Abstract
Breast cancer (BC) remains the leading cause of cancer-related mortality among women worldwide, with triple-negative breast cancer (TNBC) exhibiting the poorest prognosis. GTPBP2, a member of the G protein superfamily, has primarily been studied in the context of human genetics, with no reported research on its role in BC. This study aims to explore the effects of GTPBP2 on proliferation, migration, and invasion in TNBC, as well as to elucidate its underlying mechanisms. In this study, GTPBP2 expression was analyzed using multiple breast cancer-related databases. Western blotting was employed to validate the protein expression of GTPBP2 and its potential mechanisms in human breast cancer. Additionally, lentiviral infection was used to alter GTPBP2 expression in TNBC cells, and the effects on cancer cell proliferation, migration, and invasion were assessed in vitro using CCK-8 assays, colony formation assays, wound-healing assays, and Transwell invasion analyses. To further evaluate the role of GTPBP2 in vivo, xenograft tumors were established in female B-NDG mice to study tumor occurrence and progression. GTPBP2 is significantly upregulated in TNBC tissues and plays a critical role in promoting the malignant progression of breast cancer by positively regulating key pathways associated with tumor growth and metastasis.
Similar content being viewed by others
Introduction
Breast cancer is one of the most prevalent malignancies affecting women worldwide1,2, characterized by the uncontrolled growth of cells within breast tissue. Based on the expression status of estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor 2 (HER2), breast cancer is classified into four main subtypes2: Luminal A, Luminal B, HER2-enriched, and triple-negative breast cancer (TNBC). Among these, TNBC accounts for approximately 10–20% of all breast cancer cases and is distinguished by its poor prognosis and high recurrence rates3. TNBC is an aggressive subtype defined by the lack of expression of ER, PR, and HER2, making it unresponsive to targeted hormonal or HER2-directed therapies. This absence of key therapeutic targets has rendered TNBC treatment particularly challenging4. Historically, treatment options for TNBC have primarily involved chemotherapy and surgery. However, with advances in medicine and biotechnology, modern approaches now include targeted therapies and immunotherapies5,6. These innovations have marked a shift toward more precise and individualized treatment strategies. Given TNBC’s aggressive nature, poor clinical outcomes, and limited treatment options, there is an urgent need for biomarker discovery and the development of novel therapeutic strategies to improve patient survival and overall outcomes.
GTP-binding protein 2 (GTPBP2) is a member of the large GTPase family, which acts as molecular switches to regulate various cellular processes by cycling between an active, GTP-bound state and an inactive, GDP-bound state7. GTPBP2 is believed to play a critical role in ensuring translational fidelity and may be involved in resolving stalled ribosomes during protein synthesis. Additionally, it has been implicated in the regulation of RNA metabolism, particularly during the translation process8. The gene encoding GTPBP2 is located on chromosome 6 in humans, and its expression has been observed in a wide range of tissues, including the brain9, underscoring its importance in maintaining cellular homeostasis. Recent studies suggest that mutations in the GTPBP2 gene may contribute to neurological disorders, including neurodegenerative diseases10. Despite these findings, the precise biological function of GTPBP2 remains incompletely understood. Further investigations are required to elucidate the specific molecular pathways regulated by GTPBP2 and to clarify its potential involvement in various disease mechanisms.
The Hippo signaling pathway serves as a crucial regulator of organ size, tissue homeostasis, and cellular proliferation. Initially discovered in Drosophila, this pathway is evolutionarily conserved across species and plays a fundamental role in governing cell growth, apoptosis, and stem cell maintenance11,12. Dysregulation of the Hippo pathway has been strongly implicated in the development of various cancers and other diseases characterized by uncontrolled cell proliferation. Studies have demonstrated that alterations in the Hippo pathway—whether through genetic mutations or epigenetic modifications—can result in heightened YAP/TAZ activity, driving tumorigenesis13. As a result, the Hippo pathway has emerged as a critical focus in cancer research, with particular attention on developing therapeutics that target YAP/TAZ or other key components. Such strategies hold significant promise for treating malignancies associated with Hippo pathway dysregulation.
In this study, we investigated the role of GTPBP2 in breast cancer for the first time, with a specific focus on its expression characteristics in triple-negative breast cancer. Our primary objectives were to evaluate the expression profile of GTPBP2 in TNBC, explore its prognostic significance, and analyze its association with clinical characteristics. Additionally, we sought to comprehensively investigate the biological function of GTPBP2 in the progression of TNBC. Our findings revealed that GTPBP2 significantly promotes the migration, invasion, and proliferation of TNBC cells. Mechanistically, we demonstrated that GTPBP2 inactivates Hippo signaling to promote breast cancer cells malignancy. This research provides new insights into the role of GTPBP2 in breast cancer, paving the way for the development of novel therapeutic strategies to combat this aggressive and deadly disease.
Materials and methods
Gene expression data from public databases
We conducted a comprehensive analysis of GTPBP2 expression in breast cancer (BC) and normal breast tissues utilizing multiple public databases: the UALCAN (http://ualcan.path.uab.edu/) and GEPIA (http://gepia.cancer-pku.cn/) databases were used to assess the mRNA expression levels of GTPBP2 in BC and normal breast tissues. Both databases are based on data from The Cancer Genome Atlas (TCGA) (https://tcga-data.nci.nih.gov/tcga/), which provided valuable insights into the differential expression of GTPBP2 between tumor and normal tissues. The Human Protein Atlas (HPA) (https://www.proteinatlas.org/) database was employed to explore GTPBP2 protein expression in BC and normal breast tissues. This analysis was conducted using immunohistochemical datasets, offering spatial and quantitative insights into GTPBP2 protein distribution. To further validate the prognostic significance of GTPBP2 in BC, the PrognoScan database (http://dna00.bio.kyutech.ac.jp/PrognoScan/) was utilized. This resource integrates survival data from multiple studies, enabling the association of GTPBP2 expression levels with clinical outcomes. Single-cell RNA sequencing data of BC was analyzed using the Tumor Immune Single-cell Hub (TISCH) database (http://tisch1.comp-genomics.org/). This allowed us to evaluate GTPBP2 expression at single-cell resolution, offering a nuanced view of its role in the tumor microenvironment. By integrating these datasets, we provided a thorough examination of GTPBP2’s expression and its prognostic significance in BC across multiple dimensions, including mRNA, protein, and single-cell levels. The relationship between GTPBP2 gene expression and the infiltration levels of six immune cell types in BRCA was examined using the Tumor Immune Estimation Resource (TIMER) database. Additionally, the correlation between the gene and specific lymphocyte types was assessed using the integrated repository portal for tumor-immune system interactions (TISIDB) database. This multi-level approach highlights the potential of GTPBP2 as both a biomarker and a therapeutic target in breast cancer.
Cell culture
Human breast cancer cell lines MCF-10 A, MDA-MB-231, HCC-1937, BT-549 and MDA-MB-468 were purchased from the China Center for Type Culture Collection. These cells were cultured in Roswell Park Memorial Institute (RPMI) 1640 medium (Solarbio, China) and DMEM high glucose supplemented(Solarbio, China), which are both containing 10% heat-inactivated fetal bovine serum (FBS, Gibco, United States) and 1% penicillin-streptomycin (Gibco, United States) in a humidified atmosphere incubator with 5% CO2 at 37 °C. The normal breast epithelial cell line MCF-10 A was cultured with a specialized culture medium(Gibco, United States). All cell lines were validated by STR and tested negative for mycoplasma. These standardized protocols ensured reliable and reproducible experimental conditions for downstream analyses.
Antibodies and chemicals
Antibodies against GTPBP2 were purchased from Proteintech Group(Rosemont, IL, United States, Cat No. 11557-1-AP). Antibodies against label of Flag were obtained from sigma (Sigma-Aldrich, United States, Cat No.F1804). Antibodies against YAP, TAZ, TEAD p-YAP and GAPDH are all from Cell Signaling Technology(Danvers, MA, USA, Cat No. 14074, Cat No. 72804, Cat No. 13295, Cat No. 13008, Cat No. 5174). Antibody against p-TAZ is from Affinity Biosciences LTD, Cat No. AF4315. All antibodies were used at a working concentration of 1:1000, and were stored at 4 °C. The secondary antibodies, purchased from Proteintech (Rosemont, IL, United States) were used at a dilution ratio of 1:5000. These antibodies were critical for ensuring the specificity and sensitivity of the experimental assays, particularly for protein detection and validation steps.
Lentivirus vectors and transfection
Stable MDA-MB-231 and BT-549 cell lines with silenced or overexpressed GTPBP2 were successfully generated using lentiviral constructs. In summary, the cells were divided into four groups: cells transfected with empty vector GL186 (NC), cells with an adenovirus overexpression vector for GL186-GTPBP2 (OE), cells transfected with knockdown empty vectorGL401 (shNC) and cells with GL401-GTPBP2 lentiviral knockdown vectors (KD). The lentivirus was purchased from Obio Technology (Shanghai Corp., Ltd) and transduction was performed according to the manufacturer’s instructions. MDA-MB-231 and BT-549 cells in logarithmic growth phase were collected and inoculated in 6-well plates at a density of 30% per field after digestion with pancreatin. Lentiviral infection (GL186, an adenovirus overexpression vector for GL186-GTPBP2, and GL401 and GL401-GTPBP2 lentiviral knockdown vectors.) was performed after 4–6 h when the cells were attached and in good condition. Then, cells were incubated at 37 °C in a humidified atmosphere with 5% CO2. On the following day after infection (approximately 24 h), the virus-containing medium was discarded and replaced with fresh complete medium, followed by incubation at 37 °C. Cells were infected with appropriate volume of virus calculated based on MOI = 20 using the formula: Virus volume (µL) = (MOI × Cell Number) / Viral Titer (TU/mL) × 1000, with the addition of Polybrene at 5 µg/mL. The sequences used were: shNC (TTCTCCGAACGTGTCACGT) and KD (GAGCGAGAAGTGGATTATGAT) for knockdown experiments. Following transduction, cells were selected with puromycin (2 µg/mL) for 7 days to establish stable knockdown pools. This methodology enabled the establishment of robust and stable cell models with precise control of GTPBP2 expression, laying the groundwork for downstream functional and mechanistic studies to investigate its role in cellular processes.
Western blot analysis
The total protein was extracted with the Radio Immunoprecipitation Assay (RIPA) buffer (Biyotime, China) which containing PMSF and phosphatase inhibitors. The concentration of protein was determined by using a bicinchoninic acid (BCA) protein assay kit (Biyotime, China) following the instructional manual. Equal mass of protein (30 µg per lane) was separated by using SDS-PAGE on a 10% or 8%, and then the protein was transferred to PVDF membrane. Following that, all the PVDF membranes were sealed in Tris-Buffered Saline (Solarbio, China) with 1% TWEEN 20(Solarbio, China), blocking solution containing 5% skim milk at room temperature for 2 h. Next, the membranes were incubated overnight with the primary antibodies at 4 °C, then incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies Proteintech for 2 h at room temperature. Finally, ECL reagent (Meilunbio, China) was used for signal visualization. Then the visible protein bands were obtained using a Bio-Rad gel imaging system, and analysed by Image J software.
Cell counting Kit-8 assay
Cell proliferation was measured using the Cell Counting Kit-8 (CCK-8, Beyotime, China) assay. Cells were plated in 96-well plates with 3,000 cells per well and 100 µl of medium per well. Phosphate buffered saline (PBS, Solarbio, China) buffer is added around the orifice plate to prevent the media from evaporating. After 0 h, 24 h, 48 h, 72 h, and 96 h, 10 µl CCK-8 reagent was added to each well and incubated at 37 °C for 2-4 h. The absorbance value was evaluated at 450 nm by a microplate reader (BioTek, United States).
Colony formation assay
There were 300 cells per well inoculated into in 6-well plates. Then, the plates cultured in a medium containing 10% foetal bovine serum for approximately 2 weeks, changing the media every 3 days. When there are visible clusters of cloned cells in the petri dish, we stop the cells, and wash the plates with PBS. Next, the cells were immobilized by using a 4% paraformaldehyde (PFA, Solarbio, China) and stained with a 0.1% crystal violet (Solarbio, China). Colonies containing > 50 cells were counted using the ImageJ software. And the colony formation rate were: the number of colonies / number of cells × 100% divided by control.
Wound healing assay
Wound-healing assay was used to detect the migration of cells. The cells suspensions were placed into a 6-well plates chamber. After the cells adhered and when the cells reached 90% confluence, a 200 µl gun tip was used to make shaped scratch consistently on the cell monolayer across each well. They were washed to remove floating cells with PBS before adding medium. Wound closure was visualized and measured every 12 h using an inverted light microscope. The wound healing was evaluated using ImageJ software, and the wound healing percent were calculated: Wound healing (%) = (the initial scratch area - the scratch area after hours)/ the initial scratch area × 100%.
Transwell invasion assay
For the invasion assay, upper chamber of each insert was coated with Matrigel (BD biosciences). In the assay, 3 × 105 cells were suspended in 100 µl serum-free medium and were added to the upper chamber. 600 µl medium containing 10% FBS were seeded in the lower compartment of well plate. After 18–24 h incubation, the cells on the upper surface of the filters were wiped using a cotton swab. The cells at the bottom of the membrane were fixed with 4% paraformaldehyde and stained with 0.2% crystal violet at room temperature. The micrograph of cells that had migrated were taken and then the counted were measured using ImageJ software.
Immunofluorescence (IF)
For immunofluorescence staining, cells were cultured on coverslips and fixed with 4% paraformaldehyde for 15 min at room temperature. After fixation, the cells were permeabilized with 0.1% Triton X-100 for 10 min, followed by blocking with 5% bovine serum albumin (BSA, Beyotime, China) in PBS for 1 h at room temperature to reduce nonspecific binding. The primary antibodies-GTPBP2 were then incubated overnight at 4 °C. After washing with PBS, the cells were incubated with fluorescently labeled secondary antibodies for 1 h at room temperature in the dark. Nuclei were stained with DAPI (Beyotime, China) for 5 min. The cells were then mounted with mounting medium and analyzed under a fluorescence microscope.
Immunocytochemistry (IHC)
For immunohistochemistry, formalin-fixed paraffin-embedded (FFPE) tissue Sect. (4 μm thick) were deparaffinized in xylene and rehydrated through a graded series of alcohols. After antigen retrieval, the sections were incubated with 3% hydrogen peroxide to block endogenous peroxidase activity. The sections were then incubated with 5% BSA in PBS at room temperature for 1 h. Primary antibodies were applied overnight at 4 °C, followed by incubation with biotinylated secondary antibodies for 1 h. Signal detection was performed using an avidin-biotin complex (ABC, Beyotime, China) kit, and the sections were developed with diaminobenzidine (Beyotime, China). Finally, tissue sections were counterstained with hematoxylin, dehydrated, and mounted.
Xenograft tumor model
4-week-old female B-NDG mice (N = 20) were obtained from Hangzhou Ziyuan Laboratory Animal Technology Co., Ltd., Jiangsu, China. The mice were divided into 4 groups and injected subcutaneously with blank cells, overexpressed cells and knockdown cells respectively. About 100 µl cell suspension was injected subcutaneously at the 2nd and 3rd pairs of breast pads in miceand the amount of cells was 5 × 106. After tumor formation, the weight of the mice was measured every three days and the size of the tumor was conducted with a vernier caliper. When the tumors reached a Maximum diameter of 1.5 cm, the subcutaneous tumors were dissected and then measured and weighted after the sacrifice of the mice. Euthanize the mice intravenous (iv) administration of sodium pentobarbital (150 mg/kg). The protocols were reviewed and approved by the Animal Care and Use Committee of the Animal Ethics Committee of the Second Affiliated Hospital of Shandong First Medical University, the number is 2022-028. The care and treatment of mice were performed according to the NIH guidelines for laboratory animal care. All animal experiments involved in this study were complied with the ARRIVE 2.0 guidelines. All methods were carried out in accordance with relevant guidelines and regulations.
Statistical analysis
All data are presented as the mean ± standard deviation and the experiments were repeated three times. Statistical analysis was performed using GraphPad Prism 9, and a p-value < 0.05 was considered statistically significant.
Results
GTPBP2 mRNA levels are significantly upregulated in breast cancer tissues
The biological function of GTPBP2 in breast cancer (BC) remains largely unexplored. To investigate this, we analyzed publicly available gene expression datasets using the UALCAN and GEPIA databases to compare GTPBP2 mRNA levels between tumor and normal tissues in BC patients. Firstly, through analysis of the Cancer Genome Atlas(TCGA) by UALCAN database, it was determined that GTPBP2 exhibits high expression levels in various tumor types, including cholangio carcinoma, esophageal carcinoma, glioblastoma multiforme, and liver hepatocellular carcinomar, thereby contributing to unfavorable prognosis. And the expression levels of the GTPBP2 gene in breast cancer were determined as presented that it was highly expressed, compared with normal tissues (Fig. 1A–B). Subsequently, the GEPIA database was utilized to further validate the expression levels of GTPBP2 in breast cancer. This analysis not only confirmed the elevated expression of GTPBP2 in breast cancer tissues compared to normal tissues but also further stratified the samples by molecular subtype. The consistent high expression of GTPBP2 across all major subtypes underscores its potentially critical and universal role in breast cancer progression.(Fig. 1C–D). Next, we evaluated the expression of GTPBP2 at the protein level using the Human Protein Atlas (HPA) database. The analysis revealed significant differences in GTPBP2 protein expression across various tissues, further supporting its potential role in breast cancer (Fig. 1E–F). The results demonstrated that GTPBP2 was highly expressed in breast cancer, with particularly significant expression observed in triple-negative breast cancer (TNBC). To further confirm the prognostic value of GTPBP2 in breast cancer, the GEO dataset GSE1456-GPL96 was analyzed using the PrognoScan database (Fig. 1G). The Kaplan-Meier plot was generated, showing the survival curves for the high (red) and low (blue) expression groups, as defined by the optimal cutoff point, the 95% confidence intervals for each group are represented by dashed lines. The findings revealed that breast cancer patients with high GTPBP2 expression exhibited poorer overall survival, highlighting its potential as a prognostic biomarker.
The high expression level of GTPBP2 in breast cancer. (A) The expression plot of GTPBP2 in pan-cancer patients of UALCAN database. (B) The expression plot of GTPBP2 in breast cancer patients of UALCAN database (P < 0.05). (C) The expression profile of GTPBP2 in breast cancer patients of GEPIA database. (D) The box plots of GTPBP2 in breast cancer subtypespatients of GEPIA database. (E) Representative IHC images of GTPBP2 expression in normal tissues. (F) Validation of GTPBP2 expression proteins using the HPA database in breast cancer tissues. (G) The prognostic value of GTPBP2 in breast cancer validated using GSE1456-GPL96 dataset: G1 is the gene expression plot, G2 is the expression histogram. G3 is the P-value plot. G4 is the Kaplan-Meier plot. G5 is the survival time plot. G6 is the attribute distribution plot.
GTPBP2 expression and immune cell infiltration
Using the TISCH database, we observed that GTPBP2 was predominantly expressed in malignant cells and endothelial cells in mouse, further emphasizing its potential role in tumor progression and the tumor microenvironment. (Fig. 2A). The TIMER databases provide a comprehensive platform for integrated correlation analysis of tumor-infiltrating immune cell characteristics and key genes of interest. We investigated the relationship between GTPBP2 expression and the level of immune cell infiltration (Fig. 2B). GTPBP2 expression in BRCA showed a very weak positive correlation with tumor purity (r = 0.056, p = 7.63 × 10− 2) and macrophage content (r = 0.069, p = 3.11 × 10− 2). GTPBP2 expression also exhibited weak positive correlation with the content of B cells (r = 0.147, p = 4.11 × 10− 6), CD8 + T cells (r = 0.137, p = 1.77 × 10− 5), CD4 + T cells (r = 0.35, p = 3.95 × 10− 29), neutrophils (r = 0.362, p = 7.99 × 10− 31) and dendritic cells (r = 0.293, p = 2.49 × 10− 20). We calculated the correlation between GTPBP2 expression and specific lymphocyte types by TISIDB databases (Fig. 2C). GTPBP2 expression in BRCA showed a very weak positive correlation with avtivated CD4 T cell (ACT_CD4) (r = 0.231, p = 9.26 × 10− 15), avtivated CD8 T cell (ACT_CD8) (r = 0.09, p = 0.00279), and avtivated dendritic cell (ACT_DC) (r = 0.124, p = 3.73 × 10− 5). In contrast, GTPBP2 expression in BRCA exhibited a weak negative correlation with natural killer cells (NK) (r = -0.093, p = 0.00199). These findings suggest that GTPBP2 may play a multifaceted role in modulating the immune microenvironment within the tumor, potentially influencing both immune surveillance and the overall immune response in breast cancer.
The expressionin of GTPBP2 in tumor progression and the tumor microenvironment. (A) GTPBP2 expression at the single cell level in the BRCA_GSE136206_mouse_aPD1aCTLA4 dataset. (B) The relationship between GTPBP2 gene expression and the level of infiltration of six types of immune cells in BC was investigated using TIMER database. (C) The relationship between GTPBP2 expression and specific lymphocyte types using the TISIDB database.
GTPBP2 is expressed at high levels in TNBC cell lines
The protein levels of GTPBP2 in breast cancer (BC) cell lines were validated using Western blot analysis, which confirmed that GTPBP2 protein levels were significantly higher in triple-negative breast cancer (TNBC) cells compared to the human normal breast epithelial cell line MCF-10 A (Fig. 3A, S1). Building on these findings, the role of GTPBP2 in the occurrence and progression of TNBC was further investigated by silencing or overexpressing GTPBP2 in TNBC cell lines (MDA-MB-231 and BT-549). The Fig. 3B illustrates the efficiency of GTPBP2 knockdown or overexpression at the protein level, as confirmed by Western blot analysis (see also Supplementary Figures S2 and S3 for the uncropped blots). These results indicate that GTPBP2 is upregulated in TNBC cells, and further demonstrate that lentiviral transfection is an effective method for modulating GTPBP2 expression.
GTPBP2 promotes the proliferation of TNBC cells
To further investigate the effects of GTPBP2 on the proliferation of TNBC cells, we conducted CCK-8 assays and colony formation assays. The results of the CCK-8 assay revealed that the proliferation activity in the GTPBP2 overexpression group was significantly higher compared to the control group at the 48 h (Fig. 3C). In contrast, the growth of GTPBP2-depleted MDA-MB-231 cells was slower compared to the NC group. Similar results were observed when the assay was performed on BT-549 cells with GTPBP2 depletion (Fig. 3D). Similarly, the colony formation assays demonstrated that the downregulation of GTPBP2 significantly impaired the cell viability of MDA-MB-231 and BT-549 cells, whereas the upregulation of GTPBP2 enhanced the cell viability in both cell lines (Fig. 3E). After overexpressing GTPBP2 in MDA-MB-231 cells, the proliferation colony formation rates of the NC group and OE group were 0.16 ± 0.02 and 0.27 ± 0.03, respectively. Upon knocking down this protein, the colony formation rates of the shNC group and KD group were 0.34 ± 0.02 and 0.16 ± 0.02. All of which were statistically significant (P < 0.05). After overexpressing the GTPBP2 protein in BT-549 cells, the cell colony formation rates for the NC group and the OE group were 0.26 ± 0.03 and 0.37 ± 0.04, respectively. Knocking down GTPBP2, the colony formation rates for the shNC group and the KD group were 0.38 ± 0.04 and 0.09 ± 0.03, respectively. All the data are statistically significant (P < 0.05). In summary, these findings suggest that GTPBP2 plays a crucial role in enhancing the proliferation of TNBC cells in vitro.
GTPBP2 promotes themigration and invasion of TNBC cells
To evaluate the relevance of GTPBP2 in cell migration and invasion, we performed scratch assays and transwell assays. The wound healing assay was utilized to assess the role of GTPBP2 in the migratory capability of TNBC cells. The results showed that the wound healing rate in the GTPBP2 knockdown group was slower compared to the shNC group, whereas the GTPBP2 overexpression group exhibited a faster wound healing rate compared to the NC group (Fig. 3F). After adjusting the GTPBP2 protein expression level in MDA-MB-231 cells, the scratch wound healing rates for the NC, OE, shNC, and KD groups were 0.08 ± 0.01, 0.36 ± 0.01, 0.55 ± 0.05, and 0.31 ± 0.02 respectively. Similarly, in BT-549 cells, the scratch wound healing rates for the NC group, OE group, shNC group, and KD group were 0.26 ± 0.02, 0.71 ± 0.02, 0.58 ± 0.03, and 0.17 ± 0.06, respectively. All data were statistically significant (P < 0.05). Moreover, transwell assays results showed an increased rate of cell invasion in the GTPBP2 overexpression group compared to the control and carrier groups. While, the invasion ability of TNBC cells through the transwell with Matrigel were reduced, when the cell transfected with GTPBP2-downregulate. After altering the expression levels of GTPBP2 proteins in MDA-MB-231 cells, the count of cell perforations in the NC group, OE group, shNC group, and KD group were 441.4 ± 24.72, 885.8 ± 24.99, 918.4 ± 44.86, and 533.8 ± 28.45, respectively. Meanwhile, in BT-549 cells, the number of cell perforations in the NC, OE, shNC, KD categories were 354 ± 23.82, 620 ± 68.61, 666.2 ± 32.48, and 407 ± 25.69, respectively (Fig. 3G). In short, the comprehensive data suggest that GTPBP2 may play a regulatory role in promoting TNBC cell migration and invasion.
GTPBP2 promotes the proliferation, migration and invasion of TNBC cells in vitro. NC: the control group in the overexpression experiment; OE: the GTPBP2 overexpression group; ShNC: the control group in the knockdown experiment; KD: the GTPBP2 knockdown group. (A) GTPBP2 overexpression in TNBC by Western Blot assay. (B) The efficiency of GTPBP2 knockdown or overexpression by Western Blot assay. (C) Outcomes from CCK-8 proliferation assay with GTPBP2 overexpression and downregulation (E) The colony formation results with GTPBP2 overexpression and downregulation in cells. (F) The effect of GTPBP2 on the migration of TNBC cells by wound-healing assay. (G) The effect of GTPBP2 on the invasion of TNBC cells by Transwell assays (×100). *p < 0.05, **p < 0.01, ***p < 0.001,****p < 0.0001.
Inactivates Hippo pathway to promote TNBC cells
We found that GTPBP2 significantly promotes the proliferation of TNBC cells, and Hippo pathway, is also associated with proliferation.We employed immunofluorescence to detect the expression of GTPBP2 and YAP (a key effector molecule of the Hippo signaling pathway) in, and found that alterations in GTPBP2 expression levels were accompanied by corresponding changes in YAP expression, suggesting a potential regulatory interaction between the GTPBP2 and Hippo signaling pathways (Fig. 4A). To explore whether the signaling pathway was r elated to GTPBP2, the two cells that transfected with GTPBP2 overexpression and lowexpression were extracted proteins.Western blot detection of the expression of key proteins in the signaling pathway, such as YAP, TAZ, p-YAP, p-TAZ, TEAD. The results showed that the expression both of YAP, TAZ and TEAD was positively correlated with the expression of GTPBP2, while the expression of p-YAP, p-TAZ and GTPBP2 was negatively correlated (Fig. 4B–C, S4-5).
GTPBP2 promotes the proliferation tumorigenesis in vivo
To examine the impact of GTPBP2 on the proliferation of TNBC cells in vivo, we established a xenograft B-NDG mouse model. The MDA-MB-231 cells, including GTPBP2 knockdown cells (KD) and its respective control cells (shNC), GTPBP2 overexpressing cells (OE) and its respective control cells (NC), were subcutaneously injected into the second and third pairs of breast pads of B-NDG mice. Approximately 1.5 weeks after the tumor cell implantation, visible tumor formation was observed subcutaneously. Tumor size was then measured every three days. Compared to the respective control group, the tumor growth rate was significantly slower in the GTPBP2 silencing group and faster in the GTPBP2 overexpression group. After approximately 25 days, the B-NDG mice were euthanized, and the tumors were weighed. The results showed that the tumor growth rate in the GTPBP2 knockdown group was notably slower than that in the NC group, whereas the growth rate in the GTPBP2 overexpression group was markedly faster than in the NC group. Subsequently, tumor weights were measured, revealing that tumors in the overexpression group were significantly larger than those in the NC group, while tumors in the knockdown group were notably smaller than those in the shNC group (Fig. 4D). Furthermore, H&E staining and immunohistochemistry of tumors from the overexpression group revealed a significant upregulation of the target gene GTPBP2, accompanied by increased YAP expression and decreased p-YAP levels (Fig. 4E).
(A) Immunofluorescence of KCNIP2 and YAP in MDA-MB-231 cells (×400). (B–C) The expression of marker proteins of related signalling pathways was assessed using western blotting. (D) GTPBP2 overexpression promotes the growth of xenograft TNBC tumors. (E) HE and IHC staining of GTPBP2-overexpression of xenograft tumors (×100. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.
Discussion
Breast cancer, one of the most prevalent cancers in women, remains a significant global health burden14. Despite improvements in overall survival rates, certain subtypes continue to present major challenges in treatment. Among these, triple-negative breast cancer (TNBC) stands out as particularly difficult to manage due to its limited therapeutic options and high recurrence rates15. To address these challenges, it is crucial to advance our understanding of the mechanisms underlying malignant tumor progression and to identify novel biomarkers for cancer prognosis. These efforts could play a pivotal role in refining treatment strategies, optimizing clinical decision-making, and ultimately improving patient outcomes.
GTPBP2 (GTP Binding Protein 2), a member of the GTP-binding protein family, is located on human chromosome 68. As a pivotal component of the GTPase enzyme family, GTPBP2 is essential for regulating a wide range of fundamental biological processes within cells. It plays critical roles in translational regulation, cellular stress response, and metabolic homeostasis, while also significantly influencing molecular signaling pathways and protein functionality. These multifaceted functions highlight its importance in preserving cellular integrity and adaptability7,10,16. Although our understanding of GTPBP2 remains incomplete, evidence suggests that its functional abnormalities are linked to a range of conditions, including neurological disorders, autism, and tumors17,18. GTPBP2 is highly expressed in neural tissues, and studies have shown its strong association with several neurodegenerative diseases, such as amyotrophic lateral sclerosis (ALS), Parkinson’s disease, and cognitive impairments19,20. Moreover, emerging research indicates that the abnormal function of GTPBP2 may contribute to tumor development. Specifically, GTPBP2 has been implicated in the progression of tumor cells in various cancers, including lung cancer21, colorectal cancer22, and glioblastoma17. Notably, in the context of breast cancer, our current study—supported by online database analysis—identified the upregulated expression of GTPBP2 in breast cancer (BC). Functional studies further clarified its critical role in regulating the biological behavior of BC cells. For instance, GTPBP2 promotes proliferation, migration, invasion, and colony formation of triple-negative breast cancer (TNBC) cells in vitro, as well as xenograft tumor growth in vivo. These findings strongly suggest that GTPBP2 may serve as a promising therapeutic target for TNBC.
The Hippo pathway is a highly conserved signaling network, originally discovered in Drosophila and subsequently confirmed to be conserved in humans and other animals23,24. This pathway plays a pivotal role in regulating cell growth and death, including processes such as cell proliferation, apoptosis, and stem cell maintenance. Additionally, it is essential for maintaining tissue homeostasis and preventing organ overgrowth, thereby serving as a critical safeguard against cancer development25. Key components of the Hippo-signaling pathway include the transcriptional coactivator yes-related protein (YAP) and the WW domain-containing transcriptional regulatory protein 1 (WWTR1 or commonly referred to as TAZ)26,27. As investigated, YAP, as an important transcriptional coactivator, is hyperactivated in human malignancies and is thought to play a crucial role in tumorigenesis28,29. Because its activation is thought to enhance tumor proliferation, migration, and promote drug resistance, high expression of YAP in tumor tissue is usually associated with poor prognosis in patients. In various cancers, such as liver cancer30, lung cancer31, and colorectal cancer32, the inhibition of the Hippo pathway results in the abnormal activation of YAP/TAZ, which subsequently drives tumor cell proliferation and resistance to apoptosis. Dysregulation of Hippo signaling leads to tumorigenesis33, such as liver34, breast35, lung36and gastric cancer37. In particular, recent studies have found that, as oncoproteins, the transcriptional coactivator YAP / TAZ is able to enhance cell proliferation, promote cell transformation, and increase cancer cell stemness38,39. For example, in breast cancer, YAP / TAZ can induce cancer cell proliferation and reduce cancer cell death, which simultaneously leads to an increased cancer cell number40.Research has shown that YAP/TAZ, also serving as core regulators of mechanotransduction, undergo complex regulation of nuclear translocation by multiple biophysical signals such as matrix stiffness, culture dimensions, and cell shape, displaying markedly different activation patterns in two-dimensional and three-dimensional microenvironments41,42,43. These mechanical signals, by regulating cytoskeletal remodeling and nuclear mechanical properties, cooperate with biochemical signaling pathways to determine the spatial distribution of YAP/TAZ, thereby providing new design strategies for future disease research and therapy.
To the best of our knowledge, this study is to investigate the clinical significance and molecular function of GTPBP2 in breast cancer. However, this study has limitations. The clinical relevance could be strengthened by including samples from nosocomial TNBC patients. Additionally, although the mechanisms observed in the in vitro experiments are robust, further in vivo validation is necessary. More biomarkers (such as Ki67, p-TAZ, etc.) will be needed for validation. Spatial mechanical activation of YAP/TAZ will also be a key direction for future research.
Conclusions
In conclusion, our findings demonstrate that GTPBP2 is expressed in breast cancer cells to varying degrees, with database analysis revealing that GTPBP2 expression is significantly higher in breast cancer tissues compared to normal tissues. Moreover, GTPBP2 is associated with poor prognosis in breast cancer patients. Functional experiments confirmed that GTPBP2 promotes the proliferation, migration, and invasion of TNBC cells, further highlighting its role in tumor progression. Additionally, our results revealed alterations in YAP/TAZ protein expression in TNBC cells, indicating that GTPBP2 contributes to TNBC development by regulating the Hippo pathway. These findings indicate that elevated GTPBP2 expression drives cancer progression through diverse mechanisms, highlighting its potential as a promising target for future therapeutic interventions.
Declarations.
Data availability
The datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request.
References
Siegel, R. L., Giaquinto, A. N. & Jemal, A. Cancer statistics,. CA Cancer J Clin, 2024. 74(1): pp. 12-49. CA Cancer J Clin, 2024. 74(1): pp. 12-49 (2024). https://doi.org/10.3322/caac.21820
Siegel, R. L. et al. Cancer statistics, 2023. CA Cancer J. Clin. 73 (1), 17–48. https://doi.org/10.3322/caac.21763 (2023).
Dobovišek, L. et al. Cannabinoids and triple-negative breast cancer treatment. Front. Immunol. 15, 1386548. https://doi.org/10.3389/fimmu.2024.1386548 (2024).
Anilkumar, K. V. et al. MiRNAs in the prognosis of triple-negative breast cancer: A review. Life Sci. 333, 122183. https://doi.org/10.1016/j.lfs.2023.122183 (2023).
Das, K. et al. Extracellular vesicles in Triple-Negative breast cancer: immune Regulation, Biomarkers, and immunotherapeutic potential. Cancers (Basel). 15 (19). https://doi.org/10.3390/cancers15194879 (2023).
Li, Y. et al. Recent advances in therapeutic strategies for triple-negative breast cancer. J. Hematol. Oncol. 15 (1), 121. https://doi.org/10.1186/s13045-022-01341-0 (2022).
Watanabe, M. et al. Cloning, expression analysis, and chromosomal mapping of GTPBP2, a novel member of the G protein family. Gene 256 (1–2), 51–58. https://doi.org/10.1016/s0378-1119(00)00346-2 (2000).
Jaberi, E. et al. Identification of mutation in GTPBP2 in patients of a family with neurodegeneration accompanied by iron deposition in the brain. Neurobiol. Aging. 38, 216. https://doi.org/10.1016/j.neurobiolaging.2015.10.034 (2016).
Hajati, R. et al. Neurodegeneration with brain iron accumulation and a brief report of the disease in Iran. Can. J. Neurol. Sci. 49 (3), 338–351. https://doi.org/10.1017/cjn.2021.124 (2022).
Salpietro, V. et al. Bi-allelic genetic variants in the translational GTPases GTPBP1 and GTPBP2 cause a distinct identical neurodevelopmental syndrome. Am. J. Hum. Genet. 111 (1), 200–210. https://doi.org/10.1016/j.ajhg.2023.11.012 (2024).
Ahmad, U. S., Uttagomol, J. & Wan, H. The regulation of the Hippo pathway by intercellular junction proteins. Life (Basel). 12 (11). https://doi.org/10.3390/life12111792 (2022).
Mao, F. et al. Hippo dictates signaling for cellular homeostasis and immune defense in Crassostrea hongkongensis hemocytes. Front. Immunol. 14, 1173796. https://doi.org/10.3389/fimmu.2023.1173796 (2023).
Mokhtari, R. B. et al. The Hippo pathway effectors YAP/TAZ-TEAD oncoproteins as emerging therapeutic targets in the tumor microenvironment. Cancers (Basel). 15 (13). https://doi.org/10.3390/cancers15133468 (2023).
Rodríguez-Bejarano, O. H., Parra-López, C. & Patarroyo, M. A. A review concerning the breast cancer-related tumour microenvironment. Crit. Rev. Oncol. Hematol. 199, 104389. https://doi.org/10.1016/j.critrevonc.2024.104389 (2024).
Lu, B. et al. Molecular Classification, Treatment, and genetic biomarkers in Triple-Negative breast cancer: A review. Technol. Cancer Res. Treat. 22, 15330338221145246. https://doi.org/10.1177/15330338221145246 (2023).
Zuko, A. et al. tRNA overexpression rescues peripheral neuropathy caused by mutations in tRNA synthetase. Science 373 (6559), 1161–1166. https://doi.org/10.1126/science.abb3356 (2021).
Mulholland, P. J. et al. Genomic profiling identifies discrete deletions associated with translocations in glioblastoma multiforme. Cell. Cycle. 5 (7), 783–791. https://doi.org/10.4161/cc.5.7.2631 (2006).
Carter, M. T. et al. Clinical delineation of GTPBP2-associated neuro-ectodermal syndrome: report of two new families and review of the literature. Clin. Genet. 95 (5), 601–606. https://doi.org/10.1111/cge.13523 (2019).
Wydrych, A. et al. Metabolic alterations in fibroblasts of patients presenting with the MPAN subtype of neurodegeneration with brain iron accumulation (NBIA). Biochim. Biophys. Acta Mol. Basis Dis. 1871 (1), 167541. https://doi.org/10.1016/j.bbadis.2024.167541 (2025).
Bertoli-Avella, A. M. et al. Biallelic inactivating variants in the GTPBP2 gene cause a neurodevelopmental disorder with severe intellectual disability. Eur. J. Hum. Genet. 26 (4), 592–598. https://doi.org/10.1038/s41431-018-0097-3 (2018).
Jie, L. et al. GTPBP2 positively regulates the invasion, migration and proliferation of non-small cell lung cancer. J. Cancer. 12 (13), 3819–3826. https://doi.org/10.7150/jca.48340 (2021).
Ke, C. et al. GTP binding protein 2 maintains the quiescence, self-renewal, and chemoresistance of mouse colorectal cancer stem cells via promoting Wnt signaling activation. Heliyon 10 (5), e27159. https://doi.org/10.1016/j.heliyon.2024.e27159 (2024).
Pan, D. The Hippo signaling pathway in development and cancer. Dev. Cell. 19 (4), 491–505. https://doi.org/10.1016/j.devcel.2010.09.011 (2010).
Meng, Z., Moroishi, T. & Guan, K. L. Mechanisms of Hippo pathway regulation. Genes Dev. 30 (1), 1–17. https://doi.org/10.1101/gad.274027.115 (2016).
Fu, M. et al. The Hippo signalling pathway and its implications in human health and diseases. Signal. Transduct. Target. Ther. 7 (1), 376. https://doi.org/10.1038/s41392-022-01191-9 (2022).
Plouffe, S. W., Hong, A. W. & Guan, K. L. Disease implications of the Hippo/YAP pathway. Trends Mol. Med. 21 (4), 212–222. https://doi.org/10.1016/j.molmed.2015.01.003 (2015).
Hansen, C. G., Moroishi, T. & Guan, K. L. YAP and TAZ: a nexus for Hippo signaling and beyond. Trends Cell. Biol. 25 (9), 499–513. https://doi.org/10.1016/j.tcb.2015.05.002 (2015).
Piccolo, S. et al. YAP/TAZ as master regulators in cancer: modulation, function and therapeutic approaches. Nat. Cancer. 4 (1), 9–26. https://doi.org/10.1038/s43018-022-00473-z (2023).
Thrash, H. L. & Pendergast, A. M. Multi-Functional regulation by YAP/TAZ signaling networks in tumor progression and metastasis. Cancers (Basel). 15 (19). https://doi.org/10.3390/cancers15194701 (2023).
Shi, H. et al. Complex roles of Hippo-YAP/TAZ signaling in hepatocellular carcinoma. J. Cancer Res. Clin. Oncol. 149 (16), 15311–15322. https://doi.org/10.1007/s00432-023-05272-2 (2023).
Govorova, I. A., Nikitochkina, S. Y. & Vorotelyak, E. A. Influence of intersignaling crosstalk on the intracellular localization of YAP/TAZ in lung cells. Cell. Commun. Signal. 22 (1), 289. https://doi.org/10.1186/s12964-024-01662-2 (2024).
Mohammadpour, S. et al. Hippo Signaling Pathway in Colorectal Cancer: Modulation by Various Signals and Therapeutic Potential. Anal Cell Pathol (Amst), 2024: p. 5767535 (2024). https://doi.org/10.1155/2024/5767535
Cunningham, R. & Hansen, C. G. The Hippo pathway in cancer: YAP/TAZ and TEAD as therapeutic targets in cancer. Clin. Sci. (Lond). 136 (3), 197–222. https://doi.org/10.1042/cs20201474 (2022).
Russell, J. O. & Camargo, F. D. Hippo signalling in the liver: role in development, regeneration and disease. Nat. Rev. Gastroenterol. Hepatol. 19 (5), 297–312. https://doi.org/10.1038/s41575-021-00571-w (2022).
Luo, J. et al. The oncogenic roles and clinical implications of YAP/TAZ in breast cancer. Br. J. Cancer. 128 (9), 1611–1624. https://doi.org/10.1038/s41416-023-02182-5 (2023).
Liang, H. et al. Hippo pathway in non-small cell lung cancer: mechanisms, potential targets, and biomarkers. Cancer Gene Ther. 31 (5), 652–666. https://doi.org/10.1038/s41417-024-00761-z (2024).
Liu, Y. et al. Targeting Hippo pathway: A novel strategy for Helicobacter pylori-induced gastric cancer treatment. Biomed. Pharmacother. 161, 114549. https://doi.org/10.1016/j.biopha.2023.114549 (2023).
Driskill, J. H. & Pan, D. Control of stem cell renewal and fate by YAP and TAZ. Nat. Rev. Mol. Cell. Biol. 24 (12), 895–911. https://doi.org/10.1038/s41580-023-00644-5 (2023).
Luo, M. et al. Advances of targeting the YAP/TAZ-TEAD complex in the Hippo pathway for the treatment of cancers. Eur. J. Med. Chem. 244, 114847. https://doi.org/10.1016/j.ejmech.2022.114847 (2022).
Zhao, W. et al. Transcriptional co-activators YAP/TAZ: potential therapeutic targets for metastatic breast cancer. Biomed. Pharmacother. 133, 110956. https://doi.org/10.1016/j.biopha.2020.110956 (2021).
Aragona, M. et al. A mechanical checkpoint controls multicellular growth through YAP/TAZ regulation by actin-processing factors. Cell 154 (5), 1047–1059. https://doi.org/10.1016/j.cell.2013.07.042 (2013).
Scott, K. E., Fraley, S. I. & Rangamani, P. A Spatial model of YAP/TAZ signaling reveals how stiffness, dimensionality, and shape contribute to emergent outcomes. Proc. Natl. Acad. Sci. U S A. 118 (20). https://doi.org/10.1073/pnas.2021571118 (2021).
Caliari, S. R. et al. Dimensionality and spreading influence MSC YAP/TAZ signaling in hydrogel environments. Biomaterials 103, 314–323. https://doi.org/10.1016/j.biomaterials.2016.06.061 (2016).
Acknowledgements
We sincerely acknowledge and greatly appreciate our colleagues for their invaluable suggestions and technical support throughout this study.
Funding
This study was supported by grants from the National Natural Science Foundation of China (grant no. 81473687, 82274538), The Natural Science Foundation of Shandong Province (grant no. ZR2020MH357), Shandong Provincial Medical and Health Science and Technology Development Plan (2019WS406).
Author information
Authors and Affiliations
Contributions
Xian Zhao and Wenjing Li contribute equally to the article. Xian Zhao, Wenjing Li: Writing—Original Draft, Performing all the experiments; Qinyu Han, Chuanxin Ren: Formal analysis, Visualization and Resources; Xingchao Xu, Wenfeng Li: Supervision, Formal analysis; Xiangqi Li: Funding acquisition, Conceptualization.
Corresponding author
Ethics declarations
Competing interests
The authors declare no competing interests.
Ethical approval and consent to participate
The study was approved by the medical ethics committees of The Second Affiliated Hospital of Shandong First Medical University, the number is2022-028.
Additional information
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary Information
Below is the link to the electronic supplementary material.
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
About this article
Cite this article
Zhao, X., Li, W., Han, Q. et al. GTPBP2 inactivates Hippo signaling to promote triple-negative breast cancer cell malignancy. Sci Rep 16, 11467 (2026). https://doi.org/10.1038/s41598-026-40054-z
Received:
Accepted:
Published:
Version of record:
DOI: https://doi.org/10.1038/s41598-026-40054-z






