Fig. 2: Construction of allulose-responsive biosensors in C.glutamicum.
a Several hybrid promoters were designed by inserting PsiO sequence (ATTGCACAATCGATGGTGCAA) into different positions of Ptuf and PtacM promoters for eGFP expression. b The fluorescence of PAB1-6 at 0/50 mM allulose. PAB1: PtufU; PAB2: PtufM; PAB3: PtufD; PAB4: PtacMU; PAB5: PtacMM; PAB6: PtacMD. c Optimization of PsiR expression using eleven promoters possessing different expression strength. d The fluorescence of PAB6-16 from 0 mM to 200 mM allulose. PAB6: PH36; PAB7: PL26; PAB8: PL80; PAB9: Psod; PAB10: PM5; PAB11: PM6; PAB12: PM10; PAB13: P11F; PAB14: Ptuf; PAB15: PH5; PAB16: PH9. e Optimization of eGFP expression through changing the spacer sequence between RBS and initiation codon ATG of eGFP. f The fluorescence of PAB17-27 at 0/20 mM. In panel (f), the gray shaded region highlights PAB6 and PAB16, which did not undergo RBS replacement and serve as reference biosensors for comparison with RBS1–RBS11. PAB17: RBS1; PAB18: RBS2; PAB19: RBS3; PAB20: RBS4; PAB21: RBS5; PAB22: RBS6; PAB23: RBS7; PAB24: RBS8; PAB25: RBS9; PAB26: RBS10; PAB27: RBS11. The detailed sequence for RBS1-11 was shown in Supplementary Table 2. g Optimization of PsiR expression through replacing the spacer sequences (TACTT) between the RBS of PM10 and ATG in PAB27 with five random nucleotides (NNNNN). More than 1400 strains were screened under 0/50 mM allulose. Four biosensors PAB28-PAB31 with significant increase in signal output relative to PAB27 were selected for detailed characterization. h The detailed Hill equation data of different PABs from 0 mM to 200 mM allulose. Data are presented as mean values +/−SD (n = 3 independent experiments). Statistical analysis was performed by two-sided t test with Welch’s correction (b) comparing 0 and 50 mM allulose for each construct, and by one-way ANOVA (f) followed by Dunnett’s post hoc test using PAB16 as the control to compare PAB17–PAB27 with PAB16. Source data for (b, d, f, h) are provided as a Source Data file.
