Introduction

Punica granatum L. is one of the most important worldwide crop fruits. Pomegranate fruits possess medical and nutritional values for humans due to their contents of antioxidants, vitamins, potassium, calcium, magnesium, iron, and zinc1.

Unfortunately, fruits are infested with a wide range of insect pests. The most serious pests are lepidopteran insects such as pomegranate butterfly Deudorix (= Virachola) sp., (Lepidoptera: Lycaenidae) (Klug), fruit sucking moth Eudocima sp., (Clerk) (Lepidoptera: Erebidae), carob moth Ectomyelois (= Apomyelois and Spectrobates) sp., (Zeller) (Lepidoptera: Pyralidae), and honeydew moth Cryptoblabes sp. (Lepidoptera: Pyralidae)2.

In Egypt, the pomegranate butterfly is one of the most dangerous insect pests infesting the pomegranate fruits and the most spread. So, the first step for pest control and designing an appropriate Integrated Pest Management (IPM) program is to begin with accurate identification of the target pest. The real information about the pomegranate butterfly is still recorded from non-taxonomical resources. Even though many authors have identified lepidopteran species morphologically, the morphological criteria are not accurate enough to differentiate among these species. Additionally, some small invisible changes in morphological characteristics may remain unnoticed3 and not enough for their identification and must be supported by molecular identification methods.

In this regard, the molecular approach is an efficient support for species identification, especially when there are many ambiguities in conventional tools4,5. The mitochondrial DNA sequences are important tools for species-level identification. Especially, the mitochondrial genes and the cytochrome oxidase subunit 1 (CO1) which are used as standard barcode regions for several insect species6. Using CO1 has proved to be very useful not only for identifying species but also for revealing cryptic species7. So, the objectives of the current study are to accurately identify the pomegranate butterfly type infesting pomegranate orchids in Assiut Governorate, Northern Upper Egypt, which produces 27.93% of the world's pomegranate crop8 by morphological descriptions and genetic techniques.

Materials and methods

Experimental area

This study was conducted in Experimental Farm, Faculty of Agriculture, Assiut University, Assiut, Northern Upper Egypt (375 km South of Cairo) for collecting different stages of pomegranate butterfly from pomegranate fruits.

Pomegranate butterfly collection

The immature stages (eggs, larvae, and pupae) were collected from infested fruits (Fig. 1) of pomegranate, Punica granatum L. (Myrtales: Punicaceae). The samples were incubated in The Biological Control Lab., Plant Protection. Dept., Assiut Univ., Assiut, Egypt, at (27 ± 1 °C, 70 ± 10% RH, and L 16: D 8).

Figure 1
figure 1

Immature stages of pomegranate butterfly (eggs and larvae) collected from infested fruits; (a) a red circle surrounds 1st larval instar hatched from the egg, and (b) a black circle surrounds the 4th larval instar with symptoms of infestation caused by larvae that inter-feeding fruits.

Full size image

Morphological identification

Body coloration, wing venation, leg structure, and body morphometrics are the morphological criteria used for identifying pomegranate butterfly9,10.

Scanning electron microscopy (SEM)

Skeletal structures were studied using a Jeol JSM-5500. LV(JEOL-Japan) scanning electron microscope in The Central Lab., Fac. of Sci., South Valley Univ.

Light microscope

Wing scales were removed according to Belkin11, and the bleached wings were mounted on slides for studying wing venation by using the Leica DC150 Camera.

Body morphometrics

The criteria of measurements were body length (BL = from the head to the tip of the abdomen (Fig. 2a)), fore wing length (FWL = from the base (humeral angle) to the apex (apical angle) (Fig. 2b)), hind wing length (HWL = from the base to the middle of the term (apical margin), (Fig. 2c)), and antennal length (AntL = from the base to the tip of the antenna (Fig. 2d))10. Measurements determined by the HDMI MULTI-OUTPUT HD’ (Toup Cam_120) CAMERA.

Figure 2
figure 2

The measured morphometric criteria of pomegranate butterfly “ventral view”: (a) body length (BL), (b) forewing length (FWL), (c) hindwing length (HWL), and (d) antennal length (AntL).

Full size image

Molecular genetic identification of pomegranate butterfly

DNA isolation

DNA was extracted from the specimen’s legs from a pomegranate butterfly and followed by a modified cetyltrimethylammonium bromide protocol with an additional polyethylene glycol precipitation as described by Reineke12.

Polymerase chain reaction (PCR) conditions

The mitochondrial CO1 gene was amplified using the primers LepF1 (ATTCAACCAATCATAAAGATATTGG) and LepR1 (TAAACTTCTGGATGTCC-AAAAAATCA)7. The PCR reactions comprised 1μL (10 pmol) of each forward and reverse primer, 1μL of genomic DNA, and 20μL PCR master mix in a final reaction volume of 40μL. The PCR was carried out under the following conditions: denaturing at 95 °C for 4 min., followed by 34cycles of denaturing at 94 °C for 60 s., alignment at 48 °C for 60 s., and extension at 72 °C for 60 s., finishing with an extension at 72 °C for 7 min. All PCR products were visualized using 1.5% agarose gel stained with ethidium bromide. Gel electrophoresis was run for 40 min., at 100 V using 100 bp DNA Ladder RTU (Ready-to-Use) GeneDireX.

Sequence and phylogenetic analysis

All DNA sequencing was achieved by Macrogen (Seoul, South Korea). The sequences were deposited at the National Centre for Biotechnology Information (GenBank/NCBI) to obtain the accession number. DNA sequences were primarily aligned with the default parameters of CLUSTALW13. Two methodologies, Minimum Evolution (ME) and Neighbour-joining (NJ) implemented in MEGA software version 7.0 1814, were used for phylogenetic reconstructions. In this study, 1000 bootstrap iterations15 were applied. Sequence divergences were calculated using Kimura 2-parameter distances16.

GenBank accession number

The partial sequence of the CO1 region of the butterfly reported in this paper is deposited in GenBank nucleotide sequence databases (http://www.ncbi.nlm.nih.gov) under accession number MW463927 for DAUF-Pomegranate.

Data analysis

Means ± standard deviation (SD) was determined by using Microsoft Excel 2016 for morphometric measurement data.

Results

Morphological identification

Using light microscopy and scanning electron microscopy (SEM), some morphological structures of male and female pomegranate butterfly were illustrated.

The general body coloration

The general color of body scales is a mix of dark and light grey on the dorsal side and white on the ventral side in both sexes (Fig. 3).

Figure 3
figure 3

The body scales color of pomegranate butterfly adults: (a) female and (b) male.

Full size image

The head

Compound eyes

The color of compound eyes was brown and coppery, (Fig. 4a,b). For the first time study by focusing on one scanned eye, it there are the interfacial hairs (Fig. 4c,d) were found distributed across the eye in a corner between three facets.

Figure 4
figure 4

The head capsule of a pomegranate butterfly: (a,b) Light micrograph, (c,d) SEM, red circle surrounds the interfacial hair in a corner between three facets.

Full size image
Antennae

The antenna of the pomegranate butterfly is clavate type (Fig. 5). The number of segments in the flagellum is 22 filiform segments followed by 17 clubbed ones in both sexes. The color of terminal segments is orange and black, but other segments are black and white.

Figure 5
figure 5

Clavate type of pomegranate butterfly antenna by using light microscopy.

Full size image
Mouthparts

Mouthparts of pomegranate butterfly are sucking type. There are a pair of three-segmented labial palps and a brown coiled proboscis (galea). The labial palps tip is covered with brown scales and the bases with white scales (Fig. 6).

Figure 6
figure 6

Mouthparts of pomegranate butterfly: light micrograph head capsule (x = 16): Lp: labial palp and Prb: proboscis.

Full size image

The thorax

In both sexes, the coloration of the thorax is shiny dark grey, and the smallest of the three thoracic segments is the prothorax in a pomegranate butterfly.

Legs

The legs of a pomegranate butterfly are walking type. The three pairs of legs are covered with white scales. Each leg consists of a coxa, trochanter, femur, tibia, and five segmented fused tarsi (Fig. 7a). Tibiae of legs apically bear well-developed branched spurs. The apical tarsomere bears two claws with pulvilli and empodium in all legs for both sexes except the foreleg of the male consists of one claw (Fig. 7b,c).

Figure 7
figure 7

The Legs of pomegranate butterfly: (a) light micrograph of the leg without scales (x = 16), (b) SEM of the male foreleg, and (c) SEM of female foreleg: cox: coxa, tro: trochanter, fem: femur, tib: tibia, tar: tarsus, and clw: claw.

Full size image

Wings

Wing coloration

Both sexes of pomegranate butterfly differed in their coloration.

Upper side of female and male wing

The female fore wing upper side scaled dark brown in the apical angle (apical and sub-apical area) and apical margin (marginal and sub-marginal area), brown color in the post-discal and discal area, and a bluish tint becoming darker in the humeral angle (basal and post-basal area) (Fig. 8a FW). The female hind wing's upper side is covered in brown scales except for the anal margin (tornal area) and humeral angle (part of the discal, sub-discal, basal, and dorsal areas), which are squirrel color. Also, two spotted patches were recognized nearby the anal angle (tornal area), (Fig. 8a HW).

Figure 8
figure 8

The wing upper side of a pomegranate butterfly (x = 8): (a) The female wing's upper side (a red circle surrounds two spots) and (b) The male wing's upper side (a black circle surrounds one spot), FW: fore wing and HW: hind wing.

Full size image

The upper side of the male forewing is covered by dark orang scales, except for the costal margin (costal area), apical angle (apical and subapical area), and apical margin (marginal area), which are brown. Except for the humeral angle (basal area), anal margin (dorsal area), and part of (sub-discal, discal, and post-discal area) (Fig. 8b FW). The male hind wing's upper side is covered by dark orange scales. Additionally, there was one spotted patch in the sub-discal area and near the humeral angle (basal area) (Fig. 8b HW).

Lower side of female and male wing

The lower sides of the wings are similar in both sexes (Fig. 9). The fore and hind wings’ lower sides are covered with grey scales with different scattered bands. There are two black rounded spots, one just above the filamentous tail and the other on the wing tip. It is worth pointing out herein that in the sub-discal area of the hindwing lower side, clearly encounter two dark spots surrounded by a white oval circle (Fig. 9a,b HW).

Figure 9
figure 9

Wing coloration of the lower side of pomegranate butterfly (x = 8): (a) The female wing's lower side, (b) The male wing's lower side (a red circle surrounds two spots female and male), FW: Fore Wing and HW: hind wing.

Full size image
Wing venation

The venation in pomegranate butterfly is similar in both sexes as described in the family individuals by17. The forewing with 11 veins: Sc, R1, R2, R3, R4 + 5, M1, M2, M3, Cu1, Cu2 and A1 + 2, (Fig. 10a). The hind wing with 9 veins, include Sc + R1, Rs, M1, M2, M3, Cu1, Cu2, A1 + 2 and A3, (Fig. 10b).

Figure 10
figure 10

Wing venation of pomegranate butterfly: (a) forewing veins, (b) hindwing veins (Sc: subcostal, R: Radius, M: Media, Cu: Cubitus, and AL: Anal).

Full size image

The abdomen

The number of abdominal segments is 10segments in both sexes. The last 3segments are greatly modified to form external genitalia. The female abdomen ends with short hairs (Fig. 11a). There is a dense tuft of long hairs (pencil hairs) at the end of the male abdomen associated with the scent gland and used for courtship (Fig. 11b).

Figure 11
figure 11

Abdomen description of pomegranate butterfly removed scales: (a) female and (b) male.

Full size image

Morphometrics of pomegranate butterfly

Body length (BL) measurements

The (BL) in both sexes was measured for each sex in the pomegranate butterfly (Table 1). In males, (BL) ranged from 11.360 to 12.000 mm with an average of 11.674 ± 0.299 mm, and in females ranged from 10.380 to 13.090 mm with an average of 11.458 ± 1.001 mm.

Table 1 Body length measurements from the head to the tip of the abdomen of the pomegranate butterfly.
Full size table
Antennal length

The distance from the base to the tip of the antenna was measured for antennal length. The antennal length measurement of the pomegranate butterfly ranged from 6.190 to 7.850 mm with an average of 7.203 ± 0.529 mm. The above-mentioned measurements are based on ten individuals (n = 10).

Wings measurements

The (FWL) measurements ranged between 12.740–14.540 and 12.600–16.750 mm with an average of 13.728 ± 0.472 and 14.780 ± 1.164 mm for males and females, respectively.

The (HWL) measurements ranged between 7.820–9.940 and 8.990–12.370 mm with an average of 8.919 ± 0.716 and 10.446 ± 1.069 mm for males and females, respectively (Table 2). The above measurements were based on ten individuals of each collection (n = 10) for both wings’ measurements.

Table 2 Wings length measurements fore wing length from humeral angle to apical angle and hind wing length from base to middle of apical margin in males and females for pomegranate butterfly.
Full size table

Molecular identification of pomegranate butterfly

The first-time record of Deudorix livia, in the GenBank for the partial nucleotide sequence of CO1 was deposited under the accession number MW463927. The sequencing of the mitochondrial CO1 gene produced a nucleotide length of 632 bp. The nucleotide frequencies of adenine (A), thymine (T), cytosine (C), and guanine (G) were 33.7, 37.8, 14.8, and 13.7%, respectively. The average A + T content was 71.5%, which was higher than the average C + G content (Table 3).

Table 3 Accession numbers, nucleotide frequencies, A + T and C + G content of mitochondrial CO1 gene of Deudorix livia.
Full size table

The sequences of CO1 of D. livia were subjected to BLAST/N at (NCBI) and revealed eight related species from the genus Deudorix; in addition to the out-group species; Sabatinca demissa (HM431779.1), Sabatinca calliarcha (HM431781.1) and Sabatinca heighwayi (HQ575067.1) of the family Micropterigidae (Table 4).

Table 4 The understudied Deudorix livia with their related species from the GenBank/NCBI in addition to the out-group species based on (COX1) sequences.
Full size table

Among the studied D. livia species pairwise genetic distances ranged from 0.0114 to 0.0151. The most related species to our sample was Deudorix isocrates, where the genetic distance was 0.0114. The most genetic distance to our sample was Deudorix epirus, where the genetic distance was 0.0141. Overall, the mean distance value was 0.17% (Table 5).

Table 5 Pairwise distances using the (COX1) gene among Deudorix livia with their related species, and the out-group.
Full size table

To conduct the phylogenetic tree analysis using CO1 sequencing, D. livia was submitted to be analyzed together with eight related Deudorix species sequences and the out-group species from GenBank/NCBI (previously mentioned in Table 5). For more illustrative phylogenetic relations, more than one phylogenetic method was used (ME and NJ) based on the CO1 gene. These methods showed nearly the same relations with some differences in support values and revealed 3 main features: (1) species of out-group formed a separate cluster. (2) all Deudorix species formed two main clades; the first includes D. smilis and D. democles while the second contains the rest species. (3) the most related species to D. livia crops was D. isocrates (Fig. 12a,b).

Figure 12
figure 12

(a) Minimum-evolution phylogenetic tree among Deudorix livia with their related species, and the out-group using the (COX1) gene. (b) Neighbour Joining phylogenetic tree among Deudorix livia with their related species, and the out-group using (COX1) gene.

Full size image

Discussions

The Lycaenidae is a family comprising several thousand species. Many are brightly colored, and this is often the result of interference effects caused by the microstructure of the wings. One of the genera in this family is the Deudorix genus. This genus is formed by many species complexes that can be difficult to identify due to the similar shapes of species in this genus. Deudorix livia was described by Klug in 1834 based on the Lycaena genus, then the Virachola genus by Moore in 1881. Several studies about this genus were concerned ecology, economic harm, and control1,8,18,19,20,21, but studies on the morphology of this pest are rare. Also, morphological studies were superficial, such as22,23,24. So, the current study aims to accurately identify the pomegranate butterfly type through a full description of morphological and genetic techniques.

Although morphometric identification is much better than general morphology of insect’s species, using genetic tools became the most accurate method to differentiate between closely related species. Our results indicated that Deudorix livia was recorded for the first time in the GenBank for the partial nucleotide sequences of CO1 deposited under accession number MW463927. However, among the studied D. livia species, pairwise genetic distances ranged from 0.0114 to 0.0151. The most related species to our sample was Deudorix isocrates, although it differed morphologically from our sample25, where the genetic distance was 0.0114. Based on the finding of Kaleshkumar26 who reported that closely related species have the lowest genetic distance, while the highest genetic distance refers to highly diverged cases.

Some morphological features were studied for the first time, such as compound eyes focused on one scanned eye and interfacial hairs found between every three ommatidia. Meanwhile, most researchers focused on the general description of the eye as having dense white and dark scales on the borders, and others mentioned that it doesn’t have ocelli9,17,27. Also, on the upper side of the male hindwing, there was one spotted patch in the sub-discal area and near the humeral angle (basal area). This feature is believed to be the female sexual pheromone receiving area during the mating process. So, it needs extensive future studies to identify such pheromones for using alternative pesticides to help control this pest.

The importance of real nomenclature for the pest is one of the most important steps for conducting appropriate control approach to reduce the population density of pomegranate butterfly below the economic injury level.

Conclusions

The findings indicate that both sexes' body scales are white on the ventral side and a mixture of dark and light grey on the dorsal side. Also, it contributes a similar wing venation. However, the average body length (BL) for male was 11.674 0.299 mm, while for female it was 11.458 1.001 mm. The mitochondrial CO1 gene from Deudorix livia was originally partially sequenced and deposited in GenBank under the accession number MW463927. The accurate identification of D. livia in pomegranate agroecosystems can help in designing appropriate (IPM) programs for this serious economic pest. This is in line with the global goals of sustainable development for environmental integrity and human health.