Introduction

The increasing amount of organic waste produced by growing industrial and agricultural activities necessitates effective and sustainable management solutions. Composting has become a key method for treating biodegradable waste by converting it into stable, nutrient-rich organic matter through aerobic microbial processes. This not only reduces environmental pollution but also recycles organic materials back into the soil, improving its fertility and structure1,2,3. Compost, mainly decomposed plant residues with some animal or mineral matter, is rich in humic substances and nutrients, which boost soil organic matter, nutrient availability, and microbial activity to support sustainable crop growth and soil health4,5,6. Plant diseases caused by fungi, bacteria, and viruses pose a significant threat to global food security, with fungal pathogens accounting for 70–80% of crop losses7,8. Although chemical controls are standard, their environmental impact and increasing resistance among pathogens highlight the need for sustainable alternatives. Compost and products derived from it, such as extracts and teas, enrich soil with beneficial microbes and nutrients, helping to suppress pathogens. However, their effectiveness depends on their composition and preparation, stressing the importance of standardized production to ensure consistent quality9,3.

Compost extracts, especially compost teas, are highly valued in sustainable agriculture for improving plant health and reducing phytopathogens. Made from composted organic materials, they are prepared as aerated compost teas (ACTs), which utilize oxygenation to promote beneficial aerobic microorganisms, or non-aerated compost teas (NCTs), which depend on passive fermentation10. These extracts act as environmentally friendly biocontrol agents, decreasing reliance on chemical pesticides. Their effectiveness is attributed to a range of microorganisms, including Bacillus spp., Pseudomonas spp., Lactobacillus spp., and Streptomyces spp., as well as fungi such as Trichoderma spp., Aspergillus spp., and Penicillium spp., along with bioactive substances like humic acids, phenolic compounds, and amino acids. These components help suppress pathogens, promote plant growth, enhance nutrient absorption, and improve stress tolerance 11,12,13,14. Their mechanisms involve nutrient competition, activation of systemic acquired resistance (SAR), and antibiosis through compounds such as siderophores and lipopeptides (iturin, fengycin, surfactin), which damage pathogen membranes and lessen diseases caused by fungi like Botrytis cinerea, F. oxysporum, among others15,16,17,18,19. Liquid compost extracts can be integrated with fertigation systems to deliver nutrients and microbes via irrigation, foliar sprays, or soil drenches, supporting soil health and modern agriculture20,21,22, Ros et al., 202023. By reducing the use of synthetic agrochemicals, they promote soil biodiversity, decrease pollution, and support sustainable pest management24. However, the effectiveness of compost tea varies due to differences in compost quality, extraction techniques, and microbial community dynamics, which affect the stability of bioactive compounds and disease suppression potential14,24,25. Gaps remain regarding the best compost type, maturity, and compost-to-water ratios (ranging from 1:1 to 1:50), with inconsistent results on microbial growth and oxygen levels23,26,27,28,29. Fermentation times vary broadly (12 hours to 3 days for ACTs,7 to 14 days for NCTs), with unclear effects on nutrient release and overall effectiveness30,31. Aeration enhances microbial activity, but its implementation is limited by equipment costs and uncertain oxygen thresholds32. Additives such as glucose or molasses can enhance efficacy but often lack standardized formulations, which can lead to reproducibility and biosafety issues22,14. Further research is needed to develop standardized protocols for preparing compost extracts, ensuring they are consistent, effective, and safe.

In this context, the present study aimed to evaluate the antifungal potential of non-aerated compost extracts against phytopathogenic fungi isolated from infected plants. Specifically, it sought to determine how variations in fermentation parameters, assessed through a factorial experimental design, influence the suppressive activity of these extracts. Additionally, the study examined the impact of sterilization on their inhibitory efficiency.

Materials and methods

Composts

Two commercial composts, C1 and C2, were used and obtained, respectively, from agricultural product sale sites in Al Jouf (29° 29’ 59.99" N, 39° 29’ 59.99" E) and Al-Kharj (23° 55’ 0.01" N, 47° 30’ 0.00" E) cities in Saudi Arabia. Compost C1 was prepared with a blend of algae, pine bark, perlite, and vermiculite, while compost C2 was composed of proper plant peat and organic fertilizer.

Physico-chemical and microbial characterization of composts and their extracts

pH and electrical conductivity (EC) were measured directly in the compost extract, and after diluting the compost samples in distilled water (1:5 w/v), followed by agitation at 200 rpm for 2 hours. Then, they were settled and filtered through a Wattman paper (0.45 µm). The supernatant was analyzed for pH and electrical conductivity (EC) using a pH meter (Metrohm 744) and a conductivity meter (WTW LF 330), respectively, as described by Kebede4. The water content and total solids (TS) were determined before and after the samples were dried overnight at 105 °C. Volatile solids (VS) were determined gravimetrically by incinerating the dried compost at 550 °C for 4 hours. The ash content was calculated as the difference between total and volatile solid contents33. The chemical oxygen demand (COD) was determined according to the Knechtel method79. The total (TN) and mineral (NH4+) nitrogen concentrations were determined by the Kjeldahl method33. The total organic carbon (TOC) was determined by dichromate oxidation and measured using the Shimadzu TOC-500 analyzer after acidic hydrolysis of the sample with concentrated HCl33. Metals and heavy metals were determined by atomic absorption spectrophotometry34. The phenolic content was determined using the Folin-Ciocalteu reagent with catechol as a standard35.

Microbial enumeration was performed according to ISO 721836, with results expressed as Colony Forming Units (CFU). Successive decimal dilutions of all samples were prepared in physiological water. For quantification, 0.1 ml aliquots of appropriate dilutions were surface-plated onto Plate Count Agar (PCA, Pronadisa, Cona, Spain) for total mesophilic bacteria (TMB) and Potato Dextrose Agar (PDA, Pronadisa, Cona, Spain) for yeasts and molds. PCA plates were incubated at 37 ± 1 °C for 24 ± 2 hours, while PDA plates were incubated at 25 °C for 5 days. The experiment was conducted in triplicate. Microbial concentration was calculated using the following formula36:

$$N= \frac{\sum Ci}{\left(N1+0.1 N2\right)d x V}$$

ΣCi: Sum of characteristic colonies counted on all retained Petri dishes.

N1: Number of Petri dishes retained at the first dilution.

N2: Number of Petri dishes retained at the second dilution.

d: Dilution rate corresponding to the first dilution.

V: Inoculated volume (ml).

N: Number of microorganisms (CFU/ml).

For granulometric determination, filtration through different sieves was achieved to evaluate the fractions of composts in clay (< 2 µm), silt (2–5 µm), and sand (50–2000 µm) particles34.

To assess the phytotoxic risk of the compost, a germination test was carried out on tomato (Solanum lycopersicum L.) and watercress (Nasturtium officinale) seeds. These seeds were obtained from Larosa Emanuele Sementi, Italy, a company certified under the CE Standard Category, License C.C.I.A.A. di Bari no. 160671, dated April 29, 1974. The studied compost was diluted in distilled water (1:5 w/v), stirred at 200 rpm for 2 hours, and then allowed to settle. It was subsequently filtered through Whatman paper (0.45µm). The obtained extract was used for the seeds’ germination index. Therefore, ten seeds of watercress or tomato were placed on a 9 cm diameter Petri dish containing filter paper moistened with 10 ml of compost extract. The Petri dishes were incubated at 25 °C for 7 days in the dark. The control was conducted in the same manner using distilled water.

The germination index (GI) was calculated according to the following equation34:

$$\text{GI }\left(\text{\%}\right)= \frac{\text{Number of germinated seeds }\left(\text{compost}\right)\text{ x total radicle length of germinated seeds }\left(\text{compost}\right)\left(\text{cm}\right)}{\text{Number of germinated seeds }\left(\text{control}\right)\text{ x total radicle length of germinated seeds }\left(\text{control}\right)\left(\text{cm}\right)}\text{ x }100$$

All analyses were conducted in triplicate, and the results are reported as mean values with their corresponding standard deviations (± SD). The physicochemical and microbial characterization of the two composts studied, C1 and C2, is presented in Table 1 and Figure 1.

Table 1 Physical-chemical and microbial characteristics of the two studied composts, C1 and C2.
Full size table
Fig. 1
figure 1

Granulometric composition (%) of the studied composts C1 and C2 by particle size.

Full size image

Isolation and identification of plant-pathogenic fungi

Pathogenic fungi were isolated from diseased plant tissues: S. racemosum (F1) from Ficus benjamina leaves, P. roridum (F2) from Cucumis sativus leaves, F. oxysporum (F3) from Solanum lycopersicum fruit, and P. italicum (F4) from Citrus sinensis fruit. These samples were collected from cultivated plants on a privately owned farm located in the Al Jouf region (29°54’16.3"N 40°09’54.3" E) with prior consent from the property landowner. Collections were conducted with minimal environmental impact to ensure ethical compliance. To eliminate saprophyte microorganisms, plant surfaces were disinfected with a 5% bleach solution and then rinsed with sterile distilled water. Under sterile conditions, plant fragments were cut with a sterile scalpel and then transferred to the surface of Potato Dextrose Agar (PDA, Sigma-Aldrich, Germany) supplemented with 0.05 g/l of rose Bengal. The Petri dishes were incubated at 25 °C for 7 days.

Isolated fungi were purified on PDA medium and then identified using microscopic observation followed by molecular identification. Fungal genera and species were identified based on their colonial and microscopic structures, using the taxonomic keys of Domsch et al.37. The microscopic examination of fungal colonies included the growth pattern, color, texture, basal and surface mycelium, the reverse of the colonies, and the rate of colony growth and diameter were determined.

Identification of fungal isolates was carried out by extracting and amplifying genomic DNA using PCR, followed by sequencing analysis using the ITS1 region of the 18S rRNA gene. By using a mortar and pestle, a small portion of the fungal culture was ground in liquid nitrogen. Then, 100 mg of mycelium was used for genomic DNA extraction using the i-genomic Series DNA Extraction Mini Kit (iNtRON), which is specifically designed for extracting genomic DNA from fungal species, following the manufacturer’s instructions. ITS gene amplification was performed using the ITS universal primer (Sigma-Aldrich, Germany), ITS1 (TCCGTAGGTGAACCTTGCGG), and ITS4 (TCCTCCGCTTATTGATGC), producing ~600 bp of amplicon products. PCR Master Mix (Promega ™) was used to amplify the ~600-bp region of the ITS region. A negative control (PCR mix without template DNA) has also been performed in all PCR experiments. A DNA thermal cycler (BIO-RAD S1000, USA) was used for DNA amplification. The PCR reaction conditions were 95 °C for 2 min (1 cycle), followed by 35 cycles of denaturation at 95 °C for 30 s, annealing at 52 °C for 30 s, and extension at 72 °C for 2 min, before a final extension at 72 °C for 15 min (1 cycle). PCR products were analyzed for the presence of specific fragments of the expected length in a 1% agarose gel electrophoresis stained with Ethidium bromide. The purified PCR products were subjected to sequencing using an ABI 3730xl DNA sequencer, with sequencing performed using both forward and reverse primers. Each sequence was subjected to an individual BLAST search to be verified in the Gene Bank. Sequences have been edited using MEGA (Molecular Evolutionary Genetics Analysis) software38. Phylogenetic Analyses of sequences were newly obtained from our isolates and were aligned with highly similar sequences from the Gene Bank using the MUSCLE Multiple Sequence Alignment Program. Sequences were aligned using ClustalX version 2.0 software39, and phylogenetic analyses were performed using MEGA 4.040 for neighbor-joining and bootstrap analyses. 1,000 replications generated bootstrap values. The BLASTn similarity search program was used to identify homologous sequences in the NCBI nucleotide database, confirming the species-level similarity with the query sequence of the isolates. The percentage of replicate trees was shown, in which the related taxa were grouped in the bootstrap test alongside the branches. The phylogenetic tree is plotted at scale, with branch lengths in the same units as the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the maximum composite likelihood method41 and expressed in units of base substitutions per site.

Phytopathogenicity test of isolated fungi

To evaluate the phytopathogenicity effects of the isolated fungi, the method described by Ewekeye et al.42 was used with slight modifications. Ripe and healthy tomato fruits were sterilized with 5% sodium hypochlorite solution for 5 min and then washed with sterile distilled water. A sterile cone was carefully punctured on one side of the epidermal layer of tomato tissue. A spore solution containing a concentration of 106 spores/ml of the tested fungi was then applied to the fruit cavity. The fruit samples were incubated at 25 ℃ for 7 days in sterile plastic vials. Disease symptoms on the fruits were evaluated visually by comparison with a negative control (healthy, untreated fruit). The symptom appearance time was recorded as the point at which visible signs of disease first appeared. At the end of the incubation period, the diameter of the lesion was measured in centimeters. Additionally, the initial and final weights of the tomato fruits were recorded to assess changes over the incubation period. The experiment was conducted in triplicate, and the data were expressed as mean ± standard deviation.

Compost extract preparation

The compost extracts were prepared through a controlled compost fermentation process. The experimental design optimized fermentation conditions using four factors at two levels (Table 2): Temperature (25 °C and 44 °C), compost concentration (1/5 and 1/8 m/v), glucose concentration (0 and 1 g/l), and fermentation time (3 and 7 days). Fermentation occurred in 1 L sealed plastic containers without oxygenation, with daily manual homogenization. Extracts were obtained by decanting the samples, filtering them through gauze, and then storing them in 50 ml sterile tubes at 4 °C. To determine the optimal levels of the four studied variables, an experimental design was used to analyze the inhibition percentage of phytopathogenic fungi. All experiments were conducted in triplicate, and the data were analyzed statistically using SPSS software (Version 24). The assumptions for the statistical model, specifically normality and homogeneity of variances, were verified before analysis. A Pearson correlation coefficient was calculated to assess the linear relationship between the compost extract parameters and their antifungal effects. A p-value of less than 0.05 was considered statistically significant.

Table 2 Full factorial design of 4 parameters at 2 levels.
Full size table

Antifungal activity of compost extracts

The study of the antifungal activity of compost extracts against isolated phytopathogenic fungi was conducted using the diffusion method on agar. Specifically, the compost extracts were mixed with PDA medium at dilutions of 1/2, 1/4, and 1/8. After the agar solidified, a 6 mm disc of the studied fungus was placed in the center of each Petri dish. PDA medium without compost extract served as a control medium. Then, the Petri dishes were incubated at 25 °C until the fungal mycelial filaments reached the edge of the control dish. The assessment of compost extract inhibition of phytopathogenic fungi was estimated by calculating the inhibition percentage of fungal mycelial growth in both control and dishes containing different dilutions of compost extracts, using the following equation43:

$$\text{Inhibition percentage }\left(\text{\%}\right)= \frac{(\text{D}-\text{d})}{\text{D}}\text{ x }100$$

Where D is the average diameter (cm) of the fungal mycelium growth on the control medium, and d is the average diameter (cm) of the fungal mycelium growth on PDA with diluted compost extract.

All the experiments were conducted in triplicate.

Sterilization effect of compost extracts against phytopathogenic fungi

To determine the effect of sterilizing the compost extracts on phytopathogenic fungi, five extracts from each compost that showed a high inhibition percentage were sterilized using autoclaving at 121 °C for 20 minutes and then filtered through a 0.22 µm membrane.

Statistical analysis

Quantitative variables were analyzed by calculating the mean and standard deviation (mean ± SD), the 95% confidence interval (CI95%), the median, and the interquartile range (minimum–maximum). The Shapiro–Wilk test was used to evaluate the normality of data distribution. Parametric tests, such as the independent t-test and analysis of variance (ANOVA), were performed to identify significant associations among the physicochemical and microbial parameters of composts and their extracts across the selected studies. Pearson’s correlation test examined relationships between the physicochemical and microbial characteristics of compost extracts and their antifungal activity against phytopathogenic fungi (n = 48). Only statistically significant results are reported. A factorial experimental design was employed to evaluate the impact of fermentation parameters on antifungal activity during the preparation of compost extracts. The level of statistical significance was set at 5%. All analyses were conducted using SPSS software (version 24).

Results and discussion

Physico-chemical characterization of the studied composts

The physicochemical characterization of composts, including pH, EC, organic matter, ammonium, C/N ratio, and mineral and heavy metal concentrations (Table 1), was used to assess compost stability and maturity44.

The compost C1 exhibited a relatively acidic pH and low EC compared to C2, which showed a more alkaline pH and higher EC (Table 1). According to the British Standards PAS 10045 and the Gulf Cooperation Council Standards46, the pH range for composts used in agriculture typically ranges from 6 to 8.5. However, the maximum allowable EC is 4 dS/m according to PAS-100 and 10 dS/m per GCST46. Both composts studied met the standards of PAS-100 and GCST. Al-Turki et al.47 noted that soil in Saudi Arabia tends to become arid with an alkaline pH and recommended against applying composts with a pH higher than 7.5. Additionally, Omar et al.48 reported that high EC levels can increase soil salinity, which negatively impacts plant growth.

The two composts showed high levels of organic matter, including total and volatile solids, TOC, and nitrogen. Additionally, C1 had a higher concentration of phenolic compounds compared to C2. The minimum organic matter percentage recommended by PAS-10045 is 25%, and by GCST46, it is 40%. C1 and C2 needed high organic matter, with values of 52% and 40%, respectively. Brown and Cotton49 stated that organic matter helps maintain soil structure, water retention capacity, and nutrient availability. Recently, Rossi et al.50 noted that high organic and nitrogen content enhances mineral immobilization in soil and improves fertilizer nitrogen availability. The C/N ratios were 13.5 and 11.07 for C1 and C2, respectively, indicating that both composts are rich in nitrogen matter (especially algae, peat, and organic fertilizers). The C/N ratio is an important indicator of the decomposition rate of organic materials during compost production51. According to GCST46 and PAS-10045, the maximum acceptable C/N ratio for final compost products is 20.

Its richness in macro and micro-elements distinguished the two composts. Indeed, the C1 exhibited the highest levels of phosphorus, calcium, iron, potassium, and copper. However, C2 was relatively higher in magnesium, sodium, and zinc. The two composts showed a relatively high nitrogen content (2.72% for C1 and 2.93% for C2) (Table 1).

Potassium, phosphorus, and nitrogen are among the most essential elements for microbial growth during the composting process. Additionally, their positive effect on plant growth is mainly due to the increased availability of nutrients from compost application25. Dang et al.52 noted that applying compost at a rate of 5 kg/ha improves the soil’s cation exchange capacity (CEC), boosts the availability of calcium and magnesium, and promotes soil fertilization. Potassium (K) is vital for crop productivity and quality, playing a crucial role in metabolism, enzyme activation, nutrient transport, photosynthesis, and stress resistance53. Zinc is also essential for plant growth, aiding cell multiplication, biochemical processes, nutrient uptake, photosynthesis, and overall productivity54,55.

Recent studies have shown that nitrogen buildup during composting is often linked to the breakdown of carbon-rich materials, resulting in carbon dioxide (CO₂) emissions and a subsequent decrease in carbon content. This process increases the relative concentration of nitrogen in the compost. Materials such as algae and peat moss, which are the primary components of compost types C1 and C2, respectively, naturally contain high nitrogen content, thereby increasing nitrogen levels in the final compost product. These dynamics are essential for optimizing compost quality and improving nutrient availability for plant growth56,26.

Furthermore, the heavy metals varied between the two composts, C1 and C2. The permissible limits set by GCST46 and PAS-10045 are 350 ppm for Zn, 150 ppm for Cu, 25 ppm for Ni, 120 ppm for Pb and Cr, and three ppm for Cd. The heavy metal levels, shown in Table 1 for C1 and C2, stay within these limits, confirming that both composts are non-toxic. Some heavy metals, such as zinc (Zn), iron (Fe), copper (Cu), nickel (Ni), and manganese (Mn), are essential micronutrients for microorganisms and plants, crucial for supporting microbial biomass and activity, and aiding in nutrient cycling57. However, when their concentrations go above safe levels, they can become toxic to soil organisms and plants. Additionally, the microbial profiles of composts C1 and C2 were examined to measure mesophilic bacteria, yeasts, and molds (Table 1). Compost C2 showed a higher presence of bacteria and more yeast activity than C1, while molds were more prevalent in C1 than in C2. These differences highlight distinct microbial communities, likely influenced by variations in environmental conditions or processing methods.

Both composts exhibited a high seed germination index (almost 81% and 75% of tomato and watercress seeds, respectively), indicating their maturity and confirming their suitability for seed germination without any signs of phytotoxicity58.

The results for the two studied composts, as shown in Figure 1, indicate the percentage of each fraction in the clay (< 2 µm), silt (2–50 µm), sand (50–2000 µm), and skeleton particle (> 2000 µm) size ranges.

The fine particles (clay) were the most abundant fraction in both composts, indicating their high-quality texture and suitability for soil amendment59. Compost C2 showed a slight increase in silt and skeleton particles compared to C1, while both composts exhibited similar sand fractions. The tiniest particle size fraction was found in the skeleton particles. No significant correlation was observed between the physicochemical and microbial parameters of the two studied composts (p > 0.05).

The beneficial effects of compost on soil properties and crop productivity are closely linked to its chemical, physical, and biological characteristics. Recent studies have shown that fine particle fractions generally have lower electrical conductivity (EC) and carbon-to-nitrogen (C/N) ratios but are enriched with essential nutrients, thereby improving soil fertility2. The silt fraction tends to accumulate heavy metals but also contributes to better compost stability and structure60. Although larger particle sizes increase soil aeration and reduce water retention, the fine particles in organic amendments help boost soil organic carbon and enhance soil aggregation, leading to improved soil structure and function49.

Isolation and identification of phytopathogenic fungi

Four fungi (F1, F2, F3, and F4) were isolated from various diseased plants and fruit organs, then identified both morphologically and molecularly.

On PDA medium, the colonies of F1 grew rapidly (within 2 days), displayed a cottony appearance, and ranged in color from white to grey, turning dark grey as sporangia developed (Figure 2). Under the microscope, F1 was characterized by forming a terminal sporangiophore and exhibited the same morphological structure as Syncephalastrum sp. In contrast, the fungal F2 grew slowly on PDA medium, taking up to 7 days at 25 °C. Its colony initially appeared as white, fluffy mycelia and later developed concentric, olivaceous to grey-black sporodochia. These structures are composed of numerous phialides that produce cylindrical, hyaline to slightly olive-green conidia at their tips (Figure 2). All characteristics aligned with the description of Paramyrotheciumsp61.. On PDA, the fungal F3 exhibited thin, aerial, and relatively dense colonies that were pinkish-purple. Microscopic examination of the isolate revealed septate hyphae that were branched and hyaline, along with microconidia and ellipsoid macroconidia. These characteristics were consistent with the morphology of Fusarium sp. Fungal colonies of F4 developed rapidly on PDA media, exhibiting a velvety texture, and had white, young mycelia that turned green-blue with maturation, along with an uncolored reverse. Under the microscope, the fungus appears similar to Penicillium spp. It presented septate hyaline hyphae with branched conidiophores. Cylindrical phialiads produced long chains of small oval conidia. (Figure 2)

Fig. 2
figure 2

Mycelial growth (surface and reverse) of F1 (A1), F2 (B1), F3 (C1), and F4 (D1) on PDA at 25 ºC for 5 days and its microscopic observation (A2, B2, C2, and D2), respectively.

Full size image

Molecular identification of the isolated fungi was assessed using sequencing of the ITS rRNA genes, after submitting the nucleotide sequence to the European Nucleotide Archive, the isolated fungi were assigned accession numbers MZ057792 for Syncephalastrum racemosum (F1), MZ057761 for Paramyrothecium roridum (F2), OL913805 for Fusarium oxysporum (F3), and MZ057729 for Penicillium italicum (F4).

Phylogenetic analyses of sequences from our isolates were aligned with highly similar sequences from GenBank. The distance matrix results showed that S. racemosum isolates are monophyletic, with an average distance of 0.411 and 99.47% identity. Similarly, P. roridum isolates demonstrated a monophyletic relationship with an average distance of 0.560 and 99.83% identity. P. italicum isolates also formed a monophyletic group, with an average distance of 0.695 and 99.60% identity. F. oxysporum isolates had the closest relationship, showing an average distance of 0.231 and 100% identity, further supporting their monophyly.

The neighbor-joining phylogenetic tree (Figure 3), constructed using evolutionary distances, confirmed these results. The ITS rRNA gene sequence alignment showed that isolates within each species are closely related (monophyletic), while relationships between different species tend to be polyphyletic. Notably, S. racemosum, P. italicum, and F. oxysporum isolates cluster tightly within their species. In contrast, some P. roridum isolates exhibit polyphyletic relationships within their species but are monophyletic with S. racemosum (Figure 3).

Fig. 3
figure 3

Phylogenetic analysis of the ITS region derived from the Neighbour-Joining method using MEGA 4.0 software. (Diamond shapes represent our isolates, and the remaining are reference sequences.).

Full size image

Phytopathogenicity test of the studied fungi

The phytopathogenicity test on tomato fruits, detailed in Table 3, showed distinct virulence patterns among four fungal isolates: S. racemosum, P. roridum, F. oxysporum, and P. italicum. All isolates could cause post-harvest decay under controlled conditions. S. racemosum was the most virulent, causing rapid symptoms within 1 day, with extensive soft rot, tissue breakdown, yellowish discoloration, and liquid exudate. It also resulted in the highest weight loss (30.11%) and the largest lesion diameter (4.6 cm). F. oxysporum demonstrated aggressive growth, with white fluffy mycelium covering much of the fruit, along with a 22.05% weight loss, 3.5 cm lesions, and symptoms appearing within 1 day, likely due to Fusarium toxin-induced necrosis62. P. italicum caused moderate decay, with white mold and puncture symptoms around inoculation sites, leading to 15.33% weight loss, 1.2 cm lesions, and a 2-day onset. P. roridum was the least virulent, with symptoms appearing after 3 days, minimal 11.64% weight loss, and small 1.5 cm rot spots with sparse mycelial growth. The susceptibility of these fruits to fungal attack can be linked to the water present in their deeper layers. According to Estrada-Bahena et al.63, the fruit’s organic matrix undergoes dynamic physicochemical changes that are heavily influenced by water availability, its distribution in the tissue, and its mobility. Water activity (aw) is vital for microbial activity and enzyme reactions,fungal growth typically occurs when aw exceeds 0.90. Enzymes like amylases, phenoloxidases, and peroxidases become active at aw levels above 0.85, while lipases can still function even at aw below 0.3.

Table 3 Phytopathogenicity test of studied fungi: S. racemosum, P. roridum, F. oxysporum, and P. italicum on tomato fruit incubated for 7 days at 25 ℃.
Full size table

Effect of non-sterile compost extracts on phytopathogenic fungi

The compost extracts were prepared using a fermentation process with variations in parameters: Temperature (25 and 44 ℃), glucose concentration (0 and 1 g/l), compost concentration (1/5 and 1/8 w/v), and fermentation time (3 and 7 days). Sixteen extracts were obtained for each compost (Table 2). All the extracts were tested for their suppressive effect against the four identified fungi: S. racemosum (F1); P. roridum (F2); F. oxysporum (F3), and P. italicum (F4).

The results were presented as the inhibition percentage (%) of mycelial growth of tested fungi by different fermented compost extracts, which were diluted at 1/2, 1/4, and 1/8 in Table 4 (C1) and Table 5 (C2). Additionally, the results showed that most of the extracts exhibited notable antifungal activity against the four isolated strains, with some fluctuations observed between the different tests. The extracts obtained by fermentation of C2 (Table 5) have a greater inhibitory activity against fungi than those obtained by fermentation of C1 (Table 4). This could be related to the raw material used for compost preparation, the organic compounds, and the diversity of microbial flora of the two composts25. Therefore, the most inhibited fungi were P. roridum > F. oxysporum > P. italicum > S. racemosum. S. racemosum exhibited high resistance to the majority of the extracts. At the same time, it showed complete inhibition (100%) with the extract prepared in test n°6, which was diluted at 1/2 and 1/4. This was also observed in test n°1, where the extract was diluted to 1/2 for compost C1, and in test n°13 for compost C2.

Table 4 The Suppressive effect of compost extracts (C1) used at different dilutions (1/2, 1/4, and 1/8) on phytopathogenic fungi is expressed as the inhibition percentage (%) of fungal mycelium growth.
Full size table
Table 5 Suppressive effect of compost extracts (C2) used at different dilutions (1/2, 1/4, and 1/8) on phytopathogenic fungi expressed as inhibition percentage (%) of fungal mycelium growth.
Full size table

The extracts of compost C1 completely inhibited the fungus P. roridum at a 1/2 dilution for tests 1 and 5 and at a 1/8 dilution for test 2. However, the extracts of compost C2, at a 1/2 dilution, completely inhibited the mycelial growth of P. roridum in tests 1, 2, 4, 6, 9, 10, 11, 13, and 15; F. oxysporum in tests 6 and 9; and P. italicum in tests 1, 4, 6, 7, and 11. At a 1/4 dilution, the C2 extract achieved 100% inhibition of P. roridum in tests 6 and 9, F. oxysporum in test 9, and P. italicum in tests 6 and 9. At a 1/8 dilution, only the C2 extract from test 9 completely inhibited the growth of P. roridum and F. oxysporum.

The results also showed a concentration-dependent antifungal effect of compost extracts C1 and C2. Typically, the highest antifungal activity is seen at the least diluted concentration (1/2), with inhibition percentages decreasing as the extracts become more diluted (1/4 and 1/8). For example, non-sterile C1 extract at 1/2 dilution often achieves 100% inhibition against S. racemosum (F1) and P. roridum (F2), but this drops significantly at 1/4 and even more at 1/8. Similar patterns are observed for extract C2, where a 1/2 dilution generally results in better inhibition than a 1/4 or 1/8 dilution across different fungal strains. This suggests that the active antifungal compounds are most effective when less diluted, requiring higher concentrations to maximize fungicidal or fungistatic effects. Notably, some fungi, such as P. italicum (F4), can still be substantially inhibited even at higher dilutions, indicating different sensitivities among the fungi to these active components.

Physicochemical and microbial analyses of compost extracts

Therefore, physicochemical and microbial analyses were conducted on five samples from each compost extract, C1 (1, 6, 9, 12, and 14) and C2 (9, 10, 11, 13, and 15), both diluted to 1/2. These samples showed the highest antifungal effect (Table 6). The initial composition of the compost serves as a foundational blueprint that significantly influences the final characteristics of its extract. This is evident when comparing composts C1 and C2, and their corresponding extracts. Compost C2, which started with a higher pH, greater mineral content, and larger microbial populations, consistently produced an extract that maintained these elevated characteristics throughout the fermentation process.

Table 6 Physicochemical and microbial characterization of the main compost extracts C1 and C2 diluted to 1/2.
Full size table

Indeed, the C2 extract generally showed a higher pH, greater electrical conductivity (EC) ranging from 0.25 to 0.62 mS/cm, and more microbial counts (TMB, yeast, and molds) compared to the C1 extract, whose EC remained lower (0.10–0.26 mS/cm). However, contrary to expectations, the C1 extract had higher levels of organic matter, indicated by its generally higher COD values. In contrast, the C2 extracts contained greater amounts of TNK and NH₄⁺, suggesting more advanced nitrogen mineralization. The microbial analysis revealed distinct population dynamics: Total mesophilic bacteria were the most abundant and variable group (ranging from 4.86 to 10.38 log ufc/ml), followed by yeasts (5.02 to 7.50 log ufc/ml), while molds were the least numerous but consistently present (4.00 to 6.40 log ufc/ml). These differences highlight how the starting material influences the unique chemical and biological trajectory of the extract. Moreover, fermentation appears to be a dynamic process, causing fluctuations in parameters like pH, EC, and microbial populations over time for both extracts, indicating that the fermentation duration is a key factor in determining the final chemical and microbial properties of the compost extract. The germination index (GI) of the compost extracts varies across samples, ranging from 87.58±1.02% to 135.25±2.02%, reflecting their diverse effectiveness in supporting seed germination, while also demonstrating their dual role in suppressing phytopathogenic fungi and significantly improving agricultural productivity through enhanced soil health, promoted plant growth, and sustainable farming practices.

The bivariate correlation between physicochemical and microbial compost extract parameters and their antifungal activity against phytopathogenic fungi was assessed using the Pearson test and is presented in Table 7. The correlation analysis of compost extracts revealed significant relationships between physicochemical parameters and microbial factors with antifungal activity against the studied fungi: S. racemosum, P. roridum, F. oxysporum, and P. italicum. This suggests that the antifungal potential arises from the combined effects of nutrient availability and diverse microbial communities, rather than solely from organic matter content. Notably, Nitrogen-related parameters (NTK and NH4+) and microbial abundance (TMB, yeasts, and molds) showed strong positive correlations with each other and with activity against all studied fungi (Table 7). This highlights the role of nitrogen availability in promoting antagonistic microbial populations, as supported by research showing that nitrogen dynamics sustain bacterial growth in manure composting systems, enabling them to outcompete fungi64. Phenolic compounds, as bioactive elements, showed a strongly positive and significant correlation with the antifungal effects of S. racemosum (r = 0.868) and P. italicum (r = 0.660), as well as a moderate positive correlation with the antifungal effect of P. roridum (r = 0.416), highlighting their direct inhibitory mechanisms. Findings also suggest that phenolic compounds, such as coumaric, caffeic, and ferulic acids, in compost extracts play a key role in controlling pathogenic fungi through antimicrobial actions65. pH and EC showed moderate positive correlations with antifungal efficacy against P. roridum (r = 0.468 and r = 0.540, respectively) and F. oxysporum (r = 0.472 and r = 0.467), suggesting that slightly alkaline conditions may enhance pathogen suppression by promoting bacterial growth over fungi66. Meanwhile, COD and TOC displayed mixed but often significantly negative correlations with F. oxysporum.

Table 7 Assessment of bivariate correlations between physicochemical and microbial parameters of compost extracts and their antifungal activity against the studied fungi by using Pearson’s Test.
Full size table

In the same context, several studies have shown that the antifungal efficacy of compost extracts is due to their diverse bioactive compounds, including phenolics, organic acids, enzymes, humic and fulvic acids, volatile fatty acids, and plant growth regulators, along with active microbial communities1,67,68. These components operate through multiple mechanisms, including nutrient and space competition, antibiosis, parasitism, and the induction of systemic resistance in host plants1,69. Key microbial genera, including Bacillus, Pseudomonas, Trichoderma, Penicillium, and Streptomyces, produce a wide spectrum of antifungal metabolites such as siderophores, lipopeptides (iturin, fengycin, surfactin), chitinases, proteases, and antibiotics16,17,18,70,71,72. Both aerated (ACTs) and non-aerated compost teas (NCTs) have been shown to suppress a broad range of pathogens, including Fusarium oxysporum, Rhizoctonia solani, Sclerotinia sclerotiorum, Alternaria alternata, Botrytis cinerea, Aspergillus niger, Rhizoctonia solani, Rhizoctonia bataticola, Pythium spp., and Verticillium dahliae 73,28,51,74.

Optimal fermentation conditions of compost extracts

To determine the optimal levels of four variables (temperature, compost concentration, glucose concentration, and fermentation time) that exhibited high suppressive activity of compost extract against the studied fungi, an experimental design analysis was employed to enhance the inhibition percentage of phytopathogenic fungi. The data in Table 8 revealed a significant difference in antifungal efficacy between the two compost extracts. The normality test p-values were consistently low (≤ 0.04 for C1 and ≤ 0.002 for C2) across all fungal species, indicating that the inhibition data do not follow a normal distribution. This suggests that the inhibitory effects are not random but are likely influenced by specific, potent compounds within the extracts. The most important statistical insight comes from comparing the mean inhibition values and their 95% confidence intervals (CI95%). For each fungal pathogen tested, the confidence intervals for C1 and C2 do not overlap, with values higher in C2 extracts compared to C1. The complete separation between these ranges provides strong statistical evidence that the higher mean inhibition observed in C2 is not due to random chance but reflects a genuinely superior and more potent antifungal capability inherent to the C2 extract.

Table 8 Statistical parameters of fungal inhibition by compost extracts C1 and C2.
Full size table

The ANOVA analysis assessing the effects of different preparation variables (temperature, compost concentration, glucose concentration, and fermentation time) on antifungal activity, measured as the growth inhibition percentage of compost extracts C1 and C2 against four fungal pathogens, is summarized in Table 9. For extract C1, fermentation time significantly influenced the growth inhibition of S. racemosum (F = 17.524, p = 0.002), while no variables significantly influenced P. roridum (all p > 0.05) and F. oxysporum (all p > 0.05). However, P. italicum inhibition was significantly dependent on compost concentration (F = 6.872, p = 0.024), glucose concentration (F = 6.491, p = 0.027), and fermentation time (F = 20.278, p = 0.001). For extract C2, fermentation time significantly impacted the growth inhibition of S. racemosum (F = 7.384, p = 0.020) and P. italicum (F = 9.152, p = 0.012), while no variables affected P. roridum and F. oxysporum (all p > 0.05).

Table 9 Tests of between-subjects effects of compost extracts C1 and C2.
Full size table

The fermentation process is crucial in enhancing the antifungal effectiveness of both C1 and C2 extracts, as demonstrated by its consistent and significant impact on inhibiting the growth of S. racemosum and P. italicum across both extracts. The notable p-values for C1 and C2 against these fungi suggest that the length of fermentation likely contributes to the production or activation of bioactive compounds through microbial processes, such as enzymatic breakdown or secondary metabolite formation75. This method appears to be especially effective for these pathogens, likely because specific inhibitory substances accumulate over time. The absence of significant effects on P. roridum and F. oxysporum, despite fermentation affecting other fungi, indicates that the compounds formed through fermentation may be selectively effective, possibly needing adjustments in fermentation conditions or additional strategies to expand their activity spectrum. These results highlight the importance of optimizing fermentation duration as a key factor in preparing compost extracts for targeted antifungal use in agriculture.

Table 10 shows the descriptive statistics, including the mean and standard deviation of growth inhibition for S. racemosum and P. italicum under different conditions (Temperature, Concentration, Glucose, and Time). The results showed that for S. racemosum, the greatest growth inhibition (Mean = 100.00%) occurred with a 1/5 concentration, positive glucose, and a long fermentation time. This suggests that higher concentrations of compost extract, combined with a glucose source and extended fermentation, are highly effective against this fungus. For P. italicum, the highest inhibition (Mean = 100.00%) was observed under two different conditions: both with a 1/8 concentration, negative glucose, and long fermentation time. This suggests that for P. italicum, a lower compost concentration without added glucose is very effective, provided the fermentation time is long. Clearly, long fermentation time is often part of the conditions leading to the highest mean inhibition for both fungi, reinforcing the conclusion from Table 10 that fermentation time is a key factor.

Table 10 Descriptive statistics of dependent variable S. racemosum (F1) and P. italicum (F4).
Full size table

Table 11 presents the regression equations that describe the percentage of fungal inhibition in relation to the experimental parameters. A high R2 value indicates that the model accurately fits the data. The models for P. italicum (R2 = 0.774 for C1) and S. racemosum (R2 = 0.633 for C1) have the strongest fit, meaning the equations are fairly reliable predictors of inhibition for these fungi under the C1 compost extract conditions. The other models have lower R2 values, which suggests they are less effective as predictors.

Table 11 Modeling equations of fungal inhibition percentage obtained by experimental design analysis.
Full size table

Among the models presented, those for P. italicum and S. racemosum under compost extract C1 serve as the most reliable predictors. Analyzing their respective equations reveals which factors most significantly impact fungal inhibition. For P. italicum, the equation I (%) = 0.978 T + 24.528 CC + 23.838 G - 10.533 FT + 13.428 indicates that compost concentration (CC) and glucose (G) have the most significant positive coefficients, making them the most influential factors for increasing inhibition. In contrast, for S. racemosum, the equation I (%) = 0.741 T + 6.92 CC + 1.46 G + 13.64 FT + 68.22 identifies fermentation time (FT) as the most critical factor due to its significant positive coefficient. Overall, the data consistently show that fermentation time is the most influential parameter in enhancing the antifungal efficacy of compost extracts C1 and C2, especially against S. racemosum and P. italicum. While temperature appears to have no significant effect, certain combinations of compost concentration and glucose also play a role, particularly for P. italicum with extract C1. The descriptive statistics further emphasize that longer fermentation, combined with optimized concentrations and glucose levels, results in the highest inhibition percentages. Regression models support these conclusions, offering predictive equations that highlight the critical role of fermentation time, compost concentration, and glucose in inhibiting fungal growth.

Effect of sterile compost extracts on phytopathogenic fungi

To assess the sterilization effect of compost extracts on phytopathogenic fungi, selected extracts from C1 and C2, known for their strong antifungal activity, were sterilized using both autoclaving (121 ℃ for 20 minutes) and filtration methods.

Table 12 carefully describes how sterilization methods affect the antifungal activity of compost extracts C1 and C2, providing essential insights into their active compounds and the influence of microbial diversity. The non-sterile extracts consistently show the highest inhibition, such as 100% against S. racemosum (C1, dilution 1/2, Test 1, 6) and P. roridum (C1, dilution 1/2, Test 1, 6), and 95.19% against P. italicum (C1, dilution 1/2, Test 6). When autoclaved, which kills microbes and destroys heat-sensitive compounds, the antifungal activity drops significantly, often to 0.00% inhibition for S. racemosum and P. italicum, suggesting that many of the active components are heat-sensitive and likely microbially produced. Conversely, filtration, which removes microbes but retains heat-stable compounds, still yields some antifungal activity, generally lower than in non-sterile extracts. For example, C1 extract at dilution 1/2, after filtration, still inhibited P. roridum by 41.42% (Test 1) and P. italicum by 74.48% (Test 14), indicating the presence of heat-stable, soluble antifungal compounds that do not rely on live microbes. This variation in response to sterilization highlights the complexity of the antifungal mechanisms in compost extracts, which seem to depend on interactions between the live microbial community and its stable secondary metabolites, with the microbial portion playing a key role in achieving the most potent inhibition. Past studies support this, showing that sterilization methods such as autoclaving and microfiltration significantly disrupt the active microbial populations in compost extracts, thereby considerably reducing their disease-suppressing abilities9,76. Importantly, non-sterilized extracts retain vigorous biocontrol activity, whereas sterilized ones lose their capacity to induce systemic resistance77,78.

Table 12 Sterilization effect (by autoclave and filtration) of compost extracts (C1 and C2) against fungal growth.
Full size table

Conclusion

Effective control of fungal plant diseases remains a major challenge, requiring sustainable and environmentally friendly alternatives to harmful agrochemicals. Among these strategies, the use of compost extracts has emerged as a promising method for maintaining plant health and productivity. In this study, compost extracts produced through a fermentation process involving four variables at two levels showed strong antifungal activity against four phytopathogenic fungi, identified morphologically and molecularly as S. racemosum (F1), P. roridum (F2), F. oxysporum (F3), and P. italicum (F4). The inhibitory effects of the extracts varied depending on the compost source, fermentation conditions, and dilution levels. Compost C2 consistently outperformed Compost C1, likely due to its more favorable physicochemical profile, higher pH, electrical conductivity, and nitrogen content, as well as a more diverse microbial community. Statistical analysis confirmed that fermentation time was the most crucial factor for increasing antifungal effectiveness, especially against S. racemosum and P. italicum, while temperature had no significant impact. Compost concentration and glucose addition also played a role, particularly in enhancing inhibition of P. italicum. Pearson correlation results identified nitrogen-related parameters (NTK, NH₄⁺), microbial abundance, and phenolic content as key factors in pathogen suppression, highlighting the combined importance of nutrient availability and microbial activity. Sterilization tests further showed that disease suppression results from the combined effects of active microbial communities and their heat-stable metabolites. Non-sterilized extracts consistently exhibited the most potent inhibition, while autoclaving removed activity, and filtration only partially preserved efficacy. These results highlight the crucial role of microbial activity in achieving maximum suppression, with secondary metabolites exerting residual effects. Future research focusing on microbial species and their bioactive compounds could offer deeper insights into the mechanisms behind antifungal activity, aiding in the identification of effective microbial consortia or metabolites for sustainable disease control.