Correction to: Nature Cell Biology https://doi.org/10.1038/s41556-020-0564-2, published online 31 August 2020.
In the version of this Letter originally published, the morpholino sequences in the Methods section ‘morpholino injections’ were incorrect. “One-cell-stage embryos were injected with 2.3 nl of 250–500 μM duox morpholino 1 (MO1: 5′- AAGCGTCACTTACTATAATGTTGGA-3′; Gene Tools) or misprime morpholino (MP: 5′-TCCCTTTTAGAATTTACCTTGCCGA-3′; Gene Tools)2, together with 200 μM p53 morpholino (5′-ATGCTCAACTATAATGTTGGACATT-3′; Gene Tools)38 diluted in water” should instead read “One-cell-stage embryos were injected with 2.3 nl of 250–500 μM duox morpholino 1 (MO1: 5′- AGTGAATTAGAGAAATGCACCTTTT-3′; Gene Tools) or misprime morpholino (MP: 5′- AGTcAATTAcAGAAATcCAgCTaTT -3′; Gene Tools)2, together with 200 μM p53 morpholino (5′- GCGCCATTGCTTTGCAAGAATTG -3′; Gene Tools)38 diluted in water.” The error has been corrected.
Author information
Authors and Affiliations
Corresponding author
Rights and permissions
About this article
Cite this article
Katikaneni, A., Jelcic, M., Gerlach, G.F. et al. Author Correction: Lipid peroxidation regulates long-range wound detection through 5-lipoxygenase in zebrafish. Nat Cell Biol 23, 566 (2021). https://doi.org/10.1038/s41556-021-00683-0
Published:
Version of record:
Issue date:
DOI: https://doi.org/10.1038/s41556-021-00683-0