Author Correction: Sin1 phosphorylation impairs mTORC2 complex integrity and inhibits downstream Akt signalling to suppress tumorigenesis

Correction to: Nature Cell Biology https://doi.org/10.1038/ncb2860, published online 27 October 2013.

In the version of this Article originally published, the labels for Rictor and mTOR in the whole cell lysate (WCL) blots were swapped in Fig. 3b and the mTOR blot was placed upside down. Unprocessed blots of mTOR were also missing from Supplementary Fig. 9. The corrected Figs are shown below. In addition, control blots for the mTOR antibody (Cell Signalling Technology #2972) were also missing. These are now provided below, as Fig. 9, and show that the lower band is likely non-specific.

Fig. 3

Original and Corrected.

Fig. 9: mTOR antibody #2972 control blots.

a–c, Using a newly purchased poly-clonal mTOR antibody (Cell Signalling Technology #2972), two bands are detected in HeLa (a) and in 293T (b) whole cell lysates with a top band above 170 Kd and a lower band above 130Kd, whereas three bands are seen in 293 cells (c). Western blot analysis of WCL derived from stable cell lines generated by lenti-viral infection of two independent shRNAs against human mTOR (shmTOR-1: TCAGCGTCCCTACCTTCTTCT (from Addgene 1855) and shmTOR-2:CCGCATTGTCTCTATCAAGTT (from Addgene 1856)), that were confirmed through DNA sequencing, shows that the lower band detected by the #2972 antibody appears to be likely non-specific, given that mTOR depletion significantly reduces only the top band in HeLa (a), 293T (b) and 293 (c) cells. On the other hand, another rabbit monoclonal antibody against mTOR (Cell Signalling Technology #2983) that was not used in the original paper, detects only the upper band in this experimental setting (bottom blots in a (HeLa) and c (293)).

Supplementary Fig. 9

Original and Corrected.