MEILB2-BRME1 forms a V-shaped DNA clamp upon BRCA2-binding in meiotic recombination

Gurusaran, Manickam; Zhang, Jingjing; Zhang, Kexin; Shibuya, Hiroki; Davies, Owen R.

doi:10.1038/s41467-024-50920-x

Download PDF

Article
Open access
Published: 02 August 2024

MEILB2-BRME1 forms a V-shaped DNA clamp upon BRCA2-binding in meiotic recombination

Nature Communications volume 15, Article number: 6552 (2024) Cite this article

4365 Accesses
2 Citations
1 Altmetric
Metrics details

Subjects

Abstract

DNA double-strand break repair by homologous recombination has a specialised role in meiosis by generating crossovers that enable the formation of haploid germ cells. This requires meiosis-specific MEILB2-BRME1, which interacts with BRCA2 to facilitate loading of recombinases onto resected DNA ends. Here, we report the crystal structure of the MEILB2-BRME1 2:2 core complex, revealing a parallel four-helical assembly that recruits BRME1 to meiotic double-strand breaks in vivo. It forms an N-terminal β-cap that binds to DNA, and a MEILB2 coiled-coil that bridges to C-terminal ARM domains. Upon BRCA2-binding, MEILB2-BRME1 2:2 complexes dimerize into a V-shaped 2:4:4 complex, with rod-like MEILB2-BRME1 components arranged at right-angles. The β-caps located at the tips of the MEILB2-BRME1 limbs are separated by 25 nm, allowing them to bridge between DNA molecules. Thus, we propose that BRCA2 induces MEILB2-BRME1 to function as a DNA clamp, connecting resected DNA ends or homologous chromosomes to facilitate meiotic recombination.

Structure of a meiosis-specific complex central to BRCA2 localization at recombination sites

Article 09 August 2021

Gene conversion: a non-Mendelian process integral to meiotic recombination

Article Open access 07 April 2022

BRCA2 binding through a cryptic repeated motif to HSF2BP oligomers does not impact meiotic recombination

Article Open access 29 July 2021

Introduction

Breast cancer susceptibility protein BRCA2 performs a central role in recombination-mediated DNA double-strand breaks (DSBs) repair by loading recombinases onto resected DNA ends^1,2,3. Its importance in genome stability is demonstrated by the gross chromosomal rearrangements that accumulate in BRCA2 deficient mammalian cells^4,5, and the strong association between germline BRCA2 mutations and early-onset breast and ovarian cancers⁶. BRCA2 is also required for meiosis, as its germline-specific deficiency leads to meiotic impairment and infertility in mice⁷. Here, programmed DSBs are induced, and then repaired by recombination between homologous chromosomes to generate crossovers, which provide genetic diversity and are critical for the correct segregation of homologues^8,9. Hence, BRCA2 is essential for maintaining genome integrity in somatic cells and for generating haploid germ cells in meiosis.

In somatic cells, homologous recombination is initiated by DSB end resection, in which the MRN complex generates 3′ single-stranded DNA (ssDNA) overhangs that become coated by RPA¹⁰ (Fig. 1). BRCA2 then displaces RPA by loading recombinase RAD51 to form RAD51-ssDNA filaments^11,12. These nucleoprotein filaments invade the sister chromatid and mediate template-directed repair, generating joint molecules that are resolved by multiple pathways¹³. In meiosis, homologous recombination uses the same principal machinery, with several critical modifications (Fig. 1): (1) meiotic DSBs are induced by the SPO11–TOPOVIBL complex^14,15. (2) Resected ssDNA overhangs are coated by RPA and meiosis-specific complex MEIOB–SPATA22^16,17,18. (3) BRCA2 loads RAD51 and the meiosis-specific recombinase DMC1 onto ssDNA overhangs^19,20,21. (4) BRCA2 and recombinases are supported by essential meiosis-specific accessory proteins, including MEILB2–BRME1²². (5) Meiotic recombination uses the homologous chromosome rather than the sister chromatid as the primary repair template²³. (6) Meiotic recombination occurs within the synaptonemal complex that binds together homologous chromosome axes²⁴. (7) The processing of recombination intermediates is tightly regulated to ensure the formation of at least one crossover, and rarely more than two crossovers, per homologous chromosome pair^8,9.

**Fig. 1: Mechanics of homologous recombination.**

BRCA2 is a large protein (3329 amino acids in mice) that contains multiple recombinase-binding sites and a single globular DNA-binding domain (Fig. 2a). BRC repeats within the central exon 11 region bind to RAD51 and DMC1 by competing with their oligomerisation^25,26. In contrast, sequences that flank the DNA-binding domain (exons 14 and 27), interact with DMC1 and RAD51, respectively, in a manner that stabilises their nucleoprotein filaments^27,28,29,30. Finally, the DNA-binding domain contains OB-folds for ssDNA-binding³¹, and interacts with acidic DNA-mimicking protein DSS1³², which act together to offload RPA from ssDNA overhangs^12,33. Hence, whilst we lack a full molecular mechanism, BRCA2 contains the necessary functionalities to explain its role in displacing RPA, and loading recombinases onto ssDNA overhangs to form nucleoprotein filaments^1,2,3.

**Fig. 2: Crystal structure of the MEILB2α–BRME1_MBD 2:2 core complex.**

MEILB2 (meiotic localiser of BRCA2; also known as HSF2BP) was recently identified as a meiosis-specific interacting partner of BRCA2^34,35. BRME1 (BRCA2 and MEILB2-associating protein 1; also known as MEIOK21, MMER, C19ORF57 and 4930432K21Rik) was then identified as a meiosis-specific binding partner of MEILB2^{36,37,38,39,40}. MEILB2 and BRME2 co-localise on meiotic recombination sites in a mutually dependent manner^34,36. In MEILB2 and BRME1 knockout mice, males are sterile, with failure of RAD51 and DMC1 foci formation, failure of DSB repair and failure of crossover formation^{34,35,36,37,38,39,40}. In contrast, females exhibit subfertility, in which the development and number of oocytes is substantially reduced^{34,35,36,37,38,39,40,41}. This resembles the sexual dimorphism observed upon deficiency of BRCA2 and other recombination factors⁷. Their co-localisation and similar phenotypes suggest that MEILB2 and BRME1 exist within the same functional unit in meiosis. This likely occurs through modulation of BRCA2 function as MEILB2 or BRME1 expression suppresses BRCA2-mediated recombination in somatic cells^36,42, and MEILB2 expression has been observed in cancer cell lines and human tumour samples^35,42. Indeed, it has been hypothesised that MEILB2–BRME1 may modulate the oligomeric state or conformation of BRCA2 to favour meiotic rather than mitotic recombination²².

The mechanical basis of recombination is an intrinsically structural problem that will likely be solved by understanding the functional architecture of its principal components and complexes. MEILB2 consists of N-terminal coiled-coil and C-terminal ARM (armadillo repeat) domains, which bind with high affinity to BRME1 and BRCA2, respectively^36,43 (Fig. 2a and Supplementary Fig. 1a). The ARM domains interact with the MEILB2-binding domain (MBD) of BRCA2, which is located immediately upstream of its DMC1-binding site³⁶ (Fig. 2a). Crystal structures have revealed that BRCA2-binding staples together two MEILB2-ARM dimers at ~95° to one another^43,44. In these 2:4 complexes, each BRCA2 MBD peptide bridges between interacting MEILB2 ARM dimers, through cryptic repeats within their N- and C-terminal ends binding to opposing ARM domains^43,44. The N-terminus of MEILB2’s coiled-coil binds to the C-terminal end of BRME1³⁶ (Fig. 2a and Supplementary Fig. 1b), which currently has no other known structure or interacting partners. The MEILB2 coiled-coil exists in dimeric and higher order species in isolation, but forms stable 2:2 complexes with BRME1³⁶. However, the lack of structural information regarding the MEILB2–BRME1 complex currently prevents us from understanding the architecture of the wider BRCA2–MEILB2–BRME1 assembly, and critically the molecular basis of MEILB2–BRME1 function in BRCA2-mediated meiotic recombination.

Here, we report the crystal structure of the MEILB2–BRME1 2:2 core complex, revealing a four-helical assembly that mediates BRME1 recruitment to meiotic DSBs in vivo. We show that its N-terminal β-cap binds to DNA, requiring both MEILB2 and BRME1 amino acids. We report a model of the full MEILB2–BRME1 2:2 complex, and show that BRCA2-binding induces dimerisation of this structure into a V-shaped assembly. The β-caps at the ends of the MEILB2–BRME1 limbs of this structure are separated by 25 nm, so may bind together distinct DNA molecules, forming protein–DNA networks. Hence, we propose that BRCA2-binding may induce MEILB2–BRME1 to act as a DNA clamp in meiotic recombination.

Results

Crystal structure of the MEILB2α–BRME1_MBD core complex

MEILB2 possesses an N-terminal α-helical region, consisting of two predicted α-helices (α1 and α2), followed by a C-terminal ARM domain (Fig. 2a). We previously demonstrated that MEILB2’s α-helical region binds via its α1 helix to the C-terminus of BRME1 (MBD), forming a stable 2:2 complex³⁶. Here, we identified an optimised construct for crystallography, which includes the α1 helix and the beginning of the α2 helix of MEILB2 (amino-acids 22–81; herein referred to as MEILB2α) and the core of BRME1’s MBD (amino-acids 540–578; herein referred to as BRME1_MBD) (Supplementary Figs. 1 and 2). Crystals of this MEILB2α–BRME1_MBD complex diffracted to a resolution limit of 1.50 Å, enabling structure solution by molecular replacement of ideal helical fragments using ARCIMBOLDO_LITE⁴⁵ (Table 1 and Supplementary Fig. 3). This revealed a 2:2 structure, consisting of an N-terminal parallel four-helical bundle of MEILB2 α1 and BRME1, followed by a C-terminal MEILB2 α2 parallel dimeric coiled-coil (Fig. 2b).

Table 1 Data collection, phasing and refinement statistics

Full size table

The MEILB2α–BRME1_MBD structure contains an unusual β-cap at its N-terminal tip (Fig. 2b, c). This consists of an anti-parallel two-stranded β-sheet, which is formed by the N-terminal ends of MEILB2 chains, and is orientated perpendicular to the helical axis (Fig. 2b, c). The β-cap binds together the N-termini of the two α1 helices of the four-helical bundle, so likely prevents the fraying apart of helical ends that typically occurs within coiled-coil structures⁴⁶. Hence, we infer that the β-cap likely confers rigidity to the N-terminal end of the MEILB2α–BRME1_MBD 2:2 structure. Further, the β-cap shows a high level of evolutionary conservation that is comparable to MEILB2’s α1 and ARM regions, suggesting that it is important for function (Supplementary Fig. 1a). In previous cases of α/β-coiled-coils, the β-sheets typically constitute insertions, as β-layers within the α-helical coiled-coil structure⁴⁷. For example, PDB accession 2BA2 includes a β-layer, which is similar to the β-cap, but separates rather than capping coiled-coils⁴⁸. To our knowledge, MEILB2α–BRME1_MBD is the first example of an α/β-coiled-coil in which the β-sheet caps off the end of the α-helical coiled-coil.

Following the β-cap, a MEILB2–BRME1 four-helical bundle is observed, terminating with the splaying apart of the C-termini of BRME1 chains (Fig. 2b, d). At this point, there is a slight ‘kink’ in the MEILB2 chains, between α1 and α2 helices, where L50 and N51 adopt non-helical conformations due to a single amino-acid insertion into the heptad repeats (Fig. 2e). This kink re-orientates the MEILB2 chains from the upstream four-helical bundle to the downstream dimeric coiled-coil conformation (Fig. 2b, e). The parallel dimeric coiled-coil of the α2 helix adopts a canonical heptad pattern (Fig. 2b, f). Thus, the overall structure of MEILB2α–BRME1_MBD can be described as a parallel 2:2 α/β-coiled-coil, where an N-terminal MEILB2 β-cap is followed by a MEILB2α1–BRME1 four-helical bundle that transitions via a kink into a C-terminal MEILB2 α2 dimeric coiled-coil (Fig. 2b, g).

BRME1 recruitment to meiotic DSBs requires its MEILB2-binding interface

To determine whether the MEILB2–BRME1 interaction observed in the crystal structure is crucial for their interaction in vivo, we generated a point mutant of BRME1 that specifically targets its MEILB2-binding site. The hydrophobic core of the four-helical bundle comprises highly conserved BRME1 amino acids V548, L555 and I562, which occupy the ‘a’ positions within the heptad repeats (Fig. 3a and Supplementary Fig. 1b). Therefore, we introduced glutamate mutations at these residues (V548E, L555E and I562E; hereafter referred to as 3E) to disrupt the assembly of the four-helical bundle. We confirmed this disruption biochemically, demonstrating that the 3E mutation effectively prevented the formation of the MEILB2α–BRME1_MBD complex in vitro (Fig. 3b and Supplementary Fig. 4).

**Fig. 3: The MEILB2-binding interface is required for BRME1 recruitment to meiotic DSBs.**

In a previous study, we established that GFP–BRME1 is recruited to meiotic DSBs upon expression in mouse spermatocytes through in vivo electroporation³⁶. Therefore, we employed the same system to investigate the impact of the 3E mutation on the localisation of full-length BRME1. While GFP–BRME1_FL 3E was expressed at a comparable level to the wild-type protein (Fig. 3c), it failed to be recruited to meiotic DSBs in zygotene and pachytene spermatocytes (Fig. 3d). These findings confirm that the MEILB2-binding interface of BRME1 observed in the crystal structure is solely responsible for its interaction with MEILB2 and its recruitment to meiotic DSBs in vivo.

Structure of the full MEILB2–BRME1_MBD complex

Our MEILB2α–BRME1_MBD crystal structure contains the N-terminal end of the MEILB2 α2 coiled-coil, up to amino-acid Q77 (Fig. 2b). The C-terminal end of the same coiled-coil, from the equivalent of amino-acid Q109, was observed in previous crystal structures of the BRCA2_MBD–MEILB2 ARM complex (PDB accessions 7LDG and 7BDX)^43,44. Hence, MEILB2 α2 likely forms a continuous coiled-coil that physically separates the BRME1- and BRCA2-binding regions of MEILB2. To visualise this, and build the intervening 31 residues, we generated AlphaFold2 models of the 2:2 complex between the full structured region of MEILB2 (amino-acids 22–338; herein referred to as MEILB2) and BRME1^49,50. We chose to remove the N-terminal 21 amino acids from MEILB2 as they are poorly conserved and are predicted to be unstructured, so would interfere with subsequent biophysical studies (Supplementary Fig. 1a). During modelling, we enforced the use of our MEILB2α–BRME1_MBD crystal structure and the previous BRCA2_MBD–MEILB2 ARM structure (PDB accession 7LDG)⁴³ as the sole templates. The resultant model demonstrates that the MEILB2 α2 coiled-coil can seamlessly connect the BRME1- and BRCA2-binding regions of the MEILB2 dimer (Fig. 4a and Supplementary Fig. 5). Further, it predicts an overall length of ~18 nm between the N-terminal β-cap and the C-terminal ARM domains.

**Fig. 4: Structure of the full MEILB2–BRME1_MBD 2:2 complex.**

We confirmed the validity of the MEILB2–BRME1_MBD 2:2 model by size-exclusion chromatography small-angle X-ray scattering (SEC-SAXS) analysis of the MEILB2–BRME1_MBD complex in solution. The SAXS real-space (r) pair-distance distribution indicated a rod-like molecule of 20-nm length, including a 14-nm separation between domains, consistent with the length and location of four-helical bundle and ARM domains within the model (Fig. 4b, Supplementary Fig. 6a–c and Supplementary Table 1). Further, the SAXS scattering curve was closely fitted by the MEILB2–BRME1_MBD model, similar to the fit between the SAXS data and crystal structure of the core complex, at χ² values of 2.96 and 2.50, respectively (Fig. 4b). To test the specificity of SAXS data fitting, we generated a deformed version of the MEILB2–BRME1_MBD model in which MEILB2 α1 helices and BRME1_MBD chains were folded back onto the α2 coiled-coil to create a structurally similar but shortened model (Supplementary Fig. 6d). The deformed model gave large residuals, with a χ² value of 21.08 (Fig. 4b). Hence, fitting to the MEILB2–BRME1_MBD SAXS data is sensitive to small structural changes, providing confidence that the close fit of the MEILB2–BRME1_MBD model is specific and indicative that this model accurately reflects the solution structure. Thus, we conclude that MEILB2–BRME1_MBD has a linear structure in which the N-terminal BRME1-binding core is connected to C-terminal ARM domains by a MEILB2 α2 coiled-coil (Fig. 4c).

MEILB2–BRME1_MBD binds to DNA via its β-cap

The surface electrostatics of the MEILB2–BRME1_MBD 2:2 model indicated that the N-terminal MEILB2–BRME1_MBD core contains discrete patches of basic charge, whereas the C-terminal ARM domains are predominantly acidic (Fig. 5a). Hence, we wondered whether the N-terminal end of the molecule may bind to DNA. We noticed that addition of dsDNA led to the precipitation of MEILB2–BRME1_MBD at a physiological salt concentration of 150 mM KCl, whereas the isolated protein remained soluble in these conditions (Fig. 5b). Further, using streptavidin magnetic beads, we demonstrated that a biotinylated dsDNA substrate could pulldown the MEILB2–BRME1_MBD complex at 150 mM KCl (Fig. 5c). These observations suggest that MEILB2–BRME1_MBD is a DNA-binding protein.

**Fig. 5: DNA binding is mediated by the β-cap of MEILB2–BRME1_MBD.**

The DNA-induced precipitation of MEILB2–BRME1_MBD at physiological salt concentrations precluded its study by solution biophysics methods. Instead, we used electrophoretic mobility shift assays (EMSAs) to visualise discrete protein–DNA species by loading samples at 325 mM KCl and relying on gradual salt reduction as the complex enters the gel to prevent precipitation. Using this method, we demonstrated that MEILB2–BRME1_MBD can form discrete protein–DNA complexes with dsDNA, poly-dT ssDNA and ssDNA–dsDNA junctional substrates (Fig. 5d, e and Supplementary Fig. 7a). In addition to discrete species, some material remained the wells, likely due to the same process that led to precipitation in solution (Fig. 5d, e and Supplementary Fig. 7a). DNA binding showed no overt sequence specificity or preference for dsDNA, ssDNA or ssDNA–dsDNA junctional substrates. Further, saturation occurred at ratios of one MEILB2–BRME1_MBD 2:2 complex to 10 base pairs (dsDNA) or 20 bases (ssDNA) (Fig. 5d, e). Quantification of EMSAs conducted with substrate concentrations of 50 and 100 nM, and fitting to the Hill equation, revealed positive cooperativity with binding affinities of 520 ± 60 nM and 870 ± 70 nM for dsDNA and ssDNA, respectively (Fig. 5f). These findings are consistent with MEILB2–BRME1_MBD binding to the DNA backbone, with a binding footprint spanning ten base pairs. On this basis, we chose to use dsDNA substrates in subsequent DNA-binding analyses.

Notably, the basic charge of MEILB2–BRME1_MBD is particularly concentrated at its N-terminal β-cap (Fig. 5a). Given that the β-cap stabilises the end of the coiled-coil, we hypothesised that it may serve as a rigid platform for DNA binding at the tip of the MEILB2–BRME1 complex. To test this, we introduced glutamate mutations of MEILB2 amino-acid K26, and BRME1 amino-acids R540 and R549, which are the main contributors of basic charge at the β-cap (Fig. 5g). In both cases, the mutations did not interfere with the formation of the MEILB2–BRME1_MBD 2:2 complex (Supplementary Figs. 2 and 7b, c). The MEILB2 K26E mutation largely abrogated DNA-binding of MEILB2–BRME1_MBD by EMSA, retaining only a slight hint of binding at the highest concentration (Fig. 5h). The BRME1 R540E R549E mutation completely abolished DNA binding of MEILB2–BRME1_MBD by EMSA (Fig. 5i). Further, this mutation also abrogated DNA-induced precipitation at 150 mM KCl, and abolished pulldown by biotinylated DNA (Fig. 5b, c). Thus, DNA binding is mediated by the rigid β-cap at the N-terminal tip of the MEILB2–BRME1_MBD structure (Fig. 5j). Further, MEILB2 failed to bind DNA in the absence of BRME1_MBD (Supplementary Fig. 7d). Hence, DNA binding involves amino acids from both MEILB2 and BRME1, and appears to be a consequence of complex formation rather than being an intrinsic property of either component.

BRCA2_MBD dimerises MEILB2–BRME1_MBD to form a V-shaped assembly

What is the structure of the complex formed by MEILB2–BRME1_MBD upon interaction with BRCA2_MBD? It was previously shown that BRCA2_MBD-binding dimerises ARM domains from opposing MEILB2 dimers to form a stable 2:4 complex^43,44. To test whether this also occurs in the presence of BRME1_MBD, we used size-exclusion chromatography multi-angle light scattering (SEC-MALS) to determine the oligomeric state of MEILB2–BRME1_MBD upon binding to BRCA2’s MBD (amino-acids 2232–2283; herein referred to as BRCA2_MBD). This revealed that MEILB2–BRME1_MBD and BRCA2_MBD–MEILB2–BRME1_MBD are stable 2:2 and 2:4:4 complexes, respectively (Fig. 6a and Supplementary Figs. 2 and 8a, b). We also analysed BRCA2_MBD–MEILB2–BRME1_MBD in which MEILB2 and BRCA2_MBD harboured N-terminal MBP-tags, confirming its 2:4:4 oligomeric state (Supplementary Fig. 8c). Hence, BRCA2-binding induces dimerisation of MEILB2–BRME1 to form a stable 2:4:4 ternary complex.

**Fig. 6: Structure of the BRCA2_MBD–MEILB2–BRME1_MBD 2:4:4 ternary complex.**

We next modelled the BRCA2_MBD–MEILB2–BRME1_MBD 2:4:4 structure by docking two MEILB2–BRME1_MBD models onto the constituent MEILB2 ARM dimers of the previous BRCA2_MBD–MEILB2 ARM 2:4 crystal structure (PDB accession 7LDG)⁴³ (Supplementary Fig. 9). The resultant model reveals a V-shaped assembly in which MEILB2–BRME1_MBD 2:2 complexes are held at an angle of ~95° to one another, with their opposing ARM domains stapled together by BRCA2 MBDs (Fig. 6b). The unusual architecture of this assembly imposes a separation of ~25 nm between the β-caps at the tips of its limbs (Fig. 6b). We validated this model by cryo-EM and SEC-SAXS.

First, cryo-EM reference-free 2D class averages revealed V-shaped structures in which two limbs are bound together by a globular ring-like core (Fig. 6c). These 2D class averages are consistent with the expected appearance of the same V-shaped structure when viewed in different orientations. Further, we generated an ab initio 3D model from the cryo-EM data, demonstrating a V-shaped structure, with an approximate angle of 100° between limbs and 25 nm separation between the β-caps at the tips of its limbs (Fig. 6d). The appearance and dimensions of the cryo-EM ab initio 3D model match those of our BRCA2_MBD–MEILB2–BRME1_MBD 2:4:4 model. Second, SAXS analysis confirmed that BRCA2_MBD–MEILB2–BRME1_MBD is an elongated molecule of up to 27 nm in length, consistent with the distance between β-caps, and the SAXS scattering curve was closely fitted by the 2:4:4 model (χ² = 1.36; Fig. 6e, Supplementary Fig. 10 and Supplementary Table 1). Hence, BRCA2_MBD-binding induces dimerisation of MEILB2–BRME1_MBD 2:2 complexes into a V-shaped 2:4:4 assembly, where its two limbs are held at slightly greater than right angles to one another, and the β-caps at their N-terminal tips are separated by ~25 nm (Fig. 6f).

BRCA2_MBD–MEILB2–BRME1_MBD acts as a DNA clamp

The physical separation between the two DNA-binding β-caps of the BRCA2_MBD–MEILB2–BRME1_MBD 2:4:4 ternary complex suggested that it may be able to bridge between DNA molecules. BRCA2_MBD–MEILB2–BRME1_MBD was stable at 325 mM KCl, but precipitated at a physiological salt concentration of 150 mM KCl, even in the absence of DNA. This precluded analysis of DNA binding by solution biophysics methods. Hence, we sought to visualise protein–DNA species by EMSAs, which we had previously used to overcome the DNA-induced precipitation of MEILB2–BRME1_MBD. This revealed that BRCA2_MBD–MEILB2–BRME1_MBD readily bound to a 75 base pair dsDNA substrate, forming large-scale protein–DNA structures that mostly remained in the well (Fig. 7a). We observed no overt difference in binding nature and affinity between dsDNA, ssDNA and ssDNA/dsDNA junctional substrates (Fig. 7a and Supplementary Fig. 11a–c), suggesting that binding likely occurs through the DNA backbone. Further, barely any DNA binding was observed for a BRCA2_MBD–MEILB2 complex in the absence of BRME1_MBD, indicating that it is dependent on the formation of the ternary complex (Supplementary Fig. 11d). As it is difficult to interpret the nature of large-scale protein–DNA structures that remain in the well, we additionally analysed a truncated BRCA2_MBD–MEILB2–BRME1_MBD complex that tempered DNA binding and reduced precipitation. The truncation removed basic C-terminal amino acids of BRME1 (deletion of 575-RKTK-579; herein referred to as BRME1_MBD ΔRKTK), and did not interfere with MEILB2-binding (Supplementary Fig. 12a, b). The BRCA2_MBD–MEILB2–BRME1_MBD ΔRKTK complex formed a large protein–DNA species that was successfully resolved by EMSA, and substantially reduced the amount of material retained in the well (Fig. 7b). Hence, we used the truncated ΔRKTK complex to assist in determining the nature of DNA binding by the BRCA2_MBD–MEILB2–BRME1_MBD ternary complex.

**Fig. 7: BRCA2_MBD–MEILB2–BRME1_MBD bridges between DNA molecules.**

We reasoned that if the DNA substrate were of sufficient length, it should be possible for the two β-caps of the ternary complex to bind cooperatively to the same DNA molecule. Hence, we analysed a 300 base pair substrate, which has a length of 90 nm that far exceeds the 25 nm gap between β-caps. EMSAs showed that BRCA2_MBD–MEILB2–BRME1_MBD initially formed a large resolved species with the 300 base pair substrate, and then generated larger structures that remained in the well when present at stoichiometric excess (Fig. 7c). This effect was particularly pronounced for the BRCA2_MBD–MEILB2–BRME1_MBD ΔRKTK complex, which formed small discrete species prior to assembly into larger resolved and then unresolved structures at higher ratios (Fig. 7d). These small discrete species were not present for the 75 base pair substrate (Fig. 7a, b), which has an approximate length of 25.5 nm, so is insufficient to bind and span between the two DNA-binding β-caps. Hence, the small discrete species may represent BRCA2_MBD–MEILB2–BRME1_MBD complexes bound cooperatively via both β-caps to the same DNA molecule. In contrast, the large-scale structures observed for both DNA substrates may include protein–DNA networks in which the two DNA-binding β-caps of BRCA2_MBD–MEILB2–BRME1_MBD bridge between DNA molecules. Whilst the large resolved species may be ordered protein–DNA networks, the larger species retained in the well may be more complicated assemblies that could involve both bridging interactions and the process responsible for precipitation in solution.

The BRME1 R540 R549E mutation abrogated DNA binding of the BRCA2_MBD–MEILB2–BRME1_MBD complex (Fig. 7e). As the mutated complex still precipitated at 150 mM KCl, this confirms that the DNA binding observed for the ternary complex is specific and is mediated by the β-caps. The MEILB2 K26E mutation also blocked binding of BRCA2_MBD–MEILB2–BRME1_MBD to the shorter 75 base pair substrate (Fig. 7f). However, it retained DNA binding to the longer 300 base pair substrate, albeit forming a single discrete species rather than large-scale protein–DNA structures (Fig. 7g). Importantly, the stability and 2:4:4 oligomeric state of the BRCA2_MBD–MEILB2–BRME1_MBD complex were not affected by the MEILB2 K26E mutation (Supplementary Figs. 2 and 12c). Hence, whilst the MEILB2 K26E mutation was sufficient to block DNA binding by a single β-cap, it likely retained sufficient residual affinity for the two β-caps of the V-shaped ternary complex to interact cooperatively with a sufficiently long single DNA molecule. Thus, the MEILB2 K26E mutant provides additional evidence in favour of our model.

Finally, we visualised complexes between BRCA2_MBD–MEILB2–BRME1_MBD and dsDNA by atomic force microscopy (AFM). Whilst free dsDNA molecules were clearly separated, BRCA2_MBD–MEILB2–BRME1_MBD formed large assemblies on dsDNA molecules and induced their tangling and looping (Fig. 7h). These observations are consistent with our model in which V-shaped BRCA2_MBD–MEILB2–BRME1_MBD complexes tether together DNA molecules through their β-cap DNA-binding sites. Importantly, we did not observe tangled or looped dsDNA when using BRCA2_MBD–MEILB2–BRME1_MBD complexes harbouring BRME1 R540E R549E mutation (Supplementary Fig. 13). Hence, our combined EMSA, AFM and mutant data support a model in which the two β-caps of the BRCA2_MBD–MEILB2–BRME1_MBD complex act as spatially separated DNA-binding sites that can bridge between discrete DNA molecules.

In summary, BRCA2_MBD-binding induces dimerisation of MEILB2–BRME1_MBD into a V-shaped 2:4:4 assembly, in which DNA-binding β-caps at the tips of its two limbs can independently interact with DNA molecules. Hence, BRCA2_MBD induces MEILB2–BRME1_MBD to act as a DNA clamp that holds together discrete DNA molecules, with a separation of ~25 nm (Fig. 8). Thus, we propose that within the context of their full-length molecules, BRCA2 may induce the clamping together of DNA molecules by MEILB2–BRME1 to facilitate inter-homologue recombination as part of the specialised mechanics of meiotic recombination.

**Fig. 8: Model of BRCA2_MBD-induced dimerisation of MEILB2–BRME1_MBD into a V-shaped DNA clamp.**

Discussion

The molecular programme of meiosis utilises the machinery of DNA DSB repair by homologous recombination to align and generate crossovers between homologous chromosomes that are critical for their correct segregation and the formation of haploid germ cells. The particular adaptations of meiotic recombination require several additional meiosis-specific components. These include the MEILB2–BRME1 complex, which binds directly to BRCA2 and is essential for the correct localisation of RAD51 and DMC1 recombinases to meiotic DSBs. Here, we combine crystallographic and cell biology data to report the structure of the MEILB2α–BRME1_MBD 2:2 core complex, which we combine with existing structural data to generate an experimentally validated model of the BRCA2_MBD–MEILB2–BRME1_MBD 2:4:4 ternary complex. This V-shaped structure contains DNA-binding sites at the tips of its two limbs, which are separated by 25 nm, suggesting that it may function to clamp together DNA molecules. As BRCA2_MBD-binding is necessary for dimerisation of MEILB2–BRME1_MBD into the V-shaped structure, we conclude that its proposed role as a DNA clamp occurs within the context of its complex with BRCA2 (Fig. 8).

In this study, we analysed BRCA2–MEILB2–BRME1 complexes formed by the small MBDs of BRCA2 and BRME1. This was appropriate as the MBDs are located within unstructured regions of the proteins, so are unlikely to be part of wider structures. Further, MEILB2 binds to BRME1_MBD and BRCA2_MBD with low nano-molar affinity^44,51, and the consequent MEILB2–BRME1_MBD 2:2 and BRCA2_MBD–MEILB2–BRME1_MBD 2:4:4 complexes are highly stable and monodisperse in solution (this study). Thus, it is unlikely that other regions of BRME1 and BRCA2 interfere with these oligomers. Nevertheless, we cannot exclude this possibility as we currently lack experimental data regarding the full-length BRCA2–MEILB2–BRME1 complex. Hence, the following discussion assumes that the same structures and interactions occur within the context of the full-length proteins in vivo.

What is the function of the BRCA2-induced MEILB2–BRME1 DNA clamp in meiosis? We envisage two possibilities. First, it may bridge between DSB ends, in a manner that favours their repair by inter-homologue recombination. This is reminiscent of how MRN and CtIP are proposed to tether DNA ends and affect the choice of repair pathway at DSB sites^52,53,54. However, it is difficult to see why this would be a specific requirement of meiotic recombination. Instead, it may bridge between homologous chromosomes to provide stabilising interactions between invading RAD51/DMC1-ssDNA nucleoprotein filaments and the template during inter-homologue recombination. This is our preferred model as it fulfils a unique requirement of meiosis, which is provided in mitotic recombination by cohesion between sister chromatids⁵⁵. Notably, the 25 nm distance between DNA-binding sites of the dimerised MEILB2–BRME1 complex is comparable to the ~30 nm diameter of cohesin rings⁵⁶. Hence, BRCA2-induced MEILB2–BRME1 DNA clamps may facilitate inter-homologue recombination by bridging between homologous chromosomes in the same manner as cohesin facilitates inter-sister recombination by tethering together sister chromatids. However, it is important to acknowledge that the functional significance of the DNA-binding activity of MEILB2–BRME1 has not yet been tested in vivo. Hence, the in vivo role (or even presence) of this DNA-binding activity is purely speculative and based solely on our in vitro biochemical findings.

A particular requirement of meiotic recombination is the removal of MEIOB2–SPATA22, in addition to RPA, from 3′-ssDNA overhangs for loading of RAD51 and DMC1 recombinases^16,17,18. As BRCA2–DSS1 can offload RPA¹², it was proposed that MEILB2–BRME1 may displace MEIOB2–SPATA22 during meiotic recombination²². This is supported by the co-immunoprecipitation of MEIOB–SPATA22 with MEILB2, and the accumulation of MEIOB–SPATA22 at DSBs in MEILB2 and BRME1 knockouts^34,36,38. However, it remains unknown whether MEILB2–BRME1 binds to MEIOB–SPATA22 directly. Our finding that MEILB2–BRME1_MBD binds directly to DNA, with no overt specificity for single- or double-stranded substrates, is consistent with this proposed role. Indeed, as BRCA2’s MBD is proximal to its globular DNA-binding domain, we speculate that BRCA2–DSS1 and MEILB2–BRME1 may act together, in a coordinated manner, to offload RPA and MEIOB2–SPATA22 during meiotic recombination. This may occur alongside its proposed role in bridging between DNA ends or homologous chromosomes.

Thus far, we have addressed how BRCA2-binding affects MEILB2–BRME1 structure, but we must also consider the converse issue of how MEILB2–BRME1 affects the structure of BRCA2. In isolation, BRCA2 can form monomers, dimers and larger oligomers, in a manner that involves its N-terminal and C-terminal regions, and is modulated by ssDNA, DSS1 and RAD51^57,58. Further, the BRCA2 dimer undergoes a conformational change upon binding to RAD51¹¹. In meiosis, binding to MEILB2–BRME1 would clearly dimerise BRCA2 through its MBD region. However, given the lack of high-resolution structures of BRCA2 oligomers, it is not possible to say whether this would reinforce existing dimers or form alternative oligomers. In addition, binding to MEILB2–BRME1 may alter the conformation of BRCA2, such as to affect DMC1-binding and DNA binding of the sites immediately downstream of the MBD. Any effects on the oligomeric state and conformation of BRCA2 likely favour inter-homologue rather than inter-sister recombination²². Hence, these interactions are likely to be deleterious if they occur outside of meiosis. Accordingly, MEILB2 is expressed in cancer cell lines and human tumour samples³⁵, and ectopic expression of MEILB2 inhibits homologous recombination in somatic cells^36,42. Whilst BRME1 is also upregulated in cancers and suppresses recombination upon ectopic expression³⁶, it is not yet possible to speculate how it affects recombination as the structure and function of all but the MEILB2-binding site is unknown.

A recent parallel study reported the same MEILB2α–BRME1_MBD interface and BRCA2_MBD–MEILB2–BRME1_MBD 2:4:4 complex using human sequences⁵¹, confirming that these structures are conserved between humans and mice. This study also reported that BRCA2_MBD–MEILB2 (in the absence of BRME1_MBD) forms 4:8 complexes that assemble into an interlocked ring structure⁵¹. In agreement with this, we observed that murine BRCA2_MBD–MEILB2 forms large structures in solution that are consistent with 4:8 oligomers (Supplementary Fig. 14). It remains unknown whether MEILB2 and BRME1 interact constitutively, or whether BRME1-binding dynamically controls the formation of interlocked rings or V-shaped clamp structures by BRCA2–MEILB2 during meiosis. It is possible that an interface within the interlocked ring structure may be responsible for the precipitation that we observed in solution, and may combine with bridging interactions to form the large-scale protein–DNA structures that remained unresolved during EMSA.

Overall, we propose that BRCA2-binding of MEILB2–BRME1 may clamp together homologous chromosomes, may facilitate the removal of MEIOB–SPATA22 from 3′-ssDNA overhangs, and may alter the oligomeric state and/or conformation of BRCA2. These are not mutually exclusive, so may represent multifactorial roles of MEIB2–BRME1 in meiotic recombination. Further, MEILB2–BRME1 likely acts in coordination with the DMC1-binding site and globular DNA-binding domain that are immediately downstream of the MBD. Hence, the ternary complex formed by MEILB2–BRME1, BRCA2–DSS1, RAD51 and DMC1 may operate as a single functional unit that fulfils the above roles to facilitate inter-homologue recombination. Elucidating the structure of this meiotic ‘recombinosome’, and its targeted disruption through mutagenesis in vivo, will ultimately reveal the molecular mechanisms that underpin meiotic recombination. Further, the unusual architecture imposed by MEILB2–BRME1 may provide unique structural insights that will uncover the molecular basis of the wider role of BRCA2 in recombination-mediated DNA repair.

Methods

Recombinant protein expression and purification

Constructs of mouse MEILB2 (amino-acid residues: 22–81, 22–338) and mouse BRCA2 (amino-acid residues: 2232–2283) were cloned into pMAT11⁵⁹ and pRSF-Duet1 (Merck Millipore) vectors for expression with an N-terminal TEV-cleavable His₆-MBP tag and an N-terminal TEV-cleavable MBP tag, respectively. Constructs of mouse BRME1 (amino-acid residues: 540–578 and 540–574) were cloned into pMAT11⁵⁹ and pRSF-Duet1 (Merck Millipore) vectors for expression with an N-terminal TEV-cleavable His₆ tag. Primer sequences used for cloning are included in the Source Data file. Protein constructs were expressed in BL21 (DE3) cells (Novagen), in 2xYT media, and induced with 0.5 mM IPTG for 16 h at 25 °C. Bacterial pellets were harvested, resuspended in 20 mM Tris, pH 8.0, 500 mM KCl, and lysed using a TS Cell Disruptor (Constant Systems) at 172 MPa. Cellular debris was later removed by centrifugation at 40,000 × g. Fusion proteins were purified through consecutive Ni-NTA (Qiagen), amylose (NEB), and HiTrap Q HP (Cytiva) ion exchange chromatography. The N-terminal tags were cleaved using TEV protease, and the cleaved samples were further purified through HiTrap Q HP (Cytiva) ion exchange chromatography and size-exclusion chromatography (HiLoad 16/600 Superdex 200, Cytiva) in 20 mM HEPES, pH 7.5, 150 mM KCl, 2 mM DTT for MEILB2–BRME1_MBD constructs and in 20 mM HEPES, pH 7.5, 325 mM KCl, 2 mM DTT for BRCA2_MBD–MEILB2–BRME1_MBD constructs. Purified protein samples were spin-concentrated using Amicon Ultra centrifugal filter device (10,000 NMWL), flash frozen in liquid nitrogen, and stored at −80 °C. Purified proteins were analysed using SDS–PAGE and visualised with Coomassie staining (purified samples are shown in Supplementary Fig. 2). Protein concentrations were determined using Cary 60 UV spectrophotometer (Agilent) with extinction coefficients and molecular weights calculated by ProtParam (http://web.expasy.org/protparam/).

Crystal structure of MEILB2α–BRME1_MBD core (PDB accession 7Z8Z)

MEILB2α–BRME1_MBD (22–81; 540–574) protein crystals grew upon incubation of protein at ~10 mg/ml on ice, in 20 mM HEPES pH 7.5, 150 mM KCl. Crystals were cryo-protected by the addition of 30% PEG 400, and were cryo-cooled in liquid nitrogen. X-ray diffraction data were collected at 0.9795 Å, 100 K, as four separate datasets, each of 3600 consecutive 0.10° frames of 0.020 s exposure on a Dectris Eiger2 XE 16 M detector at beamline I04 of the Diamond Light Source synchrotron facility (Oxfordshire, UK). Data were indexed, integrated in XDS⁶⁰, scaled and merged in Aimless⁶¹, using AutoPROC⁶². Crystals belong to orthorhombic space group P2₁2₁2₁ (cell dimensions a = 27.05 Å, b = 43.99 Å, c = 178.71 Å, α = 90°, β = 90°, γ = 90°), with one MEILB2–BRME1 2:2 complex in the asymmetric unit. Structure solution was achieved through fragment-based molecular replacement using ARCIMBOLDO_LITE⁶³, in which eight helices of 14 amino acids were placed by PHASER⁶⁴ and extended by tracing in SHELXE utilising its coiled-coil mode⁴⁵. A correct solution was identified by a SHELXE correlation coefficient of 46.6%. Model building was performed through iterative re-building by PHENIX Autobuild⁶⁵ and manual building in Coot⁶⁶. The structure was refined using PHENIX refine⁶⁵, using anisotropic (protein) and isotropic (water) atomic displacement parameters. The structure was refined against data to an isotropic resolution limit of 1.50 Å, to R and R_free values of 0.1965 and 0.2347, respectively, with 100% of residues within the favoured regions of the Ramachandran plot (0 outliers), clashscore of 1.85 and overall MolProbity score of 0.95⁶⁷.

Size-exclusion chromatography multi-angle light scattering (SEC-MALS)

The absolute molar masses of protein samples were determined by multi-angle light scattering coupled with size-exclusion chromatography (SEC-MALS). Protein samples at >5 mg/ml were loaded onto a Superdex 200 Increase 10/300 GL size-exclusion chromatography column (Cytiva) in 20 mM HEPES, pH 7.5, 150 mM KCl, 2 mM DTT for MEILB2–BRME1 constructs and in 20 mM HEPES, pH 7.5, 500 mM KCl, 2 mM DTT for BRCA2–MEILB2–BRME1 constructs, at 0.5 ml/min, in line with a DAWN HELEOS II MALS detector (Wyatt Technology) and an Optilab T-rEX differential refractometer (Wyatt Technology). Differential refractive index and light scattering data were collected and analysed using ASTRA 6 software (Wyatt Technology). Molecular weights and estimated errors were calculated across eluted peaks by extrapolation from Zimm plots using a dn/dc value of 0.1850 ml/g. Bovine serum albumin (Thermo Fisher Scientific) was used as the calibration standard.

Size-exclusion chromatography small-angle X-ray scattering (SEC-SAXS)

SEC-SAXS experiments were performed at beamline B21 of the Diamond Light Source synchrotron facility (Oxfordshire, UK). Protein samples at concentrations >8 mg/ml were loaded onto a Superdex™ 200 Increase 10/300 GL size-exclusion chromatography column (GE Healthcare) in 20 mM HEPES pH 7.5, 150 mM KCl, 2 mM DTT for MEILB2–BRME1_MBD constructs and in 20 mM HEPES pH 7.5, 500 mM KCl, 2 mM DTT for BRCA2_MBD–MEILB2–BRME1_MBD constructs at 0.5 ml/min using an Agilent 1200 HPLC system. The column outlet was fed into the experimental cell, and SAXS data were recorded at 12.4 keV, detector distance 4.014 m, in 3.0 s frames. ScÅtter 3.0 was used to subtract, average the frames and carry out the Guinier analysis for the radius of gyration (Rg), and P(r) distributions were fitted using PRIMUS⁶⁸. Crystal structures and models were fitted to experimental data using CRYSOL⁶⁹.

DNA-induced precipitation

To the purified MEILB2–BRME1_MBD wildtype and BRME1 R540E R549E complexes (30 µM), 75 bp dsDNA (the same substrate used for EMSA) was gently mixed to a final concentration of 1 µM (per molecule) in a buffer containing 20 mM HEPES (pH 7.5), 150 mM KCl. The samples were then centrifuged at high speed (17,000 × g) for 30 min. The pellets and supernatant solutions were analysed on SDS–PAGE.

Protein–DNA binding by streptavidin pulldown

The purified MEILB2–BRME1_MBD complex (30 µM) was incubated with and without 1 µM (per molecule) of 75 bp dsDNA (the same substrate used for EMSA) labelled with 3′ Biotin-TEG (Integrated DNA Technologies), as well as with 30 µM of MEILB2–BRME1_MBD R540E R549E in the presence of 1 µM of 75 bp DNA labelled with 3′ Biotin-TEG, in a buffer containing 20 mM HEPES (pH 7.5), 150 mM KCl, and 10% glycerol. These mixtures were incubated for 15 min at room temperature. Pierce Streptavidin Magnetic Beads (Thermo Scientific; 30 µL/reaction) were first washed three times with 1 mL of a high-salt buffer (20 mM HEPES, 1 M KCl), then three times with a low-salt buffer (20 mM HEPES, 150 mM KCl, 10% glycerol). The samples were incubated with the beads for 10–15 min, after which unbound material was removed by discarding the supernatant following magnetic separation. The beads were then washed five times with 1 mL of the low-salt buffer, and elution was performed using 20 mM HEPES (pH 7.5), 100 mM KCl, 50 µM biotin, and 1 unit of Benzonase Nuclease. The eluted samples were analysed using SDS–PAGE.

Electrophoretic mobility shift assays (EMSAs)

Protein complexes were incubated with 50 μM (per base pair) 75 bp and 300 bp linear random sequence dsDNA, 75 base FAM-poly(dT) ssDNA and 75 base/bp ssDNA–dsDNA junction, at concentrations indicated, in 20 mM HEPES pH 7.5, 325 mM KCl for 60 min at room temperature. Glycerol was added at a final concentration of 3%, and samples were analysed by electrophoresis on a 0.4% (w/v) agarose gel in 0.5x TBE pH 8.0 at 20–40 V for ~4 h at 4 °C. DNA was detected by SYBR™ Gold (Thermo Fisher). The sequences of the DNA substrates are included below.

75 bp dsDNA

ATGGAATCTAAAGAAGAATTTGTTAAAGTCAGAAAGAAGGACCTGGAACGGCTGACGACGGAAGTGATGCAAATA.

300 bp dsDNA

ATGGAATCTAAAGAAGAATTTGTTAAAGTCAGAAAGAAGGACCTGGAACGGCTGACGACGGAAGTGATGCAAATACGGGACTTCTTACCCAGAATACTAAATGGGGAGTTACTGGAAAGTTTCCAGAAATTAAAGATGGTAGAAAAAAACCTGGAAAGAAAAGAACAAGAATTAGAGCAACTGATAATGGACCGTGAACACTTCAAAGCCCGGCTAGAAACTGCACAGGCAGACAGTGGGAGGGAGAAGAAGGAGAAGTTGGCTCTTCGACAGCAGCTGAATGAGGCAAAACAGCAGCTC.

75 base FAM-poly(dT) ssDNA

FAM-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT.

75 base/bp ssDNA–dsDNA junction

CCGGCCCGCGGTGTCCGCGGGCCGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT.

K _D determination by EMSA

Quantification of DNA binding was performed through EMSA (as described above) using 50 nM FAM-labelled 75 bp random sequence dsDNA and 100 nM 75 nt poly(dT), at protein concentrations indicated. DNA was detected by FAM and SYBR™ Gold (Thermo Fisher) staining using a ChemiDoc MP Imaging System (Bio-Rad). Gels were analysed using Image Lab software (Bio-Rad). The DNA-bound proportion was plotted against molecular protein concentration and fitted to the Hill–Langmuir equation (below), with apparent K_D and Hill coefficient (n) determined, using Prism8 (GraphPad). Protein concentrations used for K_D estimation are quoted for the oligomeric species.

$$\%\,{\,{{{bound}}\; {{DNA}}}}=\frac{{{{C}}}^{{{n}}}}{{{{{K}}}_{{{D}}}}^{{{n}}}\,+\,{{{C}}}^{{{n}}}}$$

(1)

Atomic force microscopy

The purified BRCA2_MBD–MEILB2–BRME1_MBD complex was diluted to a concentration of 1–3 ng/µL in an imaging buffer containing 20 mM HEPES (pH 7.5), 325 mM KCl, with 0.6 ng/µL of linear double-stranded DNA. The protein–DNA mixture was then incubated at room temperature for 10 min. To facilitate DNA adsorption onto mica, 10 µL of filtered 0.001% poly-l-lysine solution was incubated on freshly cleaved mica for 20 s. The mica surface was then washed three times with 1 mL of filtered Bio Performance Certified (BPC) water and dried under a stream of filtered nitrogen gas. Finally, 10 µL of the protein–DNA mixture was adsorbed onto the mica surface for 10 min. Unbound material was subsequently washed off with the imaging buffer, followed by washes with BPC water, and finally dried under a stream of filtered nitrogen gas. Imaging was performed in air at room temperature, using a FastScan-A probe in Tapping on a FastScan Bio Atomic Force Microscope (Bruker).

Structural modelling of the full MEILB2–BRME1_MBD 2:2 complex

Models were generated using a local installation of AlphaFold2 v2.3.2⁵⁰ that was modified to control the use of PDB structures and newly solved crystal structures as templates. Models of the full MEILB2–BRME1_MBD 2:2 complex were generated through the multimer pipeline⁴⁹, using the MEILB2α–BRME1_MBD 2:2 core crystal structure 7Z8Z reported herein, and PDB structure 7LDG⁴³, as the sole templates. Modelling data were analysed using modules from the ColabFold notebook⁷⁰. A deformed version of the MEILB2–BRME1_MBD model was generated by introducing a turn at the kink between α1 and α2 helices of MEILB2, such that α1 helices and BRME1_MBD chains pack against α2 helices. This was performed using Coot⁶⁶ and PyMOL Molecular Graphics System, Version 2.4 Schrödinger, LLC.

Structural modelling of the BRCA2–MEILB2–BRME1 2:4:4 complex

A model of the BRCA2_MBD–MEILB2–BRME1_MBD 2:4:4 complex was generated by docking two MEILB2–BRME1_MBD 2:2 complex models onto opposing MEILB2 ARM domain dimers of the BRCA2_MBD–MEILB2 ARM 2:4 crystal structure (PDB accession 7LDG)⁴³. The docked MEILB2–BRME1_MBD 2:2 complexes and BRCA2_MBD chains from the structure were then combined. Models were generated using PyMOL Molecular Graphics System, Version 2.4 Schrödinger, LLC.

Cryo-electron microscopy (cryo-EM)

R1.2/1.3 300-mesh copper grids (Quantifoil) were glow discharged for 90 s prior to sample freezing. A volume of 4 µl of purified BRCA2_MBD–MEILB2–BRME1_MBD complex (1 mg/ml) was dispensed onto the grid, blotted for 2 s and flash frozen in liquid ethane cooled with liquid nitrogen using a Vitrobot Mark IV (Thermo Fisher) operated at 4 °C and 100% humidity. Data were collected on an FEI Tecnai F20 cryo-electron microscope operated at 200 kV equipped with a K2 Summit direct electron detector (Gatan Inc.), using SerialEM⁷¹. Movies were recorded in electron-counting mode fractionating with a total exposure of 39 e/Å². A defocus range of −0.8 to −1.5 µm was used and the physical pixel size was 1.02 Å/pixel. The movies were gain normalised, motion-corrected, and dose-weighted with MotionCo2⁷². CryoSPARC v4.3.1⁷³ was used to import micrographs, perform CTF estimation with CTFFIND4⁷⁴, pick particles, and to generate 2D class averages and a 3D ab initio model.

Protein sequence and structure analysis

MEILB2 and BRME1 sequences were aligned and visualised using MUSCLE⁷⁵ and Jalview⁷⁶. Molecular structure images were generated using the PyMOL Molecular Graphics System, Version 2.4 Schrödinger, LLC.

Mice

Wild-type mice were congenic with the C57BL/6J background. The mice are housed in IVC cages with a 12 h dark and light cycle. The temperature is 20–22 °C and the relative humidity is between 45 and 60%. The mice have bedding material in the form of wood shavings and wood litter as well as a house of paper and nesting pads as enrichment. Cage changing is done at least once a week. All animal experiments were approved by the Regional Ethics Committee of Gothenburg, governed by the Swedish Board of Agriculture (#1316/18).

Antibodies

The following antibodies were used: rabbit antibodies against GFP (Invitrogen; A11122, 2339829, 1:1000 for WB and 1:500 for IF); mouse antibodies against β-Actin (Sigma; A2228-200UL, 067M4856V, 1:2000 for WB); and chicken antibody against SYCP3 (Shibuya lab, 1:5000 for IF).

Exogenous protein expression in the testis

Plasmid DNA was electroporated into live mouse testes as previously described⁷⁷. Briefly, male mice at postnatal days 16–20 were anaesthetised, and the testes were pulled from the abdominal cavity. Plasmid DNA (10 μl of 5 μg/μl solution) was injected into each testis using glass capillaries under a stereomicroscope. Testes were held between a pair of tweezers-type electrodes (CUY21; BEX), and electric pulses were applied four times and again four times in the reverse direction at 35 V for 50 ms for each pulse. The testes were then returned to the abdominal cavity, and the abdominal wall and skin were closed with sutures. The testes were removed 24 h after the electroporation, and immunostaining was performed.

Immunostaining of spermatocytes

Testis cell suspensions were prepared by mincing the tissue with flathead forceps in PBS, washing several times in PBS, and resuspending in a hypotonic buffer (30 mM Tris (pH 7.5), 17 mM trisodium citrate, 5 mM EDTA, 2.5 mM DTT, 0.5 mM PMSF, and 50 mM sucrose). After 30 min, the sample was centrifuged and the supernatant was aspirated. The pellet was resuspended in 100 mM sucrose. After 10 min, an equal volume of fixation buffer (1% paraformaldehyde and 0.1% Triton X-100) was added. Cells were applied to a glass slide, allowed to fix for 2 h at room temperature, and air-dried. For immunostaining, the slides were incubated with primary antibodies in PBS containing 5% BSA for 2 h and then with the following secondary antibodies for 1 h at room temperature: Donkey Anti-Rabbit Alexa 488 (1:1000; Invitrogen; A21206, 2376850) and Donkey Anti-Chicken Alexa 594 (1:1000; Invitrogen; A78951, 2551396). The slides were washed with PBS and mounted with VECTASHIELD medium with DAPI (Vector Laboratories).

Microscopy

Images were obtained on a microscope (Olympus IL-X71 Delta Vision; Applied Precision) equipped with 100× NA 1.40 objective, a camera (CoolSNAP HQ; Photometrics), and softWoRx 5.5.5 acquisition software (Delta Vision). Images were processed with Photoshop (Adobe).

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

Crystallographic structure factors and atomic coordinates have been deposited in the Protein Data Bank (PDB) under accession number 7Z8Z, and raw diffraction data have been uploaded to https://proteindiffraction.org/. This study used PDB entries 7LDG and 7BDX. All data supporting the findings of this study, in addition to raw gel images, are provided in the accompanying Supplementary Information and Source data files. Source data are provided with this paper.

References

Jensen, R. B., Carreira, A. & Kowalczykowski, S. C. Purified human BRCA2 stimulates RAD51-mediated recombination. Nature 467, 678–683 (2010).
Article ADS CAS PubMed PubMed Central Google Scholar
Liu, J., Doty, T., Gibson, B. & Heyer, W. D. Human BRCA2 protein promotes RAD51 filament formation on RPA-covered single-stranded DNA. Nat. Struct. Mol. Biol. 17, 1260–1262 (2010).
Article CAS PubMed PubMed Central Google Scholar
Thorslund, T. et al. The breast cancer tumor suppressor BRCA2 promotes the specific targeting of RAD51 to single-stranded DNA. Nat. Struct. Mol. Biol. 17, 1263–1265 (2010).
Article CAS PubMed PubMed Central Google Scholar
Patel, K. J. et al. Involvement of Brca2 in DNA repair. Mol. Cell 1, 347–357 (1998).
Article CAS PubMed Google Scholar
Yu, V. P. et al. Gross chromosomal rearrangements and genetic exchange between nonhomologous chromosomes following BRCA2 inactivation. Genes Dev. 14, 1400–1406 (2000).
Article CAS PubMed PubMed Central Google Scholar
Hall, J. M. et al. Linkage of early-onset familial breast cancer to chromosome 17q21. Science 250, 1684–1689 (1990).
Article ADS CAS PubMed Google Scholar
Sharan, S. K. et al. BRCA2 deficiency in mice leads to meiotic impairment and infertility. Development 131, 131–142 (2004).
Article CAS PubMed Google Scholar
Hunter, N. Meiotic recombination: the essence of heredity. Cold Spring Harb. Perspect. Biol. 7, a016618 (2015).
Article PubMed PubMed Central Google Scholar
Zickler, D. & Kleckner, N. Recombination, pairing, and synapsis of homologs during meiosis. Cold Spring Harb. Perspect. Biol. 7, a016626 (2015).
Article PubMed PubMed Central Google Scholar
Gnugge, R. & Symington, L. S. DNA end resection during homologous recombination. Curr. Opin. Genet. Dev. 71, 99–105 (2021).
Article CAS PubMed PubMed Central Google Scholar
Shahid, T. et al. Structure and mechanism of action of the BRCA2 breast cancer tumor suppressor. Nat. Struct. Mol. Biol. 21, 962–968 (2014).
Article CAS PubMed PubMed Central Google Scholar
Bell, J. C., Dombrowski, C. C., Plank, J. L., Jensen, R. B. & Kowalczykowski, S. C. BRCA2 chaperones RAD51 to single molecules of RPA-coated ssDNA. Proc. Natl Acad. Sci. USA 120, e2221971120 (2023).
Article CAS PubMed PubMed Central Google Scholar
Kowalczykowski, S. C. An overview of the molecular mechanisms of recombinational DNA repair. Cold Spring Harb. Perspect. Biol. 7, a016410 (2015).
Article PubMed PubMed Central Google Scholar
Keeney, S., Giroux, C. N. & Kleckner, N. Meiosis-specific DNA double-strand breaks are catalyzed by Spo11, a member of a widely conserved protein family. Cell 88, 375–384 (1997).
Article CAS PubMed Google Scholar
Robert, T. et al. The TopoVIB-Like protein family is required for meiotic DNA double-strand break formation. Science 351, 943–949 (2016).
Article ADS CAS PubMed Google Scholar
Souquet, B. et al. MEIOB targets single-strand DNA and is necessary for meiotic recombination. PLoS Genet. 9, e1003784 (2013).
Article CAS PubMed PubMed Central Google Scholar
Ribeiro, J. et al. The meiosis-specific MEIOB-SPATA22 complex cooperates with RPA to form a compacted mixed MEIOB/SPATA22/RPA/ssDNA complex. DNA Repair 102, 103097 (2021).
Article CAS PubMed Google Scholar
Luo, M. et al. MEIOB exhibits single-stranded DNA-binding and exonuclease activities and is essential for meiotic recombination. Nat. Commun. 4, 2788 (2013).
Article ADS PubMed Google Scholar
Pittman, D. L. et al. Meiotic prophase arrest with failure of chromosome synapsis in mice deficient for Dmc1, a germline-specific RecA homolog. Mol. Cell 1, 697–705 (1998).
Article CAS PubMed Google Scholar
Dai, J., Voloshin, O., Potapova, S. & Camerini-Otero, R. D. Meiotic knockdown and complementation reveals essential role of RAD51 in mouse spermatogenesis. Cell Rep. 18, 1383–1394 (2017).
Article CAS PubMed PubMed Central Google Scholar
Shinohara, A. & Shinohara, M. Roles of RecA homologues Rad51 and Dmc1 during meiotic recombination. Cytogenet. Genome Res. 107, 201–207 (2004).
Article CAS PubMed Google Scholar
Zhang, J., Nandakumar, J. & Shibuya, H. BRCA2 in mammalian meiosis. Trends Cell Biol. 32, 281–284 (2022).
Article CAS PubMed Google Scholar
Lao, J. P. & Hunter, N. Trying to avoid your sister. PLoS Biol. 8, e1000519 (2010).
Article PubMed PubMed Central Google Scholar
Adams, I. R. & Davies, O. R. Meiotic chromosome structure, the synaptonemal complex, and infertility. Annu. Rev. Genomics Hum. Genet. 24, 35–61 (2023).
Article ADS CAS PubMed Google Scholar
Pellegrini, L. et al. Insights into DNA recombination from the structure of a RAD51-BRCA2 complex. Nature 420, 287–293 (2002).
Article ADS CAS PubMed Google Scholar
Martinez, J. S. et al. BRCA2 regulates DMC1-mediated recombination through the BRC repeats. Proc. Natl Acad. Sci. USA 113, 3515–3520 (2016).
Article ADS CAS PubMed PubMed Central Google Scholar
Davies, O. R. & Pellegrini, L. Interaction with the BRCA2 C terminus protects RAD51-DNA filaments from disassembly by BRC repeats. Nat. Struct. Mol. Biol. 14, 475–483 (2007).
Article PubMed PubMed Central Google Scholar
Esashi, F., Galkin, V. E., Yu, X., Egelman, E. H. & West, S. C. Stabilization of RAD51 nucleoprotein filaments by the C-terminal region of BRCA2. Nat. Struct. Mol. Biol. 14, 468–474 (2007).
Article CAS PubMed Google Scholar
Thorslund, T., Esashi, F. & West, S. C. Interactions between human BRCA2 protein and the meiosis-specific recombinase DMC1. EMBO J. 26, 2915–2922 (2007).
Article CAS PubMed PubMed Central Google Scholar
Dunce, J. M. & Davies, O. R. BRCA2 stabilises RAD51 and DMC1 nucleoprotein filaments through a conserved interaction mode. Preprint at bioRxiv https://doi.org/10.1101/2023.11.20.567968 (2023).
Yang, H. et al. BRCA2 function in DNA binding and recombination from a BRCA2-DSS1-ssDNA structure. Science 297, 1837–1848 (2002).
Article ADS CAS PubMed Google Scholar
Marston, N. J. et al. Interaction between the product of the breast cancer susceptibility gene BRCA2 and DSS1, a protein functionally conserved from yeast to mammals. Mol. Cell. Biol. 19, 4633–4642 (1999).
Article CAS PubMed PubMed Central Google Scholar
Zhao, W. et al. Promotion of BRCA2-dependent homologous recombination by DSS1 via RPA targeting and DNA mimicry. Mol. Cell 59, 176–187 (2015).
Article CAS PubMed PubMed Central Google Scholar
Zhang, J., Fujiwara, Y., Yamamoto, S. & Shibuya, H. A meiosis-specific BRCA2 binding protein recruits recombinases to DNA double-strand breaks to ensure homologous recombination. Nat. Commun. 10, 722 (2019).
Article ADS CAS PubMed PubMed Central Google Scholar
Brandsma, I. et al. HSF2BP interacts with a conserved domain of BRCA2 and is required for mouse spermatogenesis. Cell Rep. 27, 3790–3798.e3797 (2019).
Article CAS PubMed Google Scholar
Zhang, J. et al. The BRCA2-MEILB2-BRME1 complex governs meiotic recombination and impairs the mitotic BRCA2-RAD51 function in cancer cells. Nat. Commun. 11, 2055 (2020).
Article ADS CAS PubMed PubMed Central Google Scholar
Felipe-Medina, N. et al. A missense in HSF2BP causing primary ovarian insufficiency affects meiotic recombination by its novel interactor C19ORF57/BRME1. eLife 9, e56996 (2020).
Article CAS PubMed PubMed Central Google Scholar
Takemoto, K. et al. Meiosis-specific C19orf57/4930432K21Rik/BRME1 modulates localization of RAD51 and DMC1 to DSBs in mouse meiotic recombination. Cell Rep. 31, 107686 (2020).
Article CAS PubMed Google Scholar
Shang, Y. et al. MEIOK21: a new component of meiotic recombination bridges required for spermatogenesis. Nucleic Acids Res. 48, 6624–6639 (2020).
Article CAS PubMed PubMed Central Google Scholar
Li, M. et al. The novel male meiosis recombination regulator coordinates the progression of meiosis prophase I. J. Genet. Genomics 47, 451–465 (2020).
Article PubMed Google Scholar
Shang, Y. et al. MEIOK21 regulates oocyte quantity and quality via modulating meiotic recombination. FASEB J. 36, e22357 (2022).
Article CAS PubMed Google Scholar
Sato, K. et al. HSF2BP negatively regulates homologous recombination in DNA interstrand crosslink repair. Nucleic Acids Res. 48, 2442–2456 (2020).
Article CAS PubMed PubMed Central Google Scholar
Pendlebury, D. F., Zhang, J., Agrawal, R., Shibuya, H. & Nandakumar, J. Structure of a meiosis-specific complex central to BRCA2 localization at recombination sites. Nat. Struct. Mol. Biol. 28, 671–680 (2021).
Article CAS PubMed PubMed Central Google Scholar
Ghouil, R. et al. BRCA2 binding through a cryptic repeated motif to HSF2BP oligomers does not impact meiotic recombination. Nat. Commun. 12, 4605 (2021).
Article ADS CAS PubMed PubMed Central Google Scholar
Caballero, I. et al. ARCIMBOLDO on coiled coils. Acta Crystallogr. D Struct. Biol. 74, 194–204 (2018).
Article ADS CAS PubMed PubMed Central Google Scholar
Dragan, A. I. & Privalov, P. L. Unfolding of a leucine zipper is not a simple two-state transition. J. Mol. Biol. 321, 891–908 (2002).
Article CAS PubMed Google Scholar
Hartmann, M. D. et al. α/β coiled coils. eLife 5, e11861 (2016).
Shin, D. H., Kim, J. S., Yokota, H., Kim, R. & Kim, S. H. Crystal structure of the DUF16 domain of MPN010 from Mycoplasma pneumoniae. Protein Sci. 15, 921–928 (2006).
Article CAS PubMed PubMed Central Google Scholar
Evans, R. et al. Protein complex prediction with AlphaFold-Multimer. Preprint at bioRxiv https://doi.org/10.1101/2021.10.04.463034 (2021).
Jumper, J. et al. Highly accurate protein structure prediction with AlphaFold. Nature 596, 583–589 (2021).
Article ADS CAS PubMed PubMed Central Google Scholar
Ghouil, R. et al. BRCA2-HSF2BP oligomeric ring disassembly by BRME1 promotes homologous recombination. Sci. Adv. 9, eadi7352 (2023).
Article CAS PubMed PubMed Central Google Scholar
Oh, J. & Symington, L. S. Role of the Mre11 complex in preserving genome integrity. Genes 9, 589 (2018).
Article PubMed PubMed Central Google Scholar
Davies, O. R. et al. CtIP tetramer assembly is required for DNA-end resection and repair. Nat. Struct. Mol. Biol. 22, 150–157 (2015).
Article CAS PubMed PubMed Central Google Scholar
Wilkinson, O. J. et al. CtIP forms a tetrameric dumbbell-shaped particle which bridges complex DNA end structures for double-strand break repair. eLife 8, e42129 (2019).
Article PubMed PubMed Central Google Scholar
Piazza, A. et al. Cohesin regulates homology search during recombinational DNA repair. Nat. Cell Biol. 23, 1176–1186 (2021).
Article CAS PubMed Google Scholar
Nasmyth, K. How might cohesin hold sister chromatids together? Philos. Trans. R. Soc. Lond. B Biol. Sci. 360, 483–496 (2005).
Article CAS PubMed PubMed Central Google Scholar
Le, H. P. et al. DSS1 and ssDNA regulate oligomerization of BRCA2. Nucleic Acids Res. 48, 7818–7833 (2020).
Article CAS PubMed PubMed Central Google Scholar
Paul, M. W. et al. Role of BRCA2 DNA-binding and C-terminal domain in its mobility and conformation in DNA repair. eLife 10, e67926 (2021).
Article CAS PubMed PubMed Central Google Scholar
Peranen, J., Rikkonen, M., Hyvonen, M. & Kaariainen, L. T7 vectors with modified T7lac promoter for expression of proteins in Escherichia coli. Anal. Biochem. 236, 371–373 (1996).
Article CAS PubMed Google Scholar
Kabsch, W. XDS. Acta Crystallogr. D Biol. Crystallogr. 66, 125–132 (2010).
Article ADS CAS PubMed PubMed Central Google Scholar
Evans, P. R. An introduction to data reduction: space-group determination, scaling and intensity statistics. Acta Crystallogr. D Biol. Crystallogr. 67, 282–292 (2011).
Article ADS CAS PubMed PubMed Central Google Scholar
Vonrhein, C. et al. Data processing and analysis with the autoPROC toolbox. Acta Crystallogr. D Biol. Crystallogr. 67, 293–302 (2011).
Article ADS CAS PubMed PubMed Central Google Scholar
Rodriguez, D. D. et al. Crystallographic ab initio protein structure solution below atomic resolution. Nat. Methods 6, 651–U639 (2009).
Article CAS PubMed Google Scholar
McCoy, A. J. et al. Phaser crystallographic software. J. Appl. Crystallogr. 40, 658–674 (2007).
Article ADS CAS PubMed PubMed Central Google Scholar
Adams, P. D. et al. PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallogr. D Biol. Crystallogr. 66, 213–221 (2010).
Article ADS CAS PubMed PubMed Central Google Scholar
Emsley, P., Lohkamp, B., Scott, W. G. & Cowtan, K. Features and development of Coot. Acta Crystallogr. D Biol. Crystallogr. 66, 486–501 (2010).
Article ADS CAS PubMed PubMed Central Google Scholar
Chen, V. B. et al. MolProbity: all-atom structure validation for macromolecular crystallography. Acta Crystallogr. D 66, 12–21 (2010).
Article ADS CAS PubMed Google Scholar
Konarev, P. V., Volkov, V. V., Sokolova, A. V., Koch, M. H. J., & Svergun, D. I. PRIMUS: a Windows-PC based system for small-angle scattering data analysis. J. Appl. Cryst. 36, 1277–1282 (2003).
Article ADS CAS Google Scholar
Svergun, D. I., Barberato, C. & Koch, M. H. J. CRYSOL – a program to evaluate X-ray solution scattering of biological macromolecules from atomic coordinates. J. Appl. Cryst. 28, 768–773 (1995).
Article ADS CAS Google Scholar
Mirdita, M. et al. ColabFold: making protein folding accessible to all. Nat. Methods 19, 679–682 (2022).
Article CAS PubMed PubMed Central Google Scholar
Mastronarde, D. N. Automated electron microscope tomography using robust prediction of specimen movements. J. Struct. Biol. 152, 36–51 (2005).
Article PubMed Google Scholar
Zheng, S. Q. et al. MotionCor2: anisotropic correction of beam-induced motion for improved cryo-electron microscopy. Nat. Methods 14, 331–332 (2017).
Article CAS PubMed PubMed Central Google Scholar
Punjani, A., Rubinstein, J. L., Fleet, D. J. & Brubaker, M. A. cryoSPARC: algorithms for rapid unsupervised cryo-EM structure determination. Nat. Methods 14, 290–296 (2017).
Article CAS PubMed Google Scholar
Rohou, A. & Grigorieff, N. CTFFIND4: fast and accurate defocus estimation from electron micrographs. J. Struct. Biol. 192, 216–221 (2015).
Article PubMed PubMed Central Google Scholar
Madeira, F. et al. The EMBL-EBI search and sequence analysis tools APIs in 2019. Nucleic Acids Res. 47, W636–W641 (2019).
Article CAS PubMed PubMed Central Google Scholar
Waterhouse, A. M., Procter, J. B., Martin, D. M., Clamp, M. & Barton, G. J. Jalview Version 2—a multiple sequence alignment editor and analysis workbench. Bioinformatics 25, 1189–1191 (2009).
Article CAS PubMed PubMed Central Google Scholar
Shibuya, H., Morimoto, A. & Watanabe, Y. The dissection of meiotic chromosome movement in mice using an in vivo electroporation technique. PLoS Genet. 10, e1004821 (2014).
Article PubMed PubMed Central Google Scholar

Download references

Acknowledgements

We thank Diamond Light Source and the staff of beamlines I04 and B21 (proposal mx25233), the cryo-EM facility in the School of Biological Sciences at the University of Edinburgh (SULSA and Wellcome Grant 087658/Z/08/Z) and the Atomic Force Microscopy Facility in the School of Engineering at the University of Edinburgh. This work was supported by a Wellcome Senior Research Fellowship 219413/Z/19/Z (O.R.D.), a core grant to the Wellcome Centre for Cell Biology 203149 (O.R.D.), the Structural Biology core of the Wellcome Discovery Research Platform for Hidden Cell Biology 226791 (O.R.D.), and the European Research Council StG-801659 (H.S.).

Author information

Authors and Affiliations

Wellcome Centre for Cell Biology, Institute of Cell Biology, University of Edinburgh, Edinburgh, UK
Manickam Gurusaran & Owen R. Davies
Department of Chemistry and Molecular Biology, University of Gothenburg, Gothenburg, Sweden
Jingjing Zhang, Kexin Zhang & Hiroki Shibuya
Laboratory for Gametogenesis, RIKEN Center for Biosystems Dynamics Research (BDR), Kobe, Hyogo, Japan
Hiroki Shibuya

Authors

Manickam Gurusaran
View author publications
Search author on:PubMed Google Scholar
Jingjing Zhang
View author publications
Search author on:PubMed Google Scholar
Kexin Zhang
View author publications
Search author on:PubMed Google Scholar
Hiroki Shibuya
View author publications
Search author on:PubMed Google Scholar
Owen R. Davies
View author publications
Search author on:PubMed Google Scholar

Contributions

M.G. performed all the in vitro experimental work; J.Z. and K.Z. performed the in vivo experimental work under the supervision of H.S.; M.G. and O.R.D. designed experiments and analysed data; and O.R.D. wrote the manuscript.

Corresponding author

Correspondence to Owen R. Davies.

Ethics declarations

Competing interests

The authors declare no competing interests.

Peer review

Peer review information

Nature Communications thanks John Weir and the other anonymous reviewer(s) for their contribution to the peer review of this work. A peer review file is available.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Supplementary Information

Peer Review File

Reporting Summary

Source data

Source Data

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Gurusaran, M., Zhang, J., Zhang, K. et al. MEILB2-BRME1 forms a V-shaped DNA clamp upon BRCA2-binding in meiotic recombination. Nat Commun 15, 6552 (2024). https://doi.org/10.1038/s41467-024-50920-x

Download citation

Received: 12 October 2023
Accepted: 24 July 2024
Published: 02 August 2024
Version of record: 02 August 2024
DOI: https://doi.org/10.1038/s41467-024-50920-x

This article is cited by

Biallelic BRCA2 variants induce premature ovarian insufficiency by impaired meiotic homologous recombination
- Xinyi Wu
- Qian Zhang
- Ting Guo
Communications Biology (2025)
BRCA2 stabilises RAD51 and DMC1 nucleoprotein filaments through a conserved interaction mode
- James M. Dunce
- Owen R. Davies
Nature Communications (2024)