Abstract
Scutellaria baicalensis has been one of the most commonly used traditional Chinese medicinal plants in China for more than 2000 years. The three new varieties cultivated could not be distinguished by morphology before flowering. It will hinder the promotion of later varieties. Chloroplast DNA has been widely used in species identification. Moreover, previous studies have shown that complete chloroplast genome sequences have been suggested as super barcodes for identifying plants. Therefore, we sequenced and annotated the complete chloroplast genomes of three cultivated varieties. The chloroplast genomes of SBW, SBR, and SBP were 151,702 bp, 151,799 bp, and 151,876 bp, which contained 85 protein-coding genes, 36 tRNA genes, and 8 rRNA genes. The analysis of the repeat sequences, codon usage, and comparison of chloroplast genomes shared a high degree of conservation. However, the sliding window results show significant differences among the three cultivated varieties in matK-rps16 and petA-psbJ. And we found that the matK-rps16 sequence can be used as a barcode for the identification of three varieties. In addition, the complete chloroplast genome contains more variations and can be used as a super-barcode to identify these three cultivated varieties. Based on the protein-coding genes, the phylogenetic tree demonstrated that SBP was more closely related to SBW, in the three cultivated varieties. Interestingly, we found that S. baicalensis and S. rehderiana are closely related, which provides new ideas for the development of S. baicalensis. The divergence time analysis showed that the three cultivated varieties diverged at about 0.10 Mya. Overall, this study showed that the complete chloroplast genome could be used as a super-barcode to identify three cultivated varieties of S. baicalensis and provide biological information, and it also contributes to bioprospecting.
Similar content being viewed by others
Introduction
Scutellaria baicalensis Georgi (S. baicalensis) is a traditional Chinese medicinal plant that belongs to the family Lamiaceae. As one of the most commonly used Chinese medicinal materials in China, it has been used as medicinal material for more than 2000 years since being first recorded in the Shen-nong-ben-cao-jing (The Classic of Herbal Medicine)1. To date, it has been included in over 90% of TCM formulas for treating colds2. Flavonoids and their glycosides are the main bioactive compounds of S. baicalensis. The main components of root-specific 40 deoxygenated flavonoids are baicalein, baicalin, wogonin, and carboxylase A3,4,5. According to current pharmaceutical investigations, S. baicalensis active compounds exhibit significant pharmacological actions such anti-oxidation, anti-bacterial, anti-viral, anti-tumor, and anti-inflammation6,7,8. And it has been widely used for the treatment of various diseases such as pneumonia, diarrhea, infections, colitis, and hepatitis9,10,11,12,13.
Recently, the Corona Virus Disease 2019 (COVID-19) spread worldwide quickly14. It is recently found that S. baicalensis has significant curative effects on the treatment of COVID-1915,16. It has led to the large-scale cultivation of S. baicalensis in China, and researchers are also actively cultivating new varieties. This study used wild S. baicalensis resources in Dingxi City as raw materials. The single plant optimization method screened varieties with plant agronomic characters, susceptibility, and drug grade indicators. Then we screened three new cultivated varieties of S. baicalensis with high quality and yield through strain identification, strain comparison, multi-point test, and regional production test. But it is not clear which varieties can be widely used. The morphological differences between the three cultivated varieties are mainly due to the difference in flower color (Fig. 1), namely white (SBW), rose (SBR), and purple (SBP). However, it was impossible to distinguish the three cultivated varieties before flowering. In addition, S. baicalensis typically has purple flowers, but a rare white or rose flower phenotype has been cultivated, showing great ornamental potential. Accurate identification of varieties also provides a basis for homozygous breeding.
The chloroplast (cp) is an essential organelle that plays a crucial role in plant photosynthesis and several critical biochemical processes17. Due to its slow mutation rate, abundance within plants, relatively small genome size, and haploid inheritance18. The cp DNA has been widely used in many research fields, such as taxonomic revision, systematic evolution, and species identification19,20. Moreover, previous studies have shown that complete cp genome sequences have been suggested as super barcodes for identification of plants21,22.
The complete cp genomes of three cultivated varieties were sequenced and annotated in this study. To determine the internal differences, we examined the general characteristics and compared the sequence differences. Moreover, we explored the phylogenetic position to decipher the genetic relationship amongst the three cultivated varieties to provide the basis for the variety breeding. The result of this study will provide abundant genetic information on S. baicalensis, and serve as the theoretical basis for expanding its medicinal resources.
Materials and methods
Plant materials
Fresh, healthy leaf tissues of three cultivated varieties of S. baicalensis (SBW, SBR, and SBP) were collected from the Germplasm Resources Nursery of Dingxi Academy of Agricultural Sciences (Dingxi, China, 35°6′38″N, 118°21′48″E) (Fig. 1). The specimens were identified by Professor Zhirong Sun following the taxonomic key and external morphology diagnosis proposed by Flora Reipublicae Popularis Sinieae. The voucher specimens were deposited at the herbal medicine library of the school of Chinese materia medica, Beijing University of Chinese medicine.
DNA extraction and sequencing
The fresh leave of three cultivated varieties was frozen in liquid nitrogen and stored in a − 80 °C refrigerator for DNA extraction. DNA extraction was performed using Plant Genomic DNA Kit (Tiangen Biotech, Beijing) following the manufacturer instructions. Around 20–30 mg of dried tissue or 50–60 mg of frozen tissue was used in each extraction. After DNA isolation, 1 μg of purified DNA was fragmented and used to construct short-insert libraries (insert size 300–500 bp) according to the manufacturer’s instructions (Illumina HiSeq X-Ten) for sequencing.
Cp genome assembly and annotation
The high-quality reads were assembled using GetOrganelle v.4.0 and then annotated by CpGAVAS223. The annotations of tRNA genes were confirmed by using tRNAscan-SE v.2.0324. The Bowtie2 and SAMtools were used to perform mapping the reading to the assembled genome, and evaluate the effectiveness of the assembly results. The cp genomes of SBP, SBR, and SBW were submitted to GenBank at the National Center of Biotechnology Information (NCBI), and the accession numbers were OP837955, OP837956, and OP837957, respectively. Fully annotated plastome circular diagrams were drawn by a website (https://irscope.shinyapps.io/Chloroplot/).
Codon usage
The protein-coding genes were extracted by Phylosuite v.1.2.225. Relative synonymous codon usage (RSCU) and codon usage values were analyzed by CodonW v.1.4.2. Moreover, the RSCU values were shown in a heatmap by TBtools26.
Repeat analysis and comparative analyses
Repetitive sequence analyses were performed using CPGAVAS2 analysis. Tandem repeats were identified using default settings by Tandem Repeats Finder27. The Misa.pl was used to screen the simple sequence repeats (SSRs)28. The scattered repetitive sequences were found by using VMATCH. The REPuter was used to determine the size and location of the oligonucleotide repeats (ORs)29. The complete cp genomes of three cultivated varieties were compared by mVISTA30, and the genome of S. baicalensis (NC027262) was used as the reference sequence for annotation. Sliding window analysis was conducted to assess the nucleotide diversity (Pi) values of the cp genomes by DnaSP v6 (window length = 300 bp, step size = 25 bp). IRscope31 was used to analyze inverted repeated traction and expansion at cp genomes’ junctions.
Identification and validation of barcode for species discrimination
According to the results of DNAsp, we chose the high variation region to distinguish the three cultivated varieties. Primers to discriminate between the three cultivated varieties under study were designed on the variable intergenic regions using Snapgene 6.2.1 (Snapgene from Insightful Science, available at http://www.snapgene.com, last used in 2023). PCR amplifications were performed in a final volume of 20 μL with 10 μL 2 × Taq PCR Master Mix, 0. 5 μM of each primer, 5 μL template DNA, and 4 μL ddH2O following the manufacturer’s instructions (Mei5 Biotechnology, Co., Ltd). All amplifications were carried out in a Pro-Flex PCR system (Applied Biosystems, Waltham, MA, USA) under the following conditions: denaturation at 95 °C for 3 min, followed by 36 cycles of 94 °C for 25 s and 55 °C for 10 s, and 72 °C for 2 min as the final extension following the manufacturer’s instructions (Mei5 Biotechnology, Co., Ltd). PCR amplicons were visualized on 1% agarose gels, purified and then subjected to bidirectional Sanger sequencing on an ABI 3730 XL instrument (Applied Biosystems, USA) using the same set of primers used for PCR amplification with BigDye v3.1 chemistry (Applied Biosystems) following manufacturer’s instructions. All amplifications were repeated twice for each variety.
Phylogenetic analysis and divergence times analysis
Phylogenetic analysis was performed based on 21 complete cp genomes, including the three assembled sequences in our study, 16 cp genomes downloaded from the NCBI (12 Scutellaria, 1 Pogostemon, 1 Ajuga, 1 Lavandula, and 1 Ocimum), and Tulipa gesneriana (NC063831) and Aloe vera (NC035506) as outgroup. A total of 86 shared protein-coding genes were extracted and then concatenated and aligned using MAFFT v7.30732. Subsequently, the alignment was conducted based on Bayesian inference (BI) in MrBayes using the GTR + I + G evolution model33. The parameter was set to run for five million generations and sampled every 1000 generations, with all other settings left at their defaults, and the first 25% of each run was discarded as burn-in. The alignment was also evaluated using bootstrap analysis on 1000 in a maximum likelihood (ML) by RAxML34, with parameters: raxmlHPC-PTHREADS-SSE3 -fa -N 1000 -m GTRGAMMA- x551,314,260 -p 551,314,260 -o Fritillaria_cirrhosa_NC_024728, Fritillaria_thunbergii_NC_034368 -T 20, 1000 replications and best-fit model selection. Besides, Modeltest was used to determine the most appropriate model of DNA sequence evolution for the combined 87-gene dataset. Moreover, MrBayes was run for 5,000,000 generations, sampling, and printing every 500. Two independent MCMC runs using four chains (with the default heating schedule) were conducted per Bayesian analysis. Branch support was calculated from the posterior distribution of Bayesian trees after discarding the first 25% of the trees as burn-in and 1000 ML bootstrap pseudoreplicates.
We used the software MEGA35 for molecular clock analysis on the shared cp protein-coding genes alignment, using fossil information of Arabidopsis thaliana (53–82 million years ago, Mya), Oryza sativa (148–173 Mya), and the family Labiatae (49 Mya)36,37,38. Moreover, another molecular clock tree was constructed based on an ML tree using BEAST39. Phylogenetic inference following MCMC analysis with default settings was performed (20,000,000 generations, Yule speciation tree prior to the substitution rate, the trees sampled every 1000 generations) under a strict clock approach. TRACER software was used to check the acceptability and convergence to the stationary distribution of trees40, while TREEANNOTATOR software was used to generate the maximum clade credibility tree from the obtained trees after setting a burning-in of 10%41. The tree was visualized with FigTree (v. 1.4.4; http://tree.bio.ed.ac.uk/software/figtree/).
Results and discussion
Characteristics of three cultivated varieties
The coverage of three cultivated varieties of cp genomes was even and not zero (Fig. S1). The results indicated that the cp genome splicing results of the three cultivated varieties were correct and there was no heteroplasmy. The size and content of these genomes have been analyzed (Table 1). The cp genome size of SBW (151,702 bp) was the most minor, and SBP (151,876 bp) was the largest. All three cultivars cp genomes of Scutellaria exhibited a typical quadripartite structure (Fig. 2), with two inverse-repeat (IR, including IRa and IRb, 25,261–25,265 bp) regions separated by large single-copy (LSC, 83,878–84,025 bp) and small single-copy (SSC, 17,294–17,330 bp) regions. These cp genomes exhibited identical gene content and type and were generally classified into self-replication, photosynthesis, and other genes (Table 2). A total of 129 genes in these species, including 85 protein-coding genes, 36 tRNA genes, and 8 rRNA genes. The results were identical to the other members of the genus Scutellaria. Compared with most angiosperms, the psbH, rpoA, chIB, chIL, and ycf68 were lost during evolution. The total GC content of three cultivars cp genomes was 38.33% but was unevenly distributed in each region (Table 1). The GC content in IR region (43.61%) was higher than LSC (36.32–36.33%) and SSC (32.61–32.66%). However, the GC content was lower than AT content. These results agree with previous studies of angiosperms, such as the genus of Polygonatum and Epimedium42,43. The circular map of cp genomes was provided for three cultivars in Fig. 2.
Cp genome map of three cultivated varieties. Genes lying outside the circle are transcribed in the clockwise direction, while those insides are transcribed in the counterclockwise direction. The colored bars indicate different functional groups. The darker red area in the inner circle denotes GC content, while the orange corresponds to the AT content of the genome. LSC: large single copy, SSC: small single copy, IRA/B: inverted repeat.
Additionally, the number and types of introns were similar among the cultivars of S. baicalensis, except for SBW, there is no intron in rpl16. Eighteen genes each contained one intron, including rpl2 (× 2), ndhB (× 2), trnE-UUC (× 2), trnA-UGC (× 2) were located in the IR, and the genes (trnK-UUU, rps16, trnS-CGA, atpF, rpoC1, trnL-UAA, petB, petD, and rpl16) were located in the LSC, and the ndhA was the only present in the SSC region. In addition, the ycf3 and clpP comprise two introns (Table S1). According to the statistics of intron length, trnK-UUU gene has the longest intron in the cp genome of the three cultivated varieties, which is also found in Atractylodes44. In addition, the matK gene was located within the intron of the trnK-UUU gene, which putatively codes for a plastid intron maturase45,46.
Codon usage
The cp genome of three cultivated varieties of S. baicalensis contained 64 codons encoding 20 amino acids. The result of the RSCU revealed that 31 codons were used frequently in these cultivars, with the highest frequency of AGA followed by UUA (Fig. 3). Moreover, the codon exhibited a strong bias toward an A or T at the third position. The codons that contain A/T at the 3′ end mostly have RSCU ≥ 1, whereas the codons are having C or G at the 3′ end mostly have RSCU ≤ 1. Amino acid frequency analyses revealed the highest frequency of Leucine and Iso-leucine, whereas Tryptophane was a rare amino acid. In general, we found high similarities in codon usage and amino acid frequency among the three cultivated varieties, and both contain high AT content. Similar results were found in the cp genome of other angiosperms47,48.
Repeat analysis
Our analyses identified SSRs per genome composed of mono- to di- nucleotide repeating units (Fig. 4a). The number and type of SSRs in SBR and SBP were similar, with 25 single nucleotide repeats and 2 dinucleotide repeats. SBW contains only 21 single nucleotide repeats less than SBR and SBP. Moreover, in three cultivated varieties, the main type of mononucleotide repeats was T. Oligonucleotide repeats analyses by REPuter detected two types of repeats: Forward (F) and Palindromic (P). Figure 4b showed that the number of repeats varied in three cultivated varieties. We discovered that 30 repeats in SBW include 14 forward and 16 palindromic, 41 repeats in SBR include 24 forward and 17 palindromic, and 33 repeats in SBP include 16 forward and 17 palindromic. Most of the repeats ranged in size from 30 to 40 bp in three cultivated varieties. This result showed that SBW and SBP were more similar than SBR. We also evaluated the number of repeats about the species' phylogenetic position using the topology in Fig. 8. The results confirmed the random distribution of repeat numbers independent of phylogenetic position.
Comparative cp genomic analysis
The cp genomes of the three cultivated varieties were compared by mVISTA30, and the S. baicalensis (NC027262) was used as the reference sequence for annotation. The Fig. 5 showed that the three cultivated varieties exhibit similar variation sites and degrees of variation. The coding regions (CDS) were more conserved than the intergenic spacers (IGS). The high divergence in IGS were found in rps16-trnQ(UUG), trnQ(UUG)-psbK, psbL-trnS(GCU), trnR(UCU)-atpA, trnT(GGU)-psbD, trnG(GCC)-trnfM(CAU), psaA-ycf3, rps4-trnT(UGU), petA-psbJ, trnF(UGG)-psaJ. Furthermore, some mutations of CDS were found in rps19, rpl16, ycf2. These high variation region sequences could be used to distinguish wild species from cultivated species. Moreover, the result showed that IR regions had lower sequence divergence than LSC and SSC regions.
Comparison of three cultivated varieties cp genomes using S. baicalensis (NC027262) annotation as a reference. The vertical scale indicates the percentage of identity, ranging from 50 to 100%. The horizontal axis shows the coordinates within the cp genome. Genome regions are color-coded as exons, introns, and intergenic spacer (IGS), and the Gray arrows indicate the direction of transcription of each gene. Annotated genes are displayed along the top.
In order to explore the sequence divergence between the three cultivated varieties, nucleotide diversity (Pi) was estimated to indicate the variability of potential plastid regions. The values of Pi ranged from 0 to 0.01 (Fig. 6). Among them, 4427–5018 bp region showed high nucleotide diversity (Pi: 0.0067–0.0089). This region was identified as an IGS in matK-rps16. Besides, another high variable region (Pi: 0.0067) appears at 63,718–64,092 bp, located at petA-psbJ. Therefore, the complete cp genome could be used as a super-barcode to identify the three cultivated varieties.
Inverted repeats contraction and expansion
The inverted repeats contraction and expansion revealed variation at LSC/IRs/SSC junctions. The types of junctions in three cultivated varieties and S. baicalensis (NC027262) were different (Fig. 7). In all species, a truncated copy of the rps19 gene was found at the IRb/LSC junction; the rpl22 gene was found entirely in the LSC region; and the rpl2 gene was found entirely in the IRb region. Another truncated copy of ndhF gene was found at the junction of IRb/SSC in all species, which starts in IRb regions and integrates into the SSC region. Interestingly, compared with the three cultivated varieties, the ndhF gene of S. baicalensis was longer in IRb. Moreover, a truncated copy of ycf1 was found in SSC/IRa junction, which was longer in IRa of S. baicalensis. In three cultivated varieties, trnN was observed to present entirely in the IRa region, and the trnH was completely exists in LSC and only one bp from the junction of IRa/LSC. In comparison, the trnH gene of S. baicalensis was 178 bp from the junction of IRa/LSC. These results show that the cp genome of three cultivated varieties displays a unique IR contraction compared to the wild species.
Comparison of quadripartite junction sites in three cultivated varieties cp genomes. Gene transcribed clockwise are presented below the track, whereas transcribed counterclockwise are presented on top of the track. The start and end of each gene from the junctions have been shown with arrows. The T scale bar above or below the track shows genes integrated from one region of the cp to another. JLB (IRb/LSC), JSA (SSC/IRa), JSB (IRb/SSC), and JLA (IRa/LSC) denotes the junction sites between the quadripartite regions of the genome.
Specific DNA barcode maker design for three cultivated varieties
To discriminate the three cultivated varieties, we selected 4427–5018 bp hypervariable regions, matK-rps16, to develop a barcode in which primer sequence F (forward, 5′–3′): GAATTTCAATTTAACAATGCAATAATA and R (reverse, 5′–3′): ATATTTTTTTGAATTCTGAC. PCR amplification of total DNAs from all five medicinal species samples resulted in products having the expected size (Fig. S2). The DNA fragments were extracted from each band and then subjected to Sanger sequencing. The sequencing results were identical to the expected sequences (Fig. 8). The barcode has a specific SNP loci and one Indel loci. These two variable loci can be used to differentiate three cultivated varieties.
Phylogenetic analysis and divergence times analysis
Each subfamily in the Labiatae formed a monophyletic clade. Scutellarioideae, Lamioideae, Ajugoideae, Lavanduloideae, Ocimoideae were sister groups to each other. This result is consistent with previous genetic studies49. The Scutellaria belongs to the Scutellarioideae subfamily. Moreover, the Flora of China classifies Scutellaria into Subgen. Scutellaria, Subgen. Anapis and Subgen. Scutellariopsis. However, the results of this study do not support such a classification. The BI and ML phylogenetic trees (Fig. 9) and phylogram (Fig. S3) revealed that SBP was more closely related to SBW, in the three cultivated varieties, which was also consistent with the result of the oligonucleotide repeats analysis. In addition, three cultivated varieties together with S. baicalensis (NC027262). They formed a strongly supported sister relationship with S. rehderiana (NC060314) and clustered into one branch, and then, with S. amoena (NC057255) and S likiangensis (NC061416) cluster together. This finding was consistent with the previous studies50. The closely related plants may possess similar chemicals and have the same pharmacological properties. Moreover, plants are phylogenetically related to each other. Therefore, ethnobotanists have used a range of phylogenetic methods for bioprospecting51. According to previous research, the main pharmaceutical active ingredients of S. baicalensis are flavonoids, glycosides and aglycones52,53. Modern pharmacological studies show that the active ingredients of S. baicalensis have anti-bacterial, anti-tumor, anti-oxidation, anti-viral, and anti-inflammation properties6,7,8. These results provide new ideas for the exploitation of S. baicalensis. The cp genomes seemed to provide more solid support for the reconstruction of phylogenetic relationships among these sections.
The molecular clock trees were calibrated by MEGA and BEAST with fossil record data of A. thaliana-O. sativa (Figs. 10 and S4). Ocimum basilicum and Lavandula angustifolia as root species of Labiatae with a divergence time estimated at 49.00 Mya (Fig. 10). The monophyletic group of the Scutellaris genus diverged at about 38.95 Mya. In a previous study, the divergence time of S. baicalensis based on genome sequence was approximately 13.28 Mya4. While based on the matK and CHS genes, the divergence time of S. baicalensis and S. salviifolia was approximately 1.37 Mya54. This study confirmed and traced the divergence time of S. baicalensis and three cultivated varieties, which occurred at 0.11 Mya and 0.10 Mya, later than previously reported. The differences in divergence time between three cultivated varieties and S. baicalensis are likely due to the influence of the amount of data and hybridization55,56.
Conclusions
In this study, the cp genome of the three cultivated varieties of S. baicalensis were sequenced and assembled. A comparative analysis with other genomes was also performed. S. baicalensis is one of the most commonly used Chinese medicinal materials in China. The study of cp genome can provide more biological information for the sustainability of S. baicalensis. Overall, the three cultivated varieties of S. baicalensis cp genomes had similar structures and gene compositions. However, the sliding window results show significant differences among the three cultivated varieties in matK-rps16 and petA-psbJ. Therefore, the complete cp genome could be used as a super-barcode to identify the three cultivated varieties. Moreover, we verified that the matK-rps16 sequence can be used as a barcode for the identification of three varieties. We reconstructed a phylogenetic tree by complete cp genomes. The result indicated that S. baicalensis and S. rehderiana are closely related. The results provide new ideas for the exploitation of S. baicalensis. In addition, the divergence time analysis showed that the three cultivated varieties diverged at about 0.10 Mya. Overall, these results can provide species identification and biological information and contribute to the bioprospecting and improvement of ornamental value.
Sample collection and experiment statement
All the methods including plant leaves collection and experiment were carried out in accordance with relevant national/international/legislative and institutional guidelines and regulations.
Data availability
All sequences used in this study are in the form of attachments. We have submitted this part of the data to NCBI but have not yet released it. At present, we have provided it to the journal and reviewers as an attachment and urge NCBI to release it as soon as possible. The dataset generated and or analyzed during the current study is deposited in Genbank with accession numbers: OP837955, OP837956 and OP837957.
Abbreviations
- cp:
-
Chloroplast
- NCBI:
-
National Center for Biotechnology Information
- LSC:
-
Large single-copy
- SSC:
-
Small single-copy
- IR:
-
Inverse repeat
- SSRs:
-
Simple sequence repeats
- ML:
-
Maximum likelihood
- BI:
-
Bayesian inference
References
Zhao, T. et al. Scutellaria baicalensis Georgi. (Lamiaceae): A review of its traditional uses, botany, phytochemistry, pharmacology and toxicology. J. Pharm. Pharmacol. 71, 1353–1369 (2019).
National Pharmacopoeia Committee, N. Pharmacopoeia of the People’s Republic of China (2020).
Wang, Z. et al. A Comprehensive review on phytochemistry, pharmacology, and flavonoid biosynthesis of Scutellaria baicalensis. Pharm. Biol. 56, 465–484 (2018).
Xu, Z. et al. Comparative genome analysis of Scutellaria baicalensis and Scutellaria barbata reveals the evolution of active flavonoid biosynthesis. Genomics Proteomics Bioinformatics 18, 230–240 (2020).
Liao, H., Ye, J., Gao, L. & Liu, Y. The main bioactive compounds of Scutellaria baicalensis Georgi. for alleviation of inflammatory cytokines: A comprehensive review. Biomed. Pharmacother. 133, 110917 (2021).
Park, J., Kim, R. & Park, E. Antioxidant and Α-glucosidase inhibitory activities of different solvent extracts of skullcap (Scutellaria baicalensis). Food Sci. Biotechnol. 20, 1107–1112 (2011).
Wu, R. et al. Baicalein targets GTPase-mediated autophagy to eliminate liver tumor-initiating stem cell-like cells resistant to mTORC1 inhibition. Hepatology 68, 1726–1740 (2018).
Ma, Q. et al. San Wu Huangqin decoction, a Chinese herbal formula, inhibits influenza a/PR/8/34 (H1N1) virus infection in vitro and in vivo. Viruses 10, 117 (2018).
Chen, L. et al. Synergistic activity of baicalein with ribavirin against influenza a (H1N1) virus infections in cell culture and in mice. Antivir. Res. 91, 314–320 (2011).
Guo, L. et al. Effects of ecological factors on secondary metabolites and inorganic elements of Scutellaria baicalensis and analysis of Geoherblism. Sci. China Life Sci. 56, 1047–1056 (2013).
Ye, Q., Wang, B. & Mao, J. Cytokine storm in COVID-19 and treatment. J. Infect. 80, 607–613 (2020).
Yu, F. et al. Effects of baicalin in CD4+ CD29+ T cell subsets of ulcerative colitis patients. World J. Gastroenterol 20, 15299 (2014).
Zhang, Y. et al. Baicalein selectively induces apoptosis in activated lymphocytes and ameliorates concanavalin a-induced hepatitis in mice. PLoS ONE 8, e69592 (2013).
Boozari, M. & Hosseinzadeh, H. Natural products for COVID-19 prevention and treatment regarding to previous coronavirus infections and novel studies. Phytother. Res. 35, 864–876 (2021).
Liu, H. et al. Scutellaria baicalensis extract and baicalein inhibit replication of SARS-CoV-2 and its 3C-like protease in vitro. J. Enzym. Inhib. Med. Chem. 36, 497–503 (2021).
Song, J. et al. The comprehensive study on the therapeutic effects of baicalein for the treatment of COVID-19 in vivo and in vitro. Biochem. Pharmacol. 183, 114302 (2021).
Neuhaus, H. E. & Emes, M. J. Nonphotosynthetic metabolism in plastids. Annu. Rev. Plant Biol. 51, 111 (2000).
Palmer, J. D., Jansen, R. K., Michaels, H. J., Chase, M. W. & Manhart, J. R. Chloroplast DNA variation and plant phylogeny. Ann. Mo. Bot. Gard. 75, 1180–1206 (1988).
Henriquez, C. L. et al. Evolutionary dynamics of chloroplast genomes in subfamily Aroideae (Araceae). Genomics 112, 2349–2360 (2020).
Chen, Q., Wu, X. & Zhang, D. Phylogenetic analysis of Fritillaria cirrhosa D. Don and its closely related species based on complete chloroplast genomes. PeerJ 7, e7480 (2019).
Zhang, W. et al. DNA barcoding of Oryza: Conventional, specific, and super barcodes. Plant Mol. Biol. 105, 215–228 (2021).
Li, X. et al. Plant DNA barcoding: From gene to genome. Biol. Rev. 90, 157–166 (2015).
Shi, L. et al. CPGAVAS2, an integrated plastome sequence annotator and analyzer. Nucleic Acids Res. 47, W65–W73 (2019).
Chan, P. P., Lin, B. Y., Mak, A. J. & Lowe, T. M. TRNAscan-SE 2.0: Improved detection and functional classification of transfer RNA genes. Nucleic Acids Res. 49, 9077–9096 (2021).
Zhang, D. et al. PhyloSuite: An integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies. Mol. Ecol. Resour. 20, 348–355 (2020).
Chen, C. et al. TBtools: An integrative toolkit developed for interactive analyses of big biological data. Mol. Plant. 13, 1194–1202 (2020).
Benson, G. Tandem repeats finder: A program to analyze DNA sequences. Nucleic Acids Res. 27, 573–580 (1999).
Beier, S., Thiel, T., Münch, T., Scholz, U. & Mascher, M. MISA-web: A web server for microsatellite prediction. Bioinformatics 33, 2583–2585 (2017).
Kurtz, S. et al. REPuter: The manifold applications of repeat analysis on a genomic scale. Nucleic Acids Res. 29, 4633–4642 (2001).
Frazer, K. A., Pachter, L., Poliakov, A., Rubin, E. M. & Dubchak, I. VISTA: Computational tools for comparative genomics. Nucleic Acids Res. 32, W273–W279 (2004).
Amiryousefi, A., Hyvönen, J. & Poczai, P. IRscope: An online program to visualize the junction sites of chloroplast genomes. Bioinformatics 34, 3030–3031 (2018).
Katoh, K. & Standley, D. M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 30, 772–780 (2013).
Nylander, J. A., Ronquist, F., Huelsenbeck, J. P. & Nieves-Aldrey, J. Bayesian phylogenetic analysis of combined data. Syst. Biol. 53, 47–67 (2004).
Stamatakis, A. RAxML Version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 30, 1312–1313 (2014).
Kumar, S., Stecher, G., Li, M., Knyaz, C. & Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 35, 1547 (2018).
Liu, Y. et al. Whole-genome sequencing and analysis of the Chinese herbal plant Gelsemium elegans. Acta Pharmaceutica Sinica B. 10, 374–382 (2020).
Gao, Y. et al. De novo genome assembly of the red silk cotton tree (Bombax ceiba). GigaScience. 7, y51 (2018).
Kar, R. K. On the Indian Origin of Ocimum (Lamiaceae): A Palynological Approach. (1993).
Bouckaert, R. et al. BEAST 2: A software platform for bayesian evolutionary analysis. PLoS Comput. Biol. 10, e1003537 (2014).
Rambaut, A., Drummond, A. J., Xie, D., Baele, G. & Suchard, M. A. Posterior summarization in Bayesian phylogenetics using tracer 1.7. Syst. Biol. 67, 901–904 (2018).
Helfrich, P., Rieb, E., Abrami, G., Lücking, A. & Mehler, A. TreeAnnotator: Versatile visual annotation of hierarchical text relations. In Proceedings of the Eleventh International Conference on Language Resources and Evaluation (LREC 2018), 2018.
Guo, M. et al. Plastid genome data provide new insights into the phylogeny and evolution of the genus Epimedium. J. Adv. Res. 36, 175–185 (2022).
Wang, J. et al. Comparative analysis of chloroplast genome and new insights into phylogenetic relationships of Polygonatum and tribe Polygonateae. Front. Plant Sci. 13, 882189 (2022).
Wang, Y. et al. Chloroplast genome variation and phylogenetic relationships of Atractylodes species. BMC Genomics 22, 1–12 (2021).
Hübschmann, T., Hess, W. R. & Börner, T. Impaired splicing of the Rps 12 transcript in ribosome-deficient plastids. Plant Mol. Biol. 30, 109–123 (1996).
Vogel, J., Hübschmann, T., Börner, T. & Hess, W. R. Splicing and intron-internal RNA editing of trnK-matK transcripts in barley plastids: Support for MatK as an essential splice factor. J. Mol. Biol. 270, 179–187 (1997).
Amiryousefi, A., Hyvönen, J. & Poczai, P. The chloroplast genome sequence of bittersweet (Solanum dulcamara): Plastid genome structure evolution in Solanaceae. PLoS ONE 13, e196069 (2018).
Mehmood, F., Shahzadi, I., Ahmed, I., Waheed, M. T. & Mirza, B. Characterization of Withania somnifera chloroplast genome and its comparison with other selected species of Solanaceae. Genomics 112, 1522–1530 (2020).
Jiang, D. et al. The chloroplast genome sequence of Scutellaria baicalensis provides insight into intraspecific and interspecific chloroplast genome diversity in Scutellaria. Genes. 8, 227 (2017).
Yang, X. et al. Advances in pharmacology, biosynthesis, and metabolic engineering of Scutellaria-specialized metabolites. Crit. Rev. Biotechnol. 42, 1–17 (2022).
Teixidor-Toneu, I., Jordan, F. M. & Hawkins, J. A. Comparative phylogenetic methods and the cultural evolution of medicinal plant use. Nature Plants. 4, 754–761 (2018).
Tan, Y. et al. Pharmacological properties of total flavonoids in Scutellaria baicalensis for the treatment of cardiovascular diseases. Phytomedicine 107, 154458 (2022).
Zheng, W. et al. Inhibitory effects of Coptidis Rhizoma on the intestinal absorption and metabolism of Scutellariae radix. J. Ethnopharmacol. 270, 113785 (2021).
Chiang, Y., Huang, B. & Liao, P. Diversification, biogeographic pattern, and demographic history of Taiwanese Scutellaria species inferred from nuclear and chloroplast DNA. PLoS ONE 7, e50844 (2012).
Liu, H. et al. Complete chloroplast genome sequence of Triosteum sinuatum, insights into comparative chloroplast genomics, divergence time estimation and phylogenetic relationships among dipsacales. Genes 13, 933 (2022).
Drew, B. T. & Sytsma, K. J. The South American radiation of Lepechinia (Lamiaceae): Phylogenetics, divergence times and evolution of dioecy. Bot. J. Linn. Soc. 171, 171–190 (2013).
Acknowledgements
The authors thank the Germplasm Resources Nursery of Dingxi Academy of Agricultural Sciences for providing samples.
Funding
This work was supported by the China Agriculture Research System of MOF and MARA (CARS-21) and the Dingxi city science and technology plan project (DX2021AN10).
Author information
Authors and Affiliations
Contributions
Y.J. and C.Z. conceived the ideas; S.W. and F.W. contributed to the sampling; Y.J. performed the experiments and analyzed the data. The manuscript was written by Y.J. and edited by Z.S. All authors have read and agreed to the final version of the manuscript.
Corresponding authors
Ethics declarations
Competing interests
The authors declare no competing interests.
Additional information
Publisher's note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary Information
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Jiang, Y., Zhu, C., Wang, S. et al. Identification of three cultivated varieties of Scutellaria baicalensis using the complete chloroplast genome as a super-barcode. Sci Rep 13, 5602 (2023). https://doi.org/10.1038/s41598-023-32493-9
Received:
Accepted:
Published:
Version of record:
DOI: https://doi.org/10.1038/s41598-023-32493-9
This article is cited by
-
Plastome diversity and phylogenetic insights among modern Egyptian wheat cultivars: Genome-Wide and Gene-Level perspectives
BMC Plant Biology (2025)
-
Comparative and phylogenetic analysis of the chloroplast genomes of four commonly used medicinal cultivars of Chrysanthemums morifolium
BMC Plant Biology (2024)
-
Comparative chloroplast genomics, phylogenetic relationships and molecular markers development of Aglaonema commutatum and seven green cultivars of Aglaonema
Scientific Reports (2024)
-
Species identification and germplasm conservation of origanum based on chloroplast genes
Genetic Resources and Crop Evolution (2024)












