinal degeneration with female infertility | Not listed | NM_001270525.2:r.98_273del;p.(Pro34Metfs*3) | Homozygous | Biallelic rather than monoallelic |
F2924 | 12DG1193 | NOTCH2 | NOTCH2-related retinitis pigmentosa | Not listed | NM_024408.4:c.1619C>T;p.(Pro540Leu) | Homozygous | Biallelic rather than monoallelic |
F3108 | 12DG1912 | FOXE3 | Anterior segment dysgenesis 2, multiple subtypes | 610256 | NM_012186.3:c.720 C > A;p.(Cys240*) | Homozygous | Biallelic rather than monoallelic |
F3151 | 12DG2122 | VPS13B | Cohen syndrome | 216550 | NM_152564.5:c.5783 C > T;p.(Pro1928Leu) | Homozygous | Missense rather than LOF |
F4370 | 14DG1521 | RIMS1 | Cone-rod dystrophy 7 | 603649 | ENST00000521978.1:c.3143 T > G;p.(Leu1048*) | Homozygous | Biallelic rather than monoallelic |
F4422 | 14DG1734 | AKT3 | Megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome 2 | 615937 | NM_005465.7:c.1393 C > T;p.(Arg465Trp) | Heterozygous (De novo) | Constitutional rather than mosaic |
F454 | 09DG00739 | NOTCH2 | NOTCH2-related retinitis pigmentosa | Not listed | NM_024408.4:c.1619C>T;p.(Pro540Leu) | Homozygous | Biallelic rather than monoallelic |
F4735 | 15DG0159 | COL9A3 | Stickler syndrome, type VI | 620022 | NM_001853.4:c.754 C > T;p.(Arg252*) | Homozygous | Biallelic rather than monoallelic |
F531 | 09DG00980 | MAPRE2 | Symmetric circumferential skin creases, congenital, 2 | 616734 | NM_001384732.1:c.8150_8151delGA;p.(Gly2717Alafs*40) | Homozygous | Biallelic rather than monoallelic |
F5683 | 16DG1189 | MYH9 | Macrothrombocytopenia and granulocyte inclusions with or without nephritis or sensorineural hearing loss | 155100 | NM_002473.6:c.2206 G > A;p.(Gly736Arg) | Homozygous | Biallelic rather than monoallelic |
F6666 | 19DG0767 | ABL1 | ABL1-related mirror image of CHDSKM | Not listed | NM_005157.6:c.1966_2011dupCCAGCCAAGTCCCCAAAGCCCAGCAATGGGGCTGGGGTCCCCAATG;p.(Gly671Alafs*93) | Homozygous | Biallelic LOF rather than de novo GOF |
F8175 | PSMMC-0351 | PHOX2B | Central hypoventilation syndrome, congenital, 1, with or without Hirschsprung disease | 209880 | NM_003924.3:c.590del;p.(Gly197Alafs*112) | Heterozygous | De novo LOF rather than repeat expansion |
F8309 | PSMMC-0377 | AKT3 | AKT3-related NDD with microcephaly | Not listed | Large deletion chr1:238817161-249224684 involving ZBTB18, HNRNPU, and AKT3 | Heterozygous | LOF rather than GOF |
F8399 | 20DG1091 | ADSS1 | Myopathy, distal, 5 | 617030 | NM_152328.5:c.1073+1− > T | Homozygous | LOF rather than missense |
F8485 | PSMMC-0385 | KCNMA1 | KCNMA1-related NDD | Not listed | 10q22.3(79364485-79611505)x3 | Heterozygous | Triplo-sensitivity |
F9597 | 22DG1526 | RHOBTB2 | RHOBTB2-related neurodevelopmental disorder | Not listed | NM_015178.3:c.394 C > T;p.(Arg132*) | Homozygous | Biallelic rather than monoallelic |
F9792 | Fetus of 23DG1304 | VPS50 | VPS50-related hydrocephalus | Not listed | NM_017667.4:c.1705C>T;p.(Arg569*) | Homozygous | LOF rather than missense |
F9145 | PSMMC0442 | MPL | Thrombocythemia 2 | 601977 | NM_005373.3:c.317 C > T;p.(Pro106Leu) | Homozygous | Biallelic rather than monoallelic |
F6329 | 19DG2474 | SCN3A | Epilepsy, familial focal, with variable foci 4 | 617935 | NM_006922.4:c.3003 G > C;p.(Met1001Ile) | Homozygous | Biallelic rather than monoallelic |
F7988 | 20DG0276 | ACVR2B | Heterotaxy, visceral, 4, autosomal | 613751 | NM_001106.4:c.92 A > G;p.(Tyr31Cys) | Homozygous | Biallelic rather than monoallelic |
F9176 | PSMMC9176 | CRYBA4 | Cataract 23 | 610425 | NM_001886.3:c.206 T > C;p.(Leu69Pro) | Homozygous | Biallelic rather than monoallelic |
F4216 | 14DG0915 | COL2A1 | COL2A1-related arthrogryposis | Not listed | NM_001844.5:c.985 C > T;p.(Pro329Ser) | Homozygous | Biallelic rather than monoallelic |
F5095 | 15DG1215 | CREBBP | Rubinstein-Taybi syndrome 1 | 180849 | Multi-exon duplication (4–11) | Homozygous | Biallelic rather than monoallelic |
