Introduction

Recurrent pregnancy loss (RPL) refers to the miscarriage of two or more clinically recognized pregnancies before 20–24 weeks, including both early embryonic and fetal demise. This condition affects 2.5% of women trying to conceive, and in 50–70% of couples, no obvious risk factors are identified to explain RPL1. A UK prospective cohort study found that a history of RPL significantly heightened the risk of metabolic syndromes, including abdominal obesity, hypertriglyceridemia, low HDL cholesterol levels, and hyperglycemia2. Metabolic syndrome (MetS), a cluster of metabolic dysregulations such as insulin resistance, atherogenic dyslipidaemia, and central obesity, may have a causal relationship with RPL.

Insulin resistance (IR) is closely related to RPL, and the mechanism leading to RPL is complex and involves multiple physiological processes. IR may cause miscarriage by affecting the activity of plasminogen activator (PA) inhibitors. PA inhibitors cause hypercoagulation at the maternal-fetal interface (impaired fibrinolysis) and increase levels of inflammatory cytokines, which in turn lead to placental insufficiency and increase the risk of miscarriage3. IR may cause the fetal environment to present a diabetic-like state. In the first trimester, high levels of insulin increase the transport of glucose by the cellular trophoblast by upregulating the glucose transport system4. This abnormal fetal environment can have adverse effects on fetal development, leading to miscarriage; insulin resistance can also affect the embryo implantation process.IR may disrupt vascular function during pregnancy, affecting the blood supply to the uterus and placenta, leading to embryonic dysplasia or miscarriage. In a normal pregnancy, the normal development and function of the placenta depends on good vascular function, and IR may interfere with this process. IR is associated with abnormal lymphocyte subsets in patients with RPL. Elevated TG levels in patients with IR are positively correlated with an increase in the ratio of CD3+CD4+/CD3+CD8+, which is correlated with a decrease in insulin sensitivity. This suggests that IR may interfere with the normal course of pregnancy by affecting the immune response, leading to miscarriage5.

Although metformin and pioglitazone are commonly used to treat insulin resistance, they have a high incidence of adverse effects6.TCM intervention for repeated pregnancy loss is widely used in certain developing countries, enjoys patient popularity, and has yielded satisfactory clinical results.

Using machine learning analysis data to absorb and evaluate a large amount of complex healthcare data provides considerable advantages7. High-quality data mining of traditional Chinese medicine is crucial for medical experience and new drug development8. We identified three core prescriptions for recurrent pregnancy loss (RPL) from clinical records, with the CGKYR frequently used pre-pregnancy to enhance insulin. Research shows that Kudzu in CGKYR can regulate glucose and lipid metabolism, and reduce adipocyte insulin resistance by inhibiting endoplasmic reticulum stress9. The formula containing Bupleurum can improve insulin resistance and sugar metabolism10. Atractylodes macrocephala Koidz. extract relieves insulin resistance via PI3K/Akt signalling in diabetic Drosophila11. Therefore, Using UHPLC-MS/MS analysis, network pharmacology, and in vitro experiments, we investigated CGKYR’s mechanism in preventing and controlling insulin resistance in RPL patients. The study’s main contributions are as follows.

Materials and methods

Summary the medication rules of preventing and treating RPL by R Language data mining

This study was approved by the Ethics Committee of Changzhou Hospital Affiliated to Nanjing University of Chinese Medicine [(2023-LL-006(LW)]. We collected 177 successful TCM intervention cases for repeated pregnancy loss, resulting in 640 TCM prescriptions. Using “tidyverse,” “arules,” “cluster,” and “Cluster” in RStudio version 4.3.0 on Windows 11, we analyzed drug frequency, association rules, and cluster analysis results, and visualized them. We chose to use the top 20 herbal medicines in frequency for association rule analysis, setting support to 10% and confidence level to 80%. These were hierarchically clustered based on association rule results. Data mining in RStudio version 4.3.0 summarized medication rules. Cluster analysis of high-frequency drugs, performed using the cluster package, grouped them into three core drug groups (Fig. 1). We identified the core drug combination CGKYR based on human experience.

Fig. 1
Fig. 1
Full size image

Medication rules of 640 prescriptions of traditional Chinese medicine.

Identify the components of CGKYR by UPLC-QTOF-MS

UHPLC-MS/MS analysis of CGKYR was performed using a Vanquish UHPLC System (Thermo Fisher Scientific, USA) with an ACQUITY UPLC® HSS T3 column (2.1 × 100 mm, 1.8 μm; Waters, Milford, MA, USA) maintained at 40 °C. The lyophilised CGKYR powder was accurately weighed into a 2 mL centrifuge tube, mixed with 600 µL MeOH containing 2-Amino-3-(2-chloro-phenyl)-propionic acid (4 ppm), vortexed, ground, ultrasonicated, and centrifuged. The supernatant was filtered and transferred for LC-MS detection. The flow rate and injection volume were 0.3 mL/min and 2 µL, respectively. For LC-ESI (+)-MS analysis, the mobile phases were (B2) 0.1% formic acid in acetonitrile (v/v) and (A2) 0.1% formic acid in water (v/v), with a gradient of 8–98% B2 over 10 min. For LC-ESI (–)-MS analysis, the mobile phases were (B3) acetonitrile and (A3) 5 mM ammonium formate, with a similar gradient of 8–98% B3 over 10 min12. Mass spectrometry-based metabolite analysis was performed using an Orbitrap Exploris 120 (Thermo Fisher Scientific) with an ESI ion source. The acquisition method combined MS1 and MS/MS in Full MS-ddMS2 mode. Instrumental settings were: sheath gas pressure, 40 arb; auxiliary gas flow, 10 arb; spray voltage, 3.50 kV for ESI(+) and − 2.50 kV for ESI(−); capillary temperature, 325 °C. The MS1 range was m/z 100 to 1000 with a 60,000 FWHM resolving power. Four data-dependent scans per cycle were conducted, with MS/MS resolving power at 15,000 FWHM. Normalized collision energy was 30%, and dynamic exclusion time was automatically controlled13. The compound structures were identified by Suzhou Panomik Biomedical Technology Co., Ltd.

Network Pharmacology

Collect the therapeutic targets for CGKYR

This research utilizes the TCM Network Pharmacology Analysis System (TCMNPAS), independently developed by Prof. Yang Ming at Longhua Hospital, Shanghai University of Traditional Chinese Medicine. The system comprises HIT (Herbal Ingredient’s Targets Platform), TCMID (Traditional Chinese Medicines Integrated Database), TCMSP (Traditional Chinese Medicine Systems Pharmacology Database), STITCH, and CUSTOM14,15,16. The chemical composition retrieval module was executed with 11 CGKYR herbs, using QED = 0.2, a drug-target correlation threshold of 400, and compound target significance P = 0.05.

Acquisition of the disease targets

The keywords “recurrent pregnancy loss” and “insulin resistance” were entered into the GeneCards database (https://www.genecards.org/)to search and evaluate relevant disease targets. Targets with a Relevance score < 10 for RPL and IR are removed. Excess targets were then removed and merged. Draw Venn Diagram (https://bioinfogp.cnb.csic.es/tools/venny/) was used to visualize the intersecting targets between CGKYR and RSA with IR.

Protein-protein interaction (PPI) network construction and target selection

The above intersection targets were imported into the String database (https://cn.string-db.org/) with a confidence score threshold > 0.7 and abnormal targets were removed). Analysis of these interactions was limited to the ‘Homo sapiens’ species. The PPI network TSV files were visualised in Cytoscape 3.7.2, to identify the core targets when screened thrice.

Target enrichment analysis using GO and KEGG

Common target data were imported into the DAVID database (https://david.ncifcrf.gov/) for gene list analysis in H. sapiens. Functional annotation was performed using GO enrichment and KEGG pathway analysis with screening qualifiers of p < 0.05 and FDR < 0.05, to identify biologically significant processes related to diseases. The top 20 KEGG pathways were chosen based on the top 25 targets identified through protein-protein interaction analysis. A network diagram was created to illustrate the relationship between targets and pathways using the microbirth credit website (https://bioinformatics.com.cn/bioinformatics_data_analysis_services).

Verification of molecular docking

To assess the connection between the target and compound, we used molecular docking with compounds containing the most relevant critical genes and shared core genes. In the PyMOL software, water molecules and organic compounds were substituted with hydrogen atoms in the target protein model. The modified structure was then imported into AutoDockTools 1.5.7 for receptor preparation and subsequently saved as a pdbqt file17. Molecular docking was carried out using AutoDockTools 1.5.7, and the docking results were visualized using Pymol18.

Experimental verification

Isolation of human primary decidual stromal cells

This study was approved by the Ethics Committee of Changzhou Hospital Affiliated to Nanjing University of Chinese Medicine [(2023-LL-006(LW)] and the First Hospital of Jiujiang City [JJSDYRMYY-YXLL-2024-016].Informed consent was obtained from all patients included in the study. Tissue samples were collected from three patients aged 25–35 years with insulin resistance and histories of over two pregnancy losses, with no drug treatment or cases of chromosomal abnormalities or immune-related factors. Samples were placed into 15 mL Falcon tubes with DMEM/F12 (KGM, KGM12500-500) and transported to the lab at 4 °C within 2 h. After centrifugation at 1000 rpm for 5 min, the supernatant was discarded, and pellets were transferred to Petri dishes (NEST, China) with DMEM/F12 and 10% antibiotic-antimycotic solution. Tissues were cut into small pieces and digested with 0.5 mg/mL collagenase I (Sigma-Aldrich) for 1 h at 37 °C and 5% CO2. Post-digestion, cells were centrifuged at 1000 rpm for 5 min, pellets resuspended in DMEM/F12with 10% FBS (Bio-channel, BC-SE-FBS01) and 1% penicillin-streptomycin (Beyotime, C0222), and plated into 60 mm Petri dishes (NEST, China). The medium was changed daily to remove non-adherent cells, and cells were passaged upon reaching confluence to establish a homogeneous adherent cell culture.

HDSC culture conditions and identification

HDSC cultures were cultivated in DMEM/F12 (KGM, KGM12500-500 ) supplemented with 10% FBS (Bio-channel, BC-SE-FBS01) and 1% penicillin-streptomycin (Beyotime, C0222) at 37 °C in a humidified incubator under 5% CO2. Cells were passaged when they reached 80–90% confluence, and plated at a density of 50 × 104 cells/dish. The third generation cells were tested and the cells were identified. Cellular immunofluorescence staining was performed with the marker keratin Cytokeratin19 (Proteintech, 10712-1-AP) and the epithelial molecule vimentin (Proteintech, 10366-1-AP) in HDSCs. Negative keratin staining and positive vimentin staining were observed in stromal cells, and the positive rate was > 95%. For IF, as previously stated19, cells were cultured in 6-well plates, which had placed round glass coverslips in advance, fixed with 4% paraformaldehyde (Beyotime, P0098) for 10 min, and permeabilized in Immunostaining Permeabilization Buffer with Triton X-100 (Beyotime, P0096) for 10 min at room temperature. After blocking with QuickBlock™ Blocking Buffer (Beyotime, P0102) for 60 min at room temperature, The cells were subsequently exposed to primary antibodies, diluted in a universal diluent (NCM, WB100D), and incubated at 4°C overnight. Post-incubation, after washed with 1× Immunofluorescence Washing Buffer (diluted from 10× Washing Buffer (Beyotime, P0106 C), cells were stained with fluorescently labeled secondary antibodies for 1 h at room temperature. Coverslips were mounted with Antifade Mounting Medium with DAPI (Beyotime, P0131). Imaging was performed with an inverted fluorescence microscope (Zeiss Axio Vert. A1). Identification of human primary decidual stromal cells is shown in Fig. 2.

Fig. 2
Fig. 2
Full size image

Immunofluorescent identification of human primary decidual stromal cells.

Preparation and quality assurance of CGKYR

The CGKYR herbs, obtained from Changzhou Hospital Affiliated to Nanjing University of Chinese Medicine in Changzhou, China, were boiled in distilled water (1:10 ratio) at 100 °C for 40 min, using a total of 136 g of herbs20. The solution was filtered through two layers of gauze and concentrated by rotary evaporation at 60 °C. It was then frozen at − 80 °C overnight, yielding 0.26 g g−1 powder after vacuum freeze-drying. The lyophilized powder’s weight was determined by dividing the physical liquor’s weight by the original herbs’ weight. Two grams of freeze-dried powder were dissolved in 40 mL PBS at 80 °C for 30 min, centrifuged at 1000 rpm for three 10 min cycles, and the supernatant filtered through a 0.22 μm membrane. The powder was concentrated at 100 µg/mL in the physical liquor and stored at − 20 °C for long-term preservation before extraction at the designated location21.

Cell viability assay

A cell suspension with a final density of 5 × 104 cells/mL was seeded into each well of a 96-well plate, with 100 µL of the suspension containing 5000 cells per well. The cells incubated for 24 h. Blank controls with only the complete medium were established. Cells were treated with varying concentrations of CGKYR for 24 h. After removing the medium, a culture solution containing the CCK-8 reagent was added and incubated at 37℃ for 1–4 h. Absorbance values were measured at 450 nm using a multi-functional microplate reader (Valley Molecular Instruments, USA), with three replicates per group and three replications. Cell viability was calculated, and data analysis was performed using GraphPad Prism 8.0.0 software.

5 × 103 HDSCs were seeded in 96-well plates during logarithmic growth and exposed to CGKYR concentrations (0–1000 µg/mL) at 37 °C for 24 h. After incubation, 10 µL of Cell Counting Kit-8 (APEXBIO, K1018) reagent was added and incubated at 37 °C for 1 h. Absorbance was read at 450 nm with a microplate reader.

Real-time qPCR

Total RNA was isolated from decidual tissue using Trizol reagent, followed by reverse transcription into cDNA using ALL-in-one RT superMIx for qPCR (SPARK, AG0305-B), in accordance with the manufacturer’s guidelines. Quantitative real-time PCR was performed utilizing × 2xSYBR Green qPCR Mix (SPARK, AH0104-B) on the LightCycler® 96 System (Roche, Basel, Switzerland). GAPDH served as the internal control gene for all reactions, and gene expression levels were quantified using the 7500PCR analysis software. ΔΔCt method, expressed as 2^(ΔCt experimental–ΔCt control) = 2^–ΔΔCt. The RT-PCR was performed with primers sequence. GAPDH, (5′ to 3′ F: GCAAAGTGGAGAT TGTTGCCAT; 5′ to 3′ R: CCTTGACTGTGCCGTTGAATTT), IL-6 (5′ to 3′ F: GATGGCTGAAAAAGATGGATGC, 5′ to 3′ R: CTGCAGGAACTGGATCAGGACT), SanGon, China.

Statistical methods

Statistical analyses were conducted using GraphPad Prism 8.0. An independent samples t-test evaluated differences between two groups, and one-way ANOVA assessed variations among multiple groups. Data are expressed as mean ± standard deviation (SD), with statistical significance established.

Results

Identify the components of CGKYR by UPLC-QTOF-MS

UPLC-QTOF-MS analysis of CGKYR in positive and negative ionisation modes identified its main components, which were compared with literature data. Figure 3 presents the total ion chromatograms (TICs) of the CGKYR extract, and Table 1 summarises the principal component identification results.

Fig. 3
Fig. 3
Full size image

TICs of extract of CGKYR. (A) UHPLC-MS/MS basic peak ion flow map (BPC)-negative ion model of CGKYR. (B) UHPLC-MS/MS basic peak ion flow map (BPC) positive ion model of CGKYR.

Table 1 The results of the principal component identification for CGKYR.
Full size table

Network Pharmacology

The potential therapeutic targets associated with CGKYR and the concomitant occurrence of RPL and IR

The TCMNPAS database identified 13 active compounds in BS, 57 in BX, 5 in CZ, 83 in CH, 15 in Polygonum multiflorum, 56 in DS, 5 in GG, 54 in HQ, 22 in RG, 69 in SJ, 3 in ZX, and 7 in ZK. After removing duplicates, 60 overlapping active compounds were found. Potential target prediction identified 762 unique gene targets from CGKYR. A comprehensive search yielded 680 deduplicated RPL$ IR-related genes (Fig. 4).

Fig. 4
Fig. 4
Full size image

The drugs-chemical components-potential targets network. CGKYR, CH chaihu, HQ huangqin, ZK zhike, GG gegen, DS dangshen, SJ shengjiang, CZ cangzhu, BS baishao, BX banxia, RG rougui, ZX zexie. Red shapes represent the prescription; yellow shapes represent the name of 11 drugs; The circle around each traditional Chinese medicine represents its chemical composition, the circle around CGKYR represents common chemical components of more than two traditional Chinese herbs, and the outermost circle represents all the gene targets of CGKYR.

Network analysis of CGKYR in the treatment of RPL with IR

The 197 chemical components and 762 potential targets of CGKYR were imported into the Cytoscape software and STRING database to construct the drug–chemical component–potential target network (Fig. 3) and the PPI network. A total of 179 genes were shared after removing the repetitions in both CGKYR and RPL$IR. The top10 gene targets were imported into the STRING database to construct a PPI network (Fig. 5).

Research has shown that puerarin, a component of CGKYR, mitigates obesity-related inflammation and lipid disorders by modulating macrophages and TNF-alpha in obese mouse models. Furthermore, puerarin demonstrates anti-inflammatory properties by suppressing the JNK and IKKβ/NF-kappa B signaling pathways, resulting in decreased levels of TNF-α and IL-69,33. Quercetin can reduce fasting insulin (INS), exert its hypoglycemic effect, and relieve insulin resistance34. Puerarin reduced LPS-induced AKT1 phosphorylation, and the AKT activator SC79 reversed the anti-inflammatory effects of puerarin by activating the AKT1 signaling pathway35. Puerarin alleviates oxidative stress and iron overload by modulating the JAK2/STAT3 pathway36.

Fig. 5
Fig. 5
Full size image

The top10 hub gene targets in PPI. IL6 Interleukin-6, AKT1 RAC-alpha serine/threonine-protein kinase, FN1 Fibronectin, BCL2 Apoptosis regulator Bcl-2, TP53 Cellular tumor antigen p53, INS Insulin, STAT3 Signal transducer and activator of transcription 3, IL1B Interleukin-1 beta, EGFR Epidermal growth factor receptor.

GO and KEGG signaling pathways of CGKYR and RPL with IR

Drug-disease target intersections of CGKYR and RPL with IR were analysed through GO enrichment and KEGG pathway analysis37,38,39, using correlation greater than 102,202 recurrent pregnancy loss genes from Gene Cards. Out of 1036 disease targets from insulin resistance genes, 680 intersecting disease genes were identified (Fig. 6A). These were intersected with 762 drug targets, resulting in 179 intersecting targets (Fig. 6B). GO and KEGG pathway enrichment analyses were performed on potential action targets. These targets were imported into Metascape with the species and background set as “Homo sapiens”. The top 10 cellular components (CC), biological processes (BP), molecular functions (MF), and p-values were selected. Cellular components included vesicle lumen, membrane raft, membrane microdomains, secretory granule lumen, cytoplasmic vesicle lumen, plasma membrane raft, blood particles, and the endoplasmic reticulum cavity. Biological processes involved drugs, peptide hormones, nutrient levels, reactive oxygen metabolism, bacterial-derived molecules, lipopolysaccharides, oxidative stress, cellular response to chemical stress, aging, and response to peptides. Molecular functions included signal receptor activator activity, receptor ligand activity, hormone activity, cytokine receptor binding, haeme, tetrapyrrole binding, drug binding, NADP binding, G protein-coupled receptor binding, and antioxidant activity (Fig. 6C). Comprehensive GO enrichment analysis showed that potential targets of CGKYR were correlated with RPL with IR at the GO level. KEGG pathway enrichment analysis Top10 included lipids and atherosclerosis, AGE-RAGE signalling in diabetic complications, prostate cancer, endocrine resistance, Kaposi sarcoma-associated herpesvirus infection, hepatitis B, human cytomegalovirus infection, HIF-1 signalling pathway, bladder cancer, and colorectal cancer (Fig. 6D).After literature studies, we focused on the endocrine resistance pathway.IL-6 is closely related to the endocrine resistance pathway, because insulin can participate in the decidua process of endometrial stromal cells through the PI3K pathway. Overproliferation of the endometrium leads to obstruction of the decidualization process, which can damage the migration and invasion of trophoblast cells. It is one of the reasons for early embryonic dysplasia and increased risk of miscarriage40,41. Due to the occurrence of insulin resistance, large glucose intake leads to increased insulin demand, and low levels of IL-6 and other inflammatory mediators are produced through self-stimulation. There is growing evidence that chronic low-grade inflammatory responses play a role in the pathogenesis of insulin resistance5,42,43,44,45,46.

Fig. 6
Fig. 6
Full size image

GO enrichment and KEGG pathway analysis.

Molecular docking

After literature studies, we focused on the endocrine resistance pathway. IL-6 is closely related to the endocrine resistance pathway. The binding ability of CGKYR’s key active components to the IL-6 protein was assessed via molecular docking. We extracted the chemical constituents of IL-6 in CGKYR formula through the network diagram of traditional Chinese medicine-component-target (Supplementary 1), and identified quercetin, baicalein, Atractyloid I and puerarin as key compounds through literature review. Interaction energy between each ligand and its receptor was evaluated through molecular docking, as shown in Table 2; Fig. 7. The results indicated that the core ligands identified via network pharmacology exhibited strong binding affinities for the protein receptors related to the core genes.

Fig. 7
Fig. 7
Full size image

Molecular docking between the active ingredient (ligand) of CGKYR and targets (receptors). (A) The binding effect of atractylenolide I and IL-6. (B) The binding effect of Baicalein and IL-6. (C) The binding effect of quercetin and IL-6. (D) The binding effect of Puerarin and IL-6.

Table 2 Interaction between the compounds and the protein targets.
Full size table

CGKYR promoted the expression of IL-6mRNA in HDSC cells

The cells were incubated in fresh complete culture medium containing CGKYR (0–1000 µg/mL) once for 24 h, then we used a CCK-8 assay to determine HDSCs viability. CGKYR (0 µg/mL) was as the blank control group. As shown in Fig. 6a, the CCK-8 assay indicated that CGKYR was not cytotoxic to HDSCs at concentrations. Furthermore, CGKYR significantly increased the viability of DSC cells, and the EC50 was 16.02 µg/mL, promoted the expression of IL-6 mRNA and was superior to the pioglitazone group. The difference was statistically significant (Fig. 8).

Fig. 8
Fig. 8
Full size image

CGKYR ameliorates HDSCs cell proliferation. (A) Effect of different doses on the proliferation of HDSCs. (B) The CGKYR EC50 value. (C) Different volume CGKYR HDSCs IL-6mRNA expression. C normal early pregnancy induced abortion group. M recurrent abortion with insulin group (without medication), CGKYR-L 5 µg/ml group; CGKYR-M 15 µg/ml group, CGKYR-H 50 µg/ml group. The results are shown as the mean ± SD. ****p < 0.001, compared with the control group .

Discussion

Studies have shown that insulin can participate in the decidualization process of endometrial stromal cells through the PI3K pathway. Excessive proliferation of the endometrium can hinder the decidualization process, damaging the migration and invasion of trophoblast cells, which is one of the reasons leading to poor early embryonic development and increasing the risk of miscarriage40,41. As insulin resistance develops, excessive glucose intake leads to an increased demand for insulin, which in turn stimulates the production of low levels of inflammatory mediators such as IL-6. An increasing body of evidence suggests that chronic low-grade inflammation plays a role in the pathogenesis of insulin resistance5,42,43,44,45,46. IL-6 and interleukin 6 receptor (IL-6R) complexes, in which receptor subunit glycoprotein 130 (GP130) binds, thereby initiating the STAT pathway, signaling from IL-6 by activating the transcription factor STAT3, since STAT3 is an IL-6-dependent intranuclear transcription factor; while IL-6 activation STAT3 in endometrial stromal cells maintains endometrial receptivity by inhibiting excessive estrogen response and cell proliferation in the uterus during the periimplantation period, once the level of STAT3-dependent IL-6 in endometrial stromal cells decreases, inhibiting STAT3 activation thereby inhibiting the decidualization process induces a decrease in endometrial receptivity; IL-6 and phosphorylated STAT3 (p-STAT3) levels decrease by inhibiting endometrial stromal cell proliferation and decidualization, resulting in Decreased endometrial receptivity; Studies have shown that p-STAT3 levels are observed in various cell types and tissues of women with recurrent abortion, resulting in decreased endometrial receptivity, but the mechanism remains to be deepened47,48,49.

The relationship between recurrent abortion and IL-6 has received extensive attention in recent years. IL-6 is a pleiotropic cytokine that plays an important role in immune regulation, inflammatory response, cell proliferation and differentiation. It plays a key role in the immune microenvironment at the maternal-fetal interface, and abnormal expression levels may be closely related to the occurrence of recurrent abortion50. IL-6 plays a dual role in recurrent abortion, both participating in embryo implantation and placental development, and may lead to abortion through immune imbalance and inflammatory response. IL-6 can promote the differentiation of Th17 cells, which secrete pro-inflammatory factors such as IL-17 and participate in the inflammatory response51; IL-6 can also inhibit the function of Treg cells (regulatory T cells), which are essential for maintaining maternal-fetal immune tolerance; IL-6 is an important pro-inflammatory factor, which can activate inflammatory signaling pathways, resulting in local or systemic inflammatory responses; moderate IL-6 contributes to trophoblast invasion and angiogenesis. Abnormal levels of IL-6 may increase the risk of miscarriage52.

Studies have shown that the lack of IL-6 expression in the endometrium of mice decreases the check point of embryo implantation. During the secretory period, especially the embryo implantation window period, the concentration of IL-6 secreted in the endometrium and decidua stromal cells is the highest and the immune activity is enhanced. Clinical studies have shown that recurrent abortion Insufficient IL-6 in the endometrium/decidua can lead to fetal loss53,54,55,56,57,58. This is consistent with our findings. IL-6, as a Th2-type cytokine and multifunctional cytokine, plays a key role in inflammatory response and directing T cell differentiation in adaptive immunity, and can down-regulate cell-mediated immune response, inhibit maternal rejection, and play an important role in the proliferation, invasion and differentiation of trophoblast cells and the formation of placental blood vessels, especially closely related to the success rate of embryo implantation and early fetal development59,60. The above studies all show that IL-6 plays an important role in maintaining pregnancy in the first trimester.

Data from several studies suggest that recurrent abortion is closely associated with insulin resistance4,61,62. Metformin and pioglitazone are commonly prescribed for insulin resistance and type 2 diabetes58,63,64, although it has been used clinically for decades and the gut is the site of important adverse effects during metformin therapy, which often completely limits the dose or use of metformin65. Chinese herbal therapy is widely used due to few side effects and cheap price. Additional treatment modalities are provided for patients with insulin resistance refractory to metformin or pioglitazone drugs.

In this study, by collecting clinical data of real-world successful cases in hospitals, clustering analysis and summarizing core prescription-CGKYR.We found that Reduced expression of IL-6 mRNA in DSCs of women with recurrent miscarriage, it is consistent with previous reports56. We preliminarily identified the active components of CGKYR, network pharmacology and in vitro experiments have verified that CGKYR can promoted the expression of DSCs IL-6 in RPL patients with IR.

Modern pharmacological studies have shown that many traditional Chinese medicines in CGKYR formula have the effect of improving insulin resistance, such as saikosaponin A in Bupleurum can improve the IR state of mice66. The puerarin contained in pueraria can increase glucose tolerance and glucose uptake, improve insulin resistance and protect pancreatic islet β cells, and puerarin has a significant promotion effect on liver mitochondrial function, which can reduce steatosis and metabolic disorders caused by high fat and high sugar9,33,67,68,69. Comparative Study of Dietary Flavonoids with Different Structures as α-Glucosidase Inhibitors and Insulin Sensitizers70,71,72,73. Quercetin may play a role in the management of metabolic disorders through different mechanisms, such as increasing adiponectin, decreasing leptin, antioxidant activity, decreasing insulin resistance, increasing insulin levels, and blocking calcium channels; and may improve IR in mice on a high-fat diet and restore the gut microbiome34,74,75,76.

However, many shortcomings still exist in our study. For example, with 680 gene targets in many KEGG signaling pathways, we cannot carry out all the studies. Secondly, much manpower and effort were spent in collecting clinical data, and due to time constraints. Our study has limitations, including the need to further explore how CGKYR activates IL-6 and its potential effects on other molecular signaling pathways. The clinical relevance of these mechanisms is unknown, and further research is needed.

Conclusions

In this study, We analyzed 177 recurrent abortion cases treated with traditional Chinese medicine and 640 prescriptions using RStudio 4.3.0 to summary medication rules. Using UHPLC-MS/MS to identify the key core prescription-CGKYR, network pharmacology techniques were employed to conduct a thorough analysis of CGKYR, identify its likely molecular targets, and provide an initial understanding of its mechanism in addressing RPL associated with IR. Additionally, the protective effects of CGKYR on DSC injury were confirmed. This methodology plays a crucial role in advancing the understanding of CGKYR’s potential in treating IR-related RPL. However, it is important to note that the findings presented are based solely on network-based predictions and preliminary experiments. Further experimental validation is required to confirm the analysis outcomes.