Fig. 1: Framework of a DNA data storage system with searching capability and the general workflow of SEEKER.

a Complete framework of a searchable DNA data storage system includes writing, searching, and reading the data. b The oligo pool storing text data is separately constructed into two parts: reference strands and data strands. The reference strands usually comprise 100–200 oligos and can be pre-sequenced to determine the dictionary used to map the data strands to binary codes as well as the crRNA spacer sequence of an intended query, for instance the keyword “courage” corresponds to the sequence “CTGTGCTAGCGTATGGCTCAT” in crRNA. The data strands are selectively amplified according to file IDs and then incubated with the Cas12a-crRNA ribonucleoprotein complex. The fluorescence intensity increases rapidly if the amplified file contains many repeats of the keyword “courage”, generating a strong fluorescence signal within a short time. If fewer instances of the keyword “courage” appear in the file, the fluorescence enhancement retards, and the endpoint fluorescence intensity becomes weaker. If the keyword “courage” is not found in the file, no fluorescence will be detected. After searching, files generating positive signals are recognized as carrying the data-of-interest and are subjected to next-generation sequencing to recover the complete content. In this example, a stronger signal is generated when the keyword “courage” appears twice, whereas a weaker signal is generated when the keyword only appears once. Illustrations were created with BioRender.com.