Fig. 6: Length variation of fine-mapped TRs associates with local gene expression and DNA methylation. | Nature Communications

Fig. 6: Length variation of fine-mapped TRs associates with local gene expression and DNA methylation.

From: A phenome-wide association study of tandem repeat variation in 168,554 individuals from the UK Biobank

Fig. 6: Length variation of fine-mapped TRs associates with local gene expression and DNA methylation.

A Fine-mapped TRs showed significant enrichments for both eQTLs and mQTLs in the GTEx cohort and were often associated with the same gene as which the TR was located within. Points at the center of each error bar represent the QTL enrichment, while horizontal lines indicate 95% confidence intervals. The eQTL and mQTL enrichments shown for PheWAS significant TRs are based on 1573 and 1342 TRs, respectively, while for high confidence fine-mapped TRs, enrichments shown are based on 44 and 37 TRs, respectively. P values were calculated using a two-tailed Fisher’s exact test. B, C Results for an exonic poly(CCA) motif in HRCT1 associated with both normalized HRCT1 expression (shown for aorta tissue) and DNA methylation of a CpG (cg21518683) in the 3′UTR of HRCT1 (shown for transverse colon tissue). D A poly(CGC) motif within the 5′UTR of GNB2 associated with GNB2 expression (shown for left ventricle tissue). E A poly(GCCGCTGCCGACCTCGCTGT) motif within the 5’UTR of EIF4A3 associated with EIF4A3 expression (shown for cultured fibroblasts). In BE, p values were calculated using linear regression, gray shading represents the 95% confidence intervals for the regression slope.

Back to article page