Main

Over 80% of cytosines in the context of CpG dinucleotides are methylated in mammalian genomes. Methylation of CpG-dense promoters causes stable transcriptional repression1,2 and is the basis for long-term monoallelic silencing3, such as X chromosome inactivation and genomic imprinting4. DNA methylation is also associated with silencing of retrotransposons in somatic tissues5 and tumor suppressor genes in cancer1.

Two pathways, which are not mutually exclusive, are presumed to be responsible. The first operates in an indirect manner, via proteins that recognize methylated CpGs, as first shown for the MBD of MeCP2 (ref. 6). Based on homology, four additional MBD proteins (MBD1–4) as well as six proteins with an MBD-like domain, also known as a TAM (TIP5/ARBP/MBD) domain, were discovered7,8,9; the latter, however, did not bind methylated DNA10,11. Only four MBD proteins harbor a functional domain that binds methylated DNA in vitro and in vivo: MeCP2, MBD1, MBD2 and MBD4 (refs. 6,9,12). MBD3 harbors a mutated MBD13, which does not locate to methylated sequences in the genome9,12,13,14 and is not required for its function15. Other factors bind methylated DNA via structurally divergent domains yet require additional sequence context or are limited to hemimethylated DNA16. In contrast, 5mC-binding MBD proteins recognize symmetrically methylated CpG dinucleotides in a largely sequence-independent fashion12,16. Together with protein interaction studies and in vitro experiments, these findings have established a model in which MBD proteins recruit histone deacetylases to methylated DNA, contributing to transcriptional repression17,18,19,20,21.

The second mechanism for repression is direct obstruction of TF binding by cytosine methylation within their motif22. Although sensitivity of several TFs to methylation of their binding site has been observed in biochemical assays23,24,25,26,27,28,29, evidence in the cellular context remains scarce28,29,30.

Defining the contribution of both pathways is critical for our understanding of epigenetic silencing in mammals. Loss of individual MBD proteins results in only mild phenotypes in mice31,32,33 with the exception of MeCP2, whose mutation can cause Rett syndrome19,34,35. Combinatorial deletions of Mbd2/MeCP2 (ref. 19) or Mbd2/MeCP2/Kaiso36 in mice did not reveal a pronounced phenotype (other than Rett syndrome). Functional redundancy between MBDs has accordingly been suggested to account for the absence of severe transcriptional upregulation in the single or combinatorial knockouts generated thus far7,37. To date, no combined genetic deletion of all four MBD proteins has been reported.

Complete removal of DNA methylation has been achieved by deletion of the DNA methyltransferases (DNMTs) Dnmt1, Dnmt3a and Dnmt3b. This, however, led to rapid cell death in all tested mammalian cell types with the exception of mouse embryonic stem (ES) cells38,39,40. These are derived from preimplantation blastocysts, whose genomes are globally demethylated41. Thus, mechanisms are in place to ensure cellular function despite low DNA methylation levels, which are lost in soma42. The observed essential nature of DNMTs in other contexts has been attributed to misregulation of critical genes43, activation of repeats44 or to DNA damage and the resulting mitotic catastrophe38.

Here we aimed to tease apart the contribution of direct versus indirect modes of repression by contrasting cells lacking DNA methylation (both modes affected) and those lacking MBDs (only indirect mode affected). We generated cells lacking all four functional MBD proteins, which unexpectedly had only a minor impact on gene expression in both murine stem cells and derived neurons, as well as a human cell line. The absence of DNA methylation, however, activates genes controlled by methylated CpG islands and causes rampant transcription of retrotransposons specifically in neurons. This entails reorganization of the accessibility landscape by TFs that are methylation sensitive, driving both genic and repeat upregulation. Together, these results suggest direct inhibition of TF binding as the prevailing mode of repression of regulatory regions by DNA methylation.

Results

ES cells are viable in the absence of 5mC-binding MBD proteins

Because mouse ES cells are viable in the absence of DNA methylation42,45, we reasoned that they should be amenable to comprehensive deletions of readers of this epigenetic mark. We focused on MBD1, MBD2, MBD4 and MeCP2 (henceforth MBD proteins) as established 5mC binders in vitro and in vivo6,9,12. Using sequential CRISPR targeting we generated two independent mouse ES cell lines, using a different set of guide RNAs, that are a quadruple knockout of these four MBD protein genes (MBD–QKO) as verified by sequencing and immunoblotting (Fig. 1a and Extended Data Fig. 1a,b).

Fig. 1: ES cells are viable in the absence of 5mC-binding MBD proteins and display limited changes in transcription and chromatin accessibility.
Fig. 1: ES cells are viable in the absence of 5mC-binding MBD proteins and display limited changes in transcription and chromatin accessibility.The alternative text for this image may have been generated using AI.
Full size image

a, Detection of MBD proteins by immunoblot in nuclear extracts from WT ES or two MBD–QKO clones (cl. 1 and 2) derived independently with different sets of gRNAs. Actin or lamin serves as loading control. Blots are representative of at least three independent experiments. b, Representative images showing morphology of WT, MBD–QKO and DNMT–TKO ES cells. Scale bars, 50 µm. c, Number of differentially expressed genes (false discovery rate (FDR) ≤ 0.01 and |log2 fold change (FC)| ≥ 1) measured by RNA-seq in mutant ES cell lines compared with WT. d, Number of differentially accessible peaks (FDR ≤ 0.01 and |log2FC| ≥ 1) as measured by ATAC–seq in mutant ES cell lines compared with WT. c,d, Replicates from both MBD–QKO clones were combined. e, Chromatin accessibility changes in different cell lines at motifs NRF1 (n = 745) or BANP (n = 13) (indicated by sequence logo on top) that gained accessibility (from d) in DNMT–TKO ES cells. ATAC–seq replicates were merged and replicates from both MBD–QKO clones were combined.

Source data

MBD–QKO ES cells are viable in culture, with normal proliferation and morphology (Fig. 1b). Also, at the level of the transcriptome, MBD–QKO ES cells closely resemble wild-type (WT) ES cells (Extended Data Fig. 1c). Only two genes are reproducibly upregulated in both clones while 33 are downregulated (Fig. 1c and Extended Data Fig. 1c–e). This limited transcriptional response is unlikely to be the result of compensatory mechanisms that follow a stronger, transient response because it was also observed following acute depletion of a single remaining MBD by small interfering RNA knockdown in a MBD triple-knockout cell line (MBD–TKO) (Extended Data Fig. 1f–i). To determine genome-wide effects on chromatin accessibility in MBD–QKO cells we performed an assay for transposase-accessible chromatin using sequencing (ATAC–seq). This revealed only minor changes in MBD–QKO, in line with the modest transcriptional response (Fig. 1d and Extended Data Fig. 1j).

To contrast loss of the tested MBD proteins with that of DNA methylation, we deleted Dnmt1/3a/3b in ES cells using CRISPR–Cas9 (DNMT–TKO), rendering ES cells free of DNA methylation. In contrast to MBD–QKO ES cells, DNMT–TKO ES cells display gene expression changes at several hundred genes, with 504 down- and 849 upregulated (Fig. 1c). Upregulated genes are enriched for being gamete specific (Extended Data Fig. 1e), because many of these are controlled by CpG-rich promoters that are methylated and silent outside of the germline46.

Profiling the chromatin accessibility landscape by ATAC–seq in DNMT–TKO ES cells identified several thousand regions that gain accessibility compared with WT (Fig. 1d). As previously observed by us using DNase-seq30, these are methylated in WT, located distally from promoters (Extended Data Fig. 1k) and contain motifs for known methylation-sensitive TFs such as NRF1 (ref. 30) or BANP47. In cells lacking MBD proteins, these sites do not gain accessibility (Fig. 1e).

In summary, while ES cells tolerate the loss of either MBD proteins or DNMTs, only the absence of DNA methylation substantially perturbs the transcriptome and genomic accessibility.

Neuronal transcriptomes in the absence of DNMT or MBD proteins

DNA methylation-independent pathways, such as trimethylation of lysine 9 of histone H3 (H3K9me3), which is mediated by SETDB1 and targeted via KRAB-ZNF proteins, are thought to account for repeat repression in DNMT–TKO ES cells42,45,48,49,50,51,52,53. As a direct test of whether this could similarly mask potential functions of MBD proteins, we reduced SETDB1 levels by siRNA transfection in WT, DNMT–TKO and MBD–QKO ES cells (Extended Data Fig. 1l). We then monitored expression levels of evolutionary young intracisternal A-type particle (IAP) repeats54 (Extended Data Fig. 1l), which showed strong upregulation only in DNMT–TKO cells and not in MBD–QKO or WT cells45. Thus, the absence of DNA methylation but not of MBD proteins causes increased sensitivity to levels of SETDB1.

Next we reasoned that a repressive role of MBD proteins might be evident only in differentiated cells, where DNA methylation becomes essential38,40,55,56,57,58,59. Testing this is hindered by the fact that DNMT–TKO cells do not differentiate when using a classic, several-week-long protocol to generate neurons42,60 (data not shown), in line with the observation that DNA hypomethylation in the adult brain causes lethality in neurons61,62. We speculated that a rapid differentiation regime might enable generation—at least for a limited time—of methylation-free neuronal cells: ectopic expression of a neurotrophic TF (NGN2) produces functional glutamatergic neurons within a few days63,64. The parental ES cell line from which all clones were derived harbors a dox-inducible Ngn2 expression cassette. Following induction of Ngn2, both DNMT–TKO and MBD–QKO cells exited the cell cycle, adopted neuronal morphology and formed axonal networks similar to WT within about 3 days (Fig. 2a and Extended Data Fig. 2a,b).

Fig. 2: Neurons lacking MBD or DNMT proteins display distinct transcriptional phenotypes.
Fig. 2: Neurons lacking MBD or DNMT proteins display distinct transcriptional phenotypes.The alternative text for this image may have been generated using AI.
Full size image

a, ES cells carrying an inducible Ngn2 expression cassette can be rapidly differentiated towards neurons. Images represent morphology of WT, MBD–QKO and DNMT–TKO neurons 8 days after induction for at least three independent differentiation experiments. Scale bars, 50 µm. b, Gene expression changes between mutant and WT neurons; left, MBD–QKO; right, DNMT–TKO. Differentially expressed genes are depicted in blue or green (FDR ≤ 0.01 and |log2FC| ≥ 1); genes that strongly gained expression in DNMT–TKO (FDR ≤ 0.01 and log2FC > 3) are depicted in dark green (n = 434) and germline-specific genes Dazl and Asz1 in red. c,d, Average promoter methylation levels (c) and gene expression levels (d) in WT neurons of all expressed genes (total, n = 15,452) or of all genes differentially expressed in MBD–QKO and DNMT–TKO neurons (from b) or those shared between both conditions (shared: down n = 111, up n = 27). Black lines, median; boxes, first and third quartile; whiskers, maximum and minimum values of distribution after removal of outliers (Methods). e, Single-locus example of a germline-specific gene (Asz1) with a methylated promoter that is derepressed in the absence of DNA methylation (meth.) but not in the absence of MBD proteins. RPKM, reads per kilobase million.

Absence of the tested MBD proteins has no detectable effect on genomic patterns of CpG methylation (Extended Data Fig. 2c). Neurons derived from both genotypes show increased CA methylation65,66,67 but at levels lower than previously observed in adult mouse brain (Extended Data Fig. 2d), probably reflecting the limited culturing time66.

Thus, neuronal cells can be generated in vitro in the absence of DNA methylation or MBD proteins using a rapid neurogenesis paradigm, allowing us to study the effects on genome regulation in a differentiated and postmitotic cell state. While the absence of MBD proteins did not affect the long-term viability of the derived neurons, DNMT–TKO neurons showed decreased viability at around 10 days following induction (Extended Data Fig. 2e–g).

The transcriptome of MBD–QKO neurons is remarkably similar to that of WT neurons, with minor but reproducible changes (168 genes down, 58 genes up) (Fig. 2b and Extended Data Fig. 2h,i). Affected genes tend to have unmethylated promoters (Fig. 2c), are already active in WT neurons (Fig. 2d) and are enriched in different pathways of tissue development (Extended Data Fig. 2j), implying that loss of MBD-mediated indirect repression at methylated regions is not the primary driver of these changes.

The transcriptome of DNMT–TKO neurons resembles that of WT neurons (Extended Data Fig. 2h), indicating that they acquire a neuronal identity in line with their morphology. However, they are more dissimilar to WT than MBD–QKO neurons, displaying a roughly tenfold larger set of differentially expressed genes (Fig. 2b). Genes upregulated in DNMT–TKO neurons tend to be under the control of promoters that are methylated (Fig. 2c), inactive in WT (Fig. 2d) and are again enriched for gamete-specific genes (Extended Data Fig. 2j). Prominent examples include Dazl and Asz1, which are known to rely on promoter methylation for repression in somatic cells46,68. These genes are not upregulated in the absence of MBD proteins (Fig. 2b,e), arguing against a prominent role of the tested MBD proteins in maintenance or establishment of repression of genes with methylated promoters that become activated in the absence of DNA methylation in neurons.

Limited derepression is conserved in human MBD–QKO cells

Before further exploring the molecular consequences of the absence of MBD proteins in neurons, we asked whether the MBD–QKO phenotype is conserved in human cells. To do so we generated a MBD–QKO from human HEK293 cells (Extended Data Fig. 3a,b). These are viable and, again, show only a limited number of genes to be misregulated (down, 309; up, 234; Extended Data Fig. 3c,d), similar to the murine system. To generate hypomethylated cells we treated WT HEK293 cells with the DNMT1 inhibitor 5-Aza-2′-deoxycytidine (Aza), which reduced global methylation from 70 to 20% (ref. 69). Again more genes change expression than in the MBD–QKO (Extended Data Fig. 3d); upregulated genes tend to have a methylated promoter, are transcriptionally inactive in the absence of the compound and are again enriched for germline genes, including DAZL (Extended Data Fig. 3d–f). In contrast, genes differentially expressed in MBD–QKO cells are already transcriptionally active and show low promoter methylation in WT (Extended Data Fig. 3e). Genome-wide methylation levels of MBD–QKO cells are comparable to those of WT HEK293 cells (Extended Data Fig. 3g) which, unlike the murine system, have virtually no CpA methylation (Extended Data Fig. 3h). This suggests that, in this human cell line, DNA methylation-mediated repression can occur only in the context of CpG yet is independent of 5mC-binding MBD proteins.

Accessibility changes following loss of DNMT, but not MBD, proteins

Having observed the similar phenotype in human cells, we proceeded to study changes in chromatin in differentiated mouse cells. The neurons showed few accessibility changes in the absence of MBD proteins (Fig. 3a and Extended Data Fig. 4a,b), while DNMT–TKO neurons showed several thousand differentially accessible regions (Fig. 3a and Extended Data Fig. 4b). The majority of sites gain accessibility, tend to locate distally from transcription start sites, are shorter than shared sites and are methylated (Extended Data Fig. 4c–e). Increased accessibility correlates with local transcriptional upregulation (Extended Data Fig. 4f). As in ES cells, known methylation-sensitive NRF1 and BANP sites gain accessibility only in the absence of DNA methylation, but not MBD, proteins (Fig. 3b). We conclude that the absence of DNA methylation, but not MBD proteins, leads to increased accessibility of regulatory regions and upregulation of neighboring genes in neurons, suggesting a contribution of methylation-sensitive TFs.

Fig. 3: Loss of DNA methylation, but not the tested MBD proteins, reshapes the chromatin accessibility landscape revealing methylation-sensitive TFs in neurons.
Fig. 3: Loss of DNA methylation, but not the tested MBD proteins, reshapes the chromatin accessibility landscape revealing methylation-sensitive TFs in neurons.The alternative text for this image may have been generated using AI.
Full size image

a, Differentially accessible peak regions (FDR < 0.01 and |log2FC| > 1) identified by ATAC–seq in mutant neurons compared with WT. Replicates from both MBD–QKO clones were combined. b, Accessibility changes at motifs of NRF1 (n = 792) and BANP (n = 26) that gained accessibility in DNMT–TKO neurons. For each condition at least two replicates were combined. c, Unbiased clustering of the top 15 motifs enriched in DNMT–TKO-specific ATAC–seq peaks by weight matrix similarity (FDR < 0.01 and |log2FC| > 1). d, Single-locus examples of ONECUT1 binding (gray tracks) in WT and DNMT–TKO neurons at canonical motifs (black) or CpG-containing motif variants (orange). Top track indicates CpG methylation, ATAC–seq tracks in blue. Read counts in running windows of 51 nt (ChIP–seq) or 11 nt (ATAC–seq), replicate data combined. e, Motifs identified in the top 500 WT-, DNMT–TKO- or DNMT–TKO-specific (from Extended Data Fig. 6b) ONECUT1 ChIP–seq peak regions compared with a human ONECUT1 motif identified in vitro by HT-SELEX107. f, ONECUT1 peak regions with canonical or CpG-containing motifs in WT-, DNMT–TKO (TKO)- or TKO-specific peak regions.

Identification of candidate methylation-sensitive TFs

The top DNMT–TKO-specific ATAC–seq peaks in neurons are enriched for 49 known TF motifs (Extended Data Fig. 5a), several with high sequence similarity (Extended Data Fig. 5b). Among those motifs strongly enriched is the one for the methylation-sensitive TF NRF1 (Fig. 3c and Extended Data Fig. 5a) that is ubiquitously expressed30. Other prominent motifs are specific to neurons, such as ONECUT1 (also known as HNF6) (Fig. 3c and Extended Data Fig. 5a). Of note, several enriched motifs do not contain a CpG, indicating that they potentially respond to non-CpG methylation despite its low prevalence in our experimental system (Extended Data Fig. 2d). More probably, however, these might not be directly linked to DNA methylation, highlighting the general need for further experimental validation.

ONECUT1 is a methylation-sensitive TF

We first tested ONECUT1, a key regulator of the nervous system, liver and pancreas70. Its canonical motif has no CpG yet a variant motif does71,72, which is enriched in DNMT–TKO-specific open regions (Extended Data Fig. 5c). Indeed, ONECUT1 binds to ~700 additional sites in DNMT–TKO neurons while only ~100 display slightly reduced binding (Fig. 3d and Extended Data Fig. 6a,b). Newly bound sites reside distally to transcription start sites (Extended Data Fig. 6c), gain accessibility (Fig. 3d and Extended Data Fig. 6d) and are enriched for the variant motif (Fig. 3e,f and Extended Data Fig. 6e). DNMT–TKO-specific peaks that contain the CpG-variant are methylated in WT neurons and show the largest increase in binding at motifs with the highest methylation (Extended Data Fig. 6f). Methylation levels of CpGs in the vicinity of the canonical motif do not correlate with differential binding in DNMT–TKO (Extended Data Fig. 6g), leading us to conclude that ONECUT1 is methylation sensitive in vivo but only at the CpG-containing motif variant. Thus new tissue-specific TFs can be identified by generation of postmitotic cells lacking DNA methylation.

DNA methylation-dependent derepression of repeats in neurons

When asking whether repeat repression is affected in neurons, we observed no significant increase in the absence of MBD proteins (Fig. 4a and Extended Data Fig. 7a). Removal of DNA methylation dramatically increased repeat-derived RNA, in particular from IAP elements, in DNMT–TKO neurons (Fig. 4a,b and Extended Data Fig. 7b). Due to this 200-fold induction (Fig. 4a), IAPs comprise one-third of repeat-derived RNA, which impacts the expression of neighboring genes68,73 (Fig. 4c) and is also evident at individual IAP retrotransposons (Extended Data Fig. 7c,d). A comparable derepression has previously been observed in Dnmt1−/− ES cells conditionally depleted of SETDB1 (ref. 74), in murine Dnmt1−/− embryos5,68 and in conditional UHRF1-depleted postnatal mouse cortex61 (Fig. 4b), suggesting that differentiated neurons in culture recapitulate the upregulation observed in vivo.

Fig. 4: Repeats are derepressed in neurons in the absence of DNA methylation but not in the absence of the tested MBD proteins.
Fig. 4: Repeats are derepressed in neurons in the absence of DNA methylation but not in the absence of the tested MBD proteins.The alternative text for this image may have been generated using AI.
Full size image

a, Percentage of reads (all repeats plus genes) mapping to all repeats or IAPs. Numbers of replicates (circles), WT (n = 2), MBD–QKO (n = 4, both clones combined), DNMT–TKO (n = 2). Multimapping reads counted in repeats (Methods). Bar plot shows the median of replicates. b, Expression change of repeat subfamilies in mutants over WT cell lines or tissue. Rows depict repeat subfamilies differentially expressed in MBD–QKO or DNMT–TKO neurons (RNA-seq, FDR ≤ 0.01 and |log2FC| ≥ 3, with a minimum of ten repeat instances; Extended Data Fig. 7a,b). Left, Ngn2 mouse ES cells (ES) or derived neurons (N). Right, public RNA expression data: ES_DNMT1_SETDB1, conditional deletion of SETDB1 and DNMT1 in ES cells74; Cortex_UHRF1, conditional deletion of Uhrf1 in cerebral cortex of postnatal day 5 mice61; E8.5_DNMT1, Dnmt1 mutant embryos at day 8.5 (ref. 68). Multimapping RNA-seq reads were considered (Methods). c, Representative gene (Gramd1c) activated in DNMT–TKO neurons by a transcribed IAP element (red arrowhead). Red line indicates splice junctions, illustrating that RNA reads derived from the IAP repeat overlap with the downstream exon. Chr16: 43970350−44073345.

CRE is critical for IAPLTR1/1a activity

Intracisternal A-type particle elements are characterized by 5′ and 3′ long terminal repeats (LTRs) that control the expression of the viral genes54 (Fig. 5a). For correct assignment of transcriptional activity to the corresponding 5′ LTR promoter region we curated the existing RepeatMasker annotation (Extended Data Fig. 8a and Methods). This revealed that almost all copies of the evolutionarily youngest types (IAPLTR1/1a) are strongly activated (Extended Data Fig. 8b,c) while divergent LTR sequences show weaker responses (Extended Data Fig. 8c).

Fig. 5: CRE is a feature of upregulated IAPLTR1/1a and important for repeat activity.
Fig. 5: CRE is a feature of upregulated IAPLTR1/1a and important for repeat activity.The alternative text for this image may have been generated using AI.
Full size image

a, Scheme of IAP element and expression of IAPLTR1 or IAPLTR1a elements in DNMT–TKO neurons grouped by the presence of a perfect match with the CRE motif (TGACGTCA) in the 5' LTR. n, Number of elements. Only uniquely mapping reads were considered. Statistical significance was calculated using a two-sided t-test, and P values are shown. Boxplots as in Fig. 2d. b, Scheme of single-copy targeted integration of different IAPLTR1a and PGK reporter constructs by recombinase-mediated cassette exchange. Bar plot shows luciferase reporter activity in neurons, indicating that the IAPLTR1a reporter is silent in WT but active in DNMT–TKO neurons. Absence of CRE reduces reporter activity by 50%. WT_PGK (n = 5), WT_LTR (n = 3), WT_LTR_∆CRE (n = 3), DNMT–TKO_PGK (n = 3), DNM–TKO_LTR (n = 4), DNMT–TKO_LTR_∆CRE (n = 4); n, number of biological replicates. Error bars indicate s.e.m. Statistical significance was calculated using a two-sided Wilcoxon test.

To identify TF motifs associated with upregulation, we asked which motifs distinguish strongly from lowly upregulated IAPLTR1/1a in DNMT–TKO neurons. This revealed the cyclic AMP response element (CRE) as the top candidate (Fig. 5a, Extended Data Fig. 8d and Methods). To test the actual contribution of this motif, we generated reporter constructs driven by IAPLTR1a with or without the CRE upstream of a luciferase reporter gene (Fig. 5b) and placed them as single-copy integrants into both WT and DNMT–TKO ES cells at a defined genomic site75. A promoter of the Pgk1 housekeeping gene (PGK) served as a positive control and, indeed, is equally active following insertion, while the IAPLTR is silent and efficiently repressed in WT and only weakly expressed in DNMT–TKO ES cells (Extended Data Fig. 8e). In WT cells this repression is preserved following differentiation into neurons, while in DNMT–TKO neurons the IAPLTR reporter is strongly upregulated, mimicking the activation of endogenous elements (Fig. 5b). Importantly, the CRE motif itself accounts for half of the observed transcriptional activity, suggesting that it is critical for full IAPLTR1/1a activity in the absence of DNA methylation.

CREB1 binds unmethylated CRE in IAP elements

Although multiple TFs of the basic leucine zipper TF family can bind CRE as homo- or heterodimers76, the cyclic AMP (cAMP)-response element-binding protein 1 (CREB1) seemed a likely candidate at IAPLTRs because it preferentially binds CRE as a homodimer in genic and viral promoters and is furthermore ubiquitously expressed77.

Measurement of CREB1 genomic occupancy revealed that binding occurs at CRE or CRE half-sites (Extended Data Fig. 8f–h), which are located almost exclusively at CpG islands of unmethylated promoters of active genes (Extended Data Fig. 8i,j), many associated with general cellular functions (Extended Data Fig. 8k). Only seven sites are bound exclusively in WT while 141 are newly bound in DNMT–TKO neurons (Extended Data Fig. 8l), mainly located distal to promoters (Extended Data Fig. 8i).

CREB1 binding signal is inversely correlated with motif methylation in WT (Extended Data Fig. 8m) and DNMT–TKO-specific binding occurs at sites that are methylated in WT (Fig. 6a,b), arguing that CREB1 is indeed methylation sensitive in vivo, as previously predicted in vitro25,28,78,79,80.

Fig. 6: CREB1 binds in a methylation-sensitive manner to IAPLTR1/1a elements and contributes to repeat activity.
Fig. 6: CREB1 binds in a methylation-sensitive manner to IAPLTR1/1a elements and contributes to repeat activity.The alternative text for this image may have been generated using AI.
Full size image

a, Single-locus example illustrating DNA methylation-sensitive binding of CREB1 (blue tracks, ChIP–seq) in WT and DNMT–TKO (TKO) neurons. CREB1 motifs shown in the motif track. Chromatin accessibility (black tracks, ATAC–seq) for WT, DNMT–TKO and CREB1–KO in DNMT–TKO neurons. Top track indicates CpG methylation (black dots) in WT neurons. Chr7: 41118130−41118764. b, Changes in CREB1 binding between DNMT–TKO and WT neurons grouped according to their motif methylation in WT neurons. n, number of CREB1 sites indicated for each bin. Boxplots as in Fig. 2d. c, Changes in chromatin accessibility (top, ATAC–seq), POL2 binding (middle, ChIP–seq) and CREB1 binding (bottom, ChIP–seq) in WT and DNMT–TKO neurons at IAPLTR1/1a elements gaining expression in the absence of DNA methylation (RNA-seq, FDR < 0.05 and log2FC ≥ 1). Signal is centered at the start site of IAP elements. Orange bars denote average width of the 5' LTR and dashed lines average length of an entire IAP element, including the 5' and 3' LTR regions. Only uniquely mapping reads are considered. Replicates per condition are combined in each composite plot. n, number of elements. d, Genic example (Fsip2l) of CREB1-mediated activation following loss of DNA methylation. CpG methylation and CRE motifs are indicated; CREB1 ChIP–seq, blue tracks; gray bar indicates the promoter region methylated in WT neurons. ChrX: 48838466−48880713. e, ATAC–seq signal or RNA expression levels of IAPLTR1 (n = 746) or 1a (n = 884) elements in WT or DNMT–TKO neurons with (orange) or without (yellow) functional CREB1 gene at elements derepressed in the absence of DNA methylation (FDR < 0.05 and FC ≥ 2). Only reads mapping uniquely to the reference genome were considered. ATAC–seq reads counted in 5' LTRs were summed for each replicate (n = 3). Replicates (n = 2) of RNA-seq reads counted in the IAPLTR1/1a element were combined by condition. Boxplots as in Fig. 2d. Statistical significance calculated using two-sided t-test, and P values are shown.

Next, we asked whether CREB1 binds 5' LTR regions of IAPLTR1/1a elements in the absence of DNA methylation. To benchmark our ability to measure occupancy at repetitive sequences, we first profiled RNA polymerase II (POL2) binding in WT and DNMT–TKO neurons (Extended Data Fig. 9a). This revealed a reproducible increase in POL2 binding at 5' LTR regions of IAPLTR1/1a elements upregulated in the absence of DNA methylation (Fig. 5c and Extended Data Fig. 9b,c) and coincides with increased accessibility (Fig. 5c and Extended Data Fig. 9b,c). As expected, we did not detect POL2 binding in WT neurons at the same LTRs (Fig. 5c and Extended Data Fig. 9b,c). Quantification of CREB1 occupancy by chromatin immunoprecipitation sequencing (ChIP–seq) revealed selective and reproducible binding in the absence of DNA methylation at IAPLTR1/1a repeats (Fig. 5c and Extended Data Fig. 9b,c), indicating CREB1 binding in a methylation-sensitive manner.

CREB1 deletion results in reduced activity at genes and IAPs

To directly test CREB1 contribution to repeat activity we deleted Creb1 in DNMT–TKO ES cells using CRISPR (Extended Data Fig. 10a,b) and generated neurons transcriptionally resembling the parent line (Extended Data Fig. 10c). Among genes bound by CREB1, the majority of responding genes were down- (n = 51) rather than upregulated (n = 9) (Extended Data Fig. 10d), in line with it being an activator77. Downregulated genes included Fsip2l (Fig. 5d), which is upregulated and bound by CREB1 at its promoter only following the removal of DNA methylation. Upregulation was reversed when Creb1 was deleted (Fig. 5d and Extended Data Fig. 10d), providing a genic example of CREB1-mediated activation following loss of DNA methylation.

Sites that are newly bound by CREB1 and that increase in accessibility following removal of DNA methylation decrease in accessibility following Creb1 deletion (Fig. 5a and Extended Data Fig. 10e,f). Thus CREB1 responds to genome demethylation by binding to new sites, leading to increased chromatin accessibility and transcriptional activation. Decreased accessibility is similarly evident at 5' LTRs of IAPLTR1/1a following loss of CREB1 in DNMT–TKO, accompanied by reduced transcriptional activity (Fig. 5e).

Taken together, the findings show that motif methylation of CRE abrogates binding of CREB1 to promoters of genes such as Fsip2l and IAP repeats. In the absence of DNA methylation, CREB1 substantially contributes to IAP upregulation. This provides a case of direct repeat repression via blockage of TF binding by motif methylation.

Discussion

Here we asked to what extent repression of regulatory regions by DNA methylation depends on direct inhibition of binding of TFs versus indirect inhibition via sequence-independent recruitment of MBD proteins. Both stable and acute deletion of four MBD proteins with established 5mC binding in murine ES cells, differentiated neurons and a human cell line caused limited transcriptional response that appears not to be linked to methylation of regulatory sequences. This challenges a scenario where indirect repression mediated by the tested MBD proteins is essential for repression of CpG-dense methylated regulatory regions. Conversely, removal of DNA methylation results in upregulation of a group of genes controlled by otherwise methylated CpG island promoters in the tested cell states, as well as rampant transcription of endogenous retroviruses in neurons. In line with this upregulation being caused by methylation-sensitive TFs, we identify and validate new factors that are blocked from binding their motifs by DNA methylation and that activate genes and retroviruses in its absence. These results suggest that direct impediment of TF binding is a prevailing mechanism of methylation-mediated repression of regulatory regions in both human and mouse.

Importantly, these observations are compatible with other proposed functions of MBD proteins—in particular MeCP2—in gene regulation, such as impacting transcriptional elongation by methyl-CA binding65,81,82, alternative splicing83,84, microRNA processing85 or protecting CA repeats from nucleosome invasion86. While MBD proteins can have a repressive function—in particular when recruited to certain sites or at transfected reporter plasmids17,18,19,87,88,89,90—our experiments argue against functional redundancy between the four tested MBD proteins as a reason for the absence of more severe transcriptional phenotypes, as hypothesized in previous loss-of-function studies of selected MBD proteins19,36. It remains conceivable that the MBD proteins we tested participate in stabilizing aspects of transcriptional repression91,92 in a way that is redundant in the cell systems we employed, yet relevant in vivo in different contexts. It remains possible that other, currently uncharacterized, sequence-agnostic methyl-CpG binding proteins exist and are able to mediate indirect repression. TAM domain proteins7,8 seem unlikely candidates because they do not bind methylated DNA10,11 and show only weak homology in the MBD domain. The plant-specific MBD5 and MBD6 are readers of methylated DNA and mediate transcriptional repression at a subset of genes and repeats93 via the recruitment of chaperone activity, yet are unrelated and nonhomologous.

In contrast to the mild phenotype of MBD deletions, we did observe that methylation of CpGs within specific motifs interferes with TF binding. Removal of DNA methylation increases chromatin accessibility, TF binding and transcription, both genome wide and in reporter assays. In addition to factors shown to be methylation sensitive in cells at their canonical motif (NRF1, BANP, CREB1), we report ONECUT1 to be methylation sensitive at only one specific CpG-containing motif variant, but not the CpG-free canonical motif. This agrees with previous in vitro observations in a SELEX-based screen28 and defines the actual contributions of these variants to the ONECUT1 binding landscape in the cellular context.

Structural data of CREB1 (ref. 94) and ONECUT1 (ref. 95) in complexes with unmethylated DNA show that both proteins interact with the major groove where the methyl group of the cytosine is positioned22, causing groove widening96. CREB1 does not bind if the central cytosine is replaced by a thymidine, which structurally resembles methyl-cytosine97. Of note, methylation can also change the DNA shape at neighboring base pairs, thus affecting binding for motifs that do not contain central CpGs29,96. It is an intriguing possibility that methylation-restricted binding at select TF motifs can function to mediate TF hierarchies30 or specifically regulate different motif variants in a cell type-specific manner, thus expanding the gene regulatory toolkit at a subset of sites. Although comparison with ancestral genomes reveals ongoing depletion of CpG-containing TF motifs98, a large fraction of promoters is rich in CpGs and these are indeed efficiently silenced by DNA methylation. We speculate that this is due to a combination of inhibition of methylation-sensitive TFs with complex motifs, but also to CXXC-domain-containing proteins that bind unmethylated CG dinucleotides and have been linked to activation99.

It is unclear whether aberrant gene expression43 or repeat activation44 causes cellular death in differentiated cells in the absence of DNA methylation96. While both processes have been linked to mitotic catastrophe in dividing cells38, our methylation-devoid neurons are postmitotic for several days before cell death, suggesting alternative scenarios in nondividing cells. Rampant repeat activation is the key feature that distinguishes these neurons, which potentially induces cell death by sheer transcriptional load, activation of the interferon pathway100 or insertion of active endogenous retroviruses (ERVs) into genes or promoter regions, thereby producing mutations or high levels of chimeric transcripts101.

Release of direct inhibition of methylation-sensitive TFs such as CREB1 contributes to repeat activation in differentiated cells. DNA methylation-independent pathways repress repeats in vertebrates during periods of global low methylation that occur in the germline as part of epigenome resetting41. Transcription and transposition in the germline is critical for genomic expansion of ERVs and thus for their evolutionary ‘success’102, whereas their activity in somatic cells would only reduce the fitness of the host. Transcriptional control by methylation-sensitive TFs could benefit the expansion of ERV by being compatible with expression in hypomethylated states in the germline while ensuring repression in somatic cells. It enables exploitation of an ubiquitously expressed activator such as CREB1 and might contribute to the fact that IAP elements are among the most active TEs in the mouse genome103.

The larger family of ERVK elements to which IAP elements belong includes human counterparts, the HERVK LTR retrotransposons, of which HERVK(HML-2) appears to replicate in the human population102. Interestingly, several human LTR retrotransposons contain CRE motifs and CREB or ATF/AP-1 factors have been implicated in driving the expression of human ERVs, human T cell leukemia virus type 1 and human immunodeficiency virus104,105,106. CRE methylation has furthermore been linked to promoter silencing of the Epstein–Barr virus genome79.

Taken together, our findings provide insights into transcriptional repression through DNA methylation of CpG-rich regulatory regions that drive genes and repeats, and favor a model of direct inhibition of TF binding as the prevailing molecular mechanism. This finding is in line with a model where genome-wide DNA methylation evolved as an efficient means to repress repetitive elements in somatic cells and was subsequently co-opted to other regulatory regions, resulting in an epigenetic marking system that remains essential at the cellular level in somatic cells.

Methods

Cell culture

HA36 mouse ES cells (mixed 129-C57Bl/6 strain, no commercial source available) were maintained in DMEM (Invitrogen), supplemented with 15% fetal calf serum (Invitrogen), 1× GlutaMax (Thermo Scientific), 1× nonessential amino acids (Gibco), 0.001% beta-mercaptoethanol (Sigma) and leukemia inhibitory factor (LIF; produced in house). All experiments were performed with cells grown for several passages on plates coated with 0.2% gelatin (Sigma).

HEK293 cells (obtained from ATCC, no. CRL-1573) were cultured in DMEM (Invitrogen), supplemented with 10% fetal calf serum (Invitrogen) and 2 mM L-Glutamine (Thermo Scientific).

Cell line generation

Ngn2 cassette integration

Mouse ES cells (HA36, 4 × 106 cells) were electroporated (mouse ES cell Nucleofector Kit, no. VPH-1001, Amaxa biosystems) in 100-µl volumes containing 95 µl of Nucleofector solution, a Piggybac plasmid containing a cassette with doxycycline-inducible Ngn2 (3.8 µg) and Dual helper construct (0.7 µg). Electroporated cells were cultivated in 2i/LIF maintenance medium (G-MEM BHK-21 medium containing 10% KnockOut serum, 1 mM sodium pyruvate, 1× nonessential amino acids, 0.1 mM B-mercaptoethanol, LIF, 1 µM PD0325901 and 3 µM CHIR99021 inhibitors) on gelatin-coated dishes. After 2 days, G418 (300 µg ml–1) was added to the cells for 2 weeks to select those that integrated the Piggybac cassette. Individual clones were then tested for Ngn2 expression and neuronal differentiation.

MBD–TKO and MBD–QKO mouse ES cells

MBD double-knockout ES cells (MBD–DKO) were generated by cotransfecting (Lipofectamine 3000, Thermo Fisher Scientific) HA36 cells containing an integrated Ngn2 cassette with two vectors, each encoding CRISPR–Cas9 and a gRNA against either Mbd2 or Mecp2. Two distinct gRNAs were used to target each gene, to generate two biological replicates. Puromycin-resistant clones were genotyped for frameshift mutations by PCR, expanded and MBD–DKO clones validated by immunoblot. To generate MBD–QKO, the same process was repeated using MBD–DKO cells with the addition of gRNAs targeting Mbd1 and Mbd4. The MBD–TKO cell line lacking Mbd1/Mbd2/Mecp2 was generated by deletion of Mbd1 from MBD–DKO with the second set of gRNAs. Details of all gRNAs used for generation of mouse ES cells can be found in Supplementary Table 1.

MBD–QKO HEK293 cells

HEK293 cells were cotransfected with plasmids encoding either CRISPR–Cas9 or the gRNA sequence with a red fluorescence protein. In a first step, MBD2 and MECP2 were targeted simultaneously and thus RFP+ HEK293 cells were sorted (BD FACS Aria III) into 96 wells and genotyped. Double-knockout clones carrying a frameshift mutation were expanded and validated by allele sequencing and immunoblot. In a second and third step, this process was repeated twice targeting MBD1 and MBD4 successively to delete all four MBD proteins. gRNAs used for HEK293 can be found in Supplementary Table 2.

DNMT–TKO mouse ES cells

The three DNMTs—Dnmt1, Dnmt3a and Dnmt3b—were deleted in HA36 ES cells with the integrated Ngn2 cassette by CRISPR–Cas9 gene editing as previously described30, to generate a DNMT–TKO line without DNA methylation. Dnmt genes of all six alleles were sequenced and residual methylation levels measured by Zymo Research, using high-pressure liquid chromatography coupled to mass spectrometry to confirm successful targeting.

CREB1–KO in DNMT–TKO mouse ES cells

Mouse HA36 DNMT–TKO ES cells generated as described above were cotransfected (Lipofectamine 3000, Thermo Fisher Scientific) with one vector encoding CRISPR–Cas9 and a gRNA (TAACTGATTCCCAAAAACGA) against Creb1, in addition to a puromycin selection marker. Puromycin-resistant clones were genotyped for frameshift mutation by PCR, expanded and validated by immunoblot.

All generated cell lines are available upon request.

Antibodies

Antibodies used in this study for immunoblot and ChIP–seq experiments are listed in Supplementary Table 3 (mouse) and Supplementary Table 4 (human).

siRNA-mediated knockdown and RNA-seq

For knockdown of Setdb1, 50,000 ES cells per well were seeded in a six-well plate and simultaneously transfected with either 7.5 µl of 20 µM Setdb1 siRNA (Dharmacon, no. M-040815-01-0005) or Allstars negative control from GeneSolution siRNA (Qiagen, no. 1027281) using Lipofectamine RNAiMAX (Invitrogen, no. 13778-075). Medium was exchanged after 24 h and transfection repeated after 48 h. Duplicates for each condition were harvested after 72 h, RNA isolated with Direct-zol RNA Microprep (Zymo research, no. R2061) and converted to complementary DNA using the PrimeScript RT reagent Kit (Takara, no. RR047A). Expression levels of genes or repeats were measured with quantitative PCR primers against Gapdh108, Setdb1 (ref. 108) or IAP-gag74. For knockdown of Mbd4, 200,000 ES cells per well were seeded in a six-well plate and simultaneously transfected with 7.5 µl of Mbd4 siRNA (20 µM) from GeneSolution siRNA (Qiagen, no. 1027416). After 24 h. cells were harvested for immunoblot or RNA-seq.

5-Aza treatment of HEK293 cells

Wild-type or MBD–QKO HEK293 cells (150,000 seeded the day before in a well of a six-well plate) were treated with either 1 μM 5-Aza-2′-deoxycytidine (no. A3656-10MG, Sigma) or DMSO in triplicate. The next day, the medium was replaced with fresh Aza or DMSO. After 72 h cells were harvested for RNA isolation.

Neuronal differentiation

For HA36 cells containing the pTRE-Ngn2 construct, differentiation was carried out by inducing expression of NGN2 with doxycycline as previously described63, with the following modifications. Cells were plated on poly-d-lysine/laminin-coated plates and treated with DMEM/F12 and Glutamax (LifeTech, no. 31331-028) containing 1× B27 without vitamin A (LifeTech, no. 12587-010), 1× N2 supplement (LifeTech, no. 17502-048), 10 ng ml–1 human epidermal growth factor (LifeTech, no. PHG0315), 10 ng ml–1 human fibroblast growth factor (LifeTech, no. CTP0261) and 1 μg ml–1 doxycycline (Sigma, no. D989) for 3 days with no medium change. At day 3 after doxycycline induction, medium was changed to Neurobasal-Medium (LifeTech, no. 21103-049) supplemented with 1× B27 and Vitamin A (LifeTech, no. 17504-044), 1× N2 (LifeTech, no. 17502-048), 10 ng ml–1 brain-derived neurotrophic factor (PeproTech, no. 450-02), 10 ng ml–1 glial cell line-derived neurotrophic factor (PeproTech, no. 450-10) and 10 ng ml–1 NT-3 (PeproTech, no. 450-03). Every other day, half of the medium was replaced with fresh. RNA-seq, ChIP–seq and ATAC–seq were performed 8 days after doxycycline induction.

Quantification of cell viability

A mix of nuclear and cell death markers (1 µl of Hoechst, 8 µl of propidium iodide and 10 µl of AnnexinV in 125 µl of AnnexinV binding buffer (Thermo Fisher, no. V13242)) were added to neuronal cell culture in six-well plates at days 8 and 10. After 15 min of incubation at 37 °C, images were acquired with a ZOE Fluorescent Cell imager (Bio-Rad, no. 145-0031) and analyzed using ImageJ109. In brief, nuclei were segmented based on Hoechst signal and the background-subtracted AnnexinV-PI signal was measured in each segmented cell. Between the two cell populations separated based on viability markers, cells without AnnexinV-PI enrichment were counted as healthy.

Recombinase-mediated cassette exchange

For targeted insertion, the IAPLTR1a_Mm consensus sequence (downloaded from repbase110) or Pgk1 promoter region (chrX:106186728-106187231, GRCm38/mm10 genome) was cloned into a plasmid containing a multiple cloning site flanked by two inverted L1 Lox sites. Recombinase-mediated cassette exchange was performed in HA36 mouse ES cells as previously described75.

Luciferase assay

Luciferase activity of ES cells or derived neurons (8 days after induction) carrying a IAPLTR1a or PGK luciferase reporter was measured with the Luciferase Assay System (Promega, no. E1500) according to the manufacturer’s instructions. Normalization was carried out by protein concentration of lysed ES cells or neurons in 1× lysis buffer with Protein Assay (Bio-Rad, no. 500006). Luminescence was measured using a luminometer (Berthold Technologies, Centro XS3 LB 960).

RNA-seq

RNA was isolated from pellets of either (1) ES or HEK293 cells with the RNeasy mini kit (Qiagen, no. 74104) using on-column DNA digestion or (2) neurons (8 days after doxycycline induction) with Direct-zol RNA Microprep (Zymo research, no. R2061) with on-column DNA digestion. Sequencing libraries were prepared from purified RNA for a minimum of two biological replicates per condition using TruSeq Stranded Total RNA Library Prep Gold (Illumina, no. 20020599). ES cell libraries were single-end sequenced on a HiSeq 2500 platform with 50 cycles. lllumina RTA 1.18.64 (HiSeq 2500) and bcl2fastq2 v.2.17 were used for base calling and demultiplexing.

HEK293 or neuron libraries were sequenced on an Illumina NextSeq platform with paired-end reads of 2 × 38 or 2 × 75 base pairs (bp), respectively. Illumina RTA 2.4.1 (NextSeq 500) and bcl2fastq2 v.2.17 were used for base calling and demultiplexing.

RNA of Mbd4 or control siRNA-treated MBD–TKO ES cells (in triplicate) was isolated using Direct-zol RNA Microprep (Zymo research, no. R2061). Sequencing libraries were prepared using TruSeq Stranded Total RNA Library Prep Gold (Illumina, no. 20020599) and paired-end sequenced on a NovaSeq 6000 platform with 2 × 56 cycles. lllumina RTA 3.4.5 (NovaSeq 6000) and bcl2fastq2 v.2.20 were used for base calling and demultiplexing.

ChIP–seq

ChIP was carried out as previously described111 with the following modifications. (1) Chromatin was sonicated for 20 cycles of 30 s using a Diagenode Bioruptor Pico, with 30-s breaks between cycles; (2) Dynabeads protein A (Invitrogen, no. 10008D) was used; and (3) DNA was purified using AMPure XP beads. Immunoprecipitated and input DNA were submitted for library preparation (NEBNext Ultra DNA Library Prep Kit, Illumina, no. E7370). In the library preparation protocol, input samples (200 ng) were amplified using six PCR cycles and immunoprecipitation samples using 12 cycles. Libraries were paired-end sequenced for 150 cycles (2 × 75 bp) on the Illumina NextSeq 500 platform. Illumina RTA 2.4.1 (NextSeq 500) and bcl2fastq2 v.2.17 were used for base calling and demultiplexing.

ATAC–seq

ATAC–seq was performed according to the protocol previously described for Omni-ATAC112 for both ES and neuronal cells. Briefly, 50,000 cells were washed with cold PBS and resuspended in lysis buffer to extract nuclei, which were then cold-centrifuged at 500g for 10 min. Nuclear pellets were incubated with transposition reaction buffer for 30 min at 37 °C. DNA was purified using the PCR Purification Kit (Qiagen). Eluted transposed DNA was amplified with 11–12 cycles of PCR using Q5 High-Fidelity Polymerase (NEB). Libraries were sequenced paired-end with 76 cycles (2 × 38 bp) on the Illumina NextSeq platform. All ATAC–seq experiments were performed in at least two independent biological replicates per condition. Illumina RTA 2.4.1 (NextSeq 500) and bcl2fastq2 v.2.17 were used for base calling and demultiplexing.

Whole-genome bisulfite sequencing

Nuclei of day 8 neurons were isolated as described by Grand et al.47 and sorted by flow cytometry (BD FACS Aria III). Genomic DNA was isolated (QIAamp DNA Micro Kit, no. 56304) from mouse ES cells or sorted neuronal nuclei and 1 µg was fragmented (Covaris S220) to an average size of ~300 bp. Libraries were prepared according to the manufacturer’s instructions. Adapter ligation was performed using the NEBNext Ultra II DNA Library Prep Kit (no. E7645L) with methylated adapters (NEBNext, no. E7535S), bisulfite treated (EZ DNA Methylation-Gold Kit; Zymo, no. D5006) and indexed (NEBNext Multiplex Oligos for Illumina) using 11 cycles in the PCR reaction (KAPA HiFi HotStart Uracil+ ReadyMix; Roche, no. 07959052001). Libraries were paired-end sequenced on a NovaSeq 6000 platform with 2 × 100 cycles. lllumina RTA 3.4.5 (NovaSeq 6000) and bcl2fastq2 v.2.20 were used for base calling and demultiplexing, with one sample per genotype. WT neuron experiments were performed in duplicate (individual differentiation experiments) and sequenced to half the coverage compared with the other samples.

HEK293 genomic DNA was isolated with a QIAamp DNA mini kit (Qiagen, no. 51306) and fragmented with Covaris S220, with 500 ng of fragmented DNA then used for library preparation (NEBNext Ultra DNA Library Prep Kit; NEB, no. E7370) with methylated adapters (NEBNext; NEB, no. E7535S) and bisulfite treated with EZ DNA methylation-lightning Kit (Zymo Research, no. D5046). Final PCR amplification was performed using a KAPA HiFi HotStart Uracil+ ReadyMix PCR Kit (Roche, no. 07959052001) with 12 cycles of amplification. One sample was prepared per genotype.

The resulting libraries were sequenced on an Illumina NextSeq platform (75 cycles, single-end). Illumina RTA 2.4.1 and bcl2fastq2 v.2.17 were used for base calling and demultiplexing.

Statistics and reproducibility

No statistical method was used to predetermine sample size. No data were excluded from the analyses. The experiments were not randomized and the investigators were not blinded to allocation during experiments and outcome assessment. All statistical tests and number of observations are stated in figure panels or legends. Resulting P values are two-sided, with exceptions stated in individual figure legends.

In all boxplots, black lines correspond to median, boxes to first and third quartiles and whiskers to 1.5 times the interquartile range (IQR). Notches, if indicated, extend to ±1.58 × (IQR/sqrt(n)). Whiskers correspond to the maximum and minimum values of the distribution after removal of outliers, in which outliers were defined as >1.5 × IQR away from the box. Pearson correlation coefficients were calculated using the R function cor, with default parameters.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.