Murine hematopoietic progenitor cell lines with erythroid and megakaryocyte potential

Wu, Ruiqiong; Salehi, Faraz; Redecke, Vanessa; Ma, Zhijun; Marchetti, Marco; Finkelstein, David; Xu, Peng; Cheng, Yong; Queisser, Kimberly A.; Petrey, Aaron C.; Field, Conroy O.; Ahn, Hyun Sook; Poncz, Mortimer; Weiss, Mitchell J.; Häcker, Hans

doi:10.1038/s41467-025-62668-z

Download PDF

Article
Open access
Published: 07 August 2025

Murine hematopoietic progenitor cell lines with erythroid and megakaryocyte potential

Ruiqiong Wu¹^na1,
Faraz Salehi ORCID: orcid.org/0000-0003-0104-7882²^na1,
Vanessa Redecke²,
Zhijun Ma³,
Marco Marchetti⁴,
David Finkelstein⁵,
Peng Xu¹^nAff8,
Yong Cheng¹,
Kimberly A. Queisser⁶,
Aaron C. Petrey⁶,
Conroy O. Field⁷,
Hyun Sook Ahn⁷,
Mortimer Poncz ORCID: orcid.org/0000-0001-7237-3613⁷,
Mitchell J. Weiss ORCID: orcid.org/0000-0002-6734-4858¹ &
…
Hans Häcker ORCID: orcid.org/0000-0001-5971-0451²

Nature Communications volume 16, Article number: 7283 (2025) Cite this article

3166 Accesses
10 Altmetric
Metrics details

Subjects

Abstract

Red blood cells and platelets derive from bi-potential bone marrow megakaryocyte-erythroid progenitors, but their study is constrained by cell scarcity and limited experimental systems. Here we show that conditional expression of a virally transduced, regulated form of Hoxa7 enables expansion of murine cells resembling megakaryocyte-erythroid progenitors (Hoxa7-TPO), which undergo erythro-megakaryocytic differentiation upon Hoxa7 inactivation. The close relationship of Hoxa7-TPO cells to megakaryocyte-erythroid progenitors is supported by genetic and phenotypic analyses, and mature Hoxa7-TPO-derived red blood cells and platelets are largely indistinguishable from their primary counterparts. Genetic knock-out studies in Hoxa7-TPO cells recapitulate the key function of Klf1 and Nfe2 in red blood cell and platelet development, respectively, while disruption of the von Willebrand receptor gene Gp1ba recapitulates features of human Bernard-Soulier syndrome. Hence, we developed a versatile experimental system for expansion and differentiation of megakaryocyte-erythroid progenitors to study red blood cell and platelet development and model human diseases.

The GPI-anchored protein CD109 protects hematopoietic progenitor cells from undergoing erythroid differentiation induced by TGF-β

Article 06 November 2021

Multiparameter analysis of timelapse imaging reveals kinetics of megakaryocytic erythroid progenitor clonal expansion and differentiation

Article Open access 28 September 2022

High-throughput enrichment and isolation of megakaryocyte progenitor cells from the mouse bone marrow

Article Open access 15 April 2021

Introduction

Adult hematopoiesis is initiated in the bone marrow (BM) from hematopoietic stem cells (HSC). HSCs restrict their lineage potential progressively, producing intermediate multipotent progenitors (MPPs) that eventually differentiate via intermediate cell types into mature blood cells. One well-characterized intermediate cell type is the Megakaryocyte (MK)-Erythroid progenitor (MEP), which gives rise to red blood cells (RBC) and MK/ platelets, but lacks lineage potential for major immune cell types, such as macrophages, granulocytes and lymphocytes^1,2. Given the key effector functions of RBC and platelets, i.e., oxygen transport and primary hemostasis, respectively, regulation of MEP biology is critical for balanced hematopoiesis and human health. Key factors that control cell differentiation of MEP towards RBC and platelets have been defined. However, more detailed investigations are difficult due to a lack of suitable experimental systems. We previously showed that a combination of regulated HOXB8 and defined growth factors conditionally immortalize macrophage- and neutrophil-committed progenitors or multipotent progenitors with myeloid and lymphoid potential^3,4. This approach takes advantage of the well-characterized function of Hox genes to block cell differentiation in favor of self-renewal, which is also the basis for the established oncogenic role of various Hox family members⁵. This property is also well illustrated by Hoxa7. Genetic deficiency of Hoxa7 in mice results in reduced numbers of MEPs, while inappropriate expression is a feature of leukemias harboring mixed-lineage leukemia (MLL) mutations, reflecting reduced and increased self-renewal, respectively^6,7.

Here we show that a combination of an estrogen-regulated form of Hoxa7 and thrombopoietin (TPO) can be used to conditionally immortalize MEP-like cells, which can be expanded in vitro for extended periods of time in the presence of estrogen (activating Hoxa7) and differentiate faithfully into RBC and platelets upon estrogen withdrawal (inactivating Hoxa7) in the presence of suitable growth factors in vitro or in vivo.

Results

Generation of Hoxa7-TPO cells

To investigate if MEP could be targeted by a regulated Hox gene, we transduced largely unfractionated BM cells, which had briefly been expanded in vitro, with a murine stem cell virus (MSCV)-based retroviral vector expressing an estrogen-activated form of Hoxa7. The fusion construct, ERHBD-Hoxa7, consists of Hoxa7 fused to the hormone-binding domain of the estrogen receptor (ERHBD) containing the characterized G400V substitution, which renders the hormone-binding domain insensitive to physiological concentrations of estrogen or phenol red contained in growth medium⁸. As noted, Hoxa7 was previously shown to cause selective deficiency of MEPs and, therefore, we hypothesized that its sustained expression might support expansion of MEPs⁶. As expected, cells transduced with a control vector eventually stopped growing in the presence of estrogen and TPO, whereas treatment of ERHBD-Hoxa7-transduced cells with estrogen (activating Hoxa7) and TPO led to exponential expansion of blast-like cells, whose survival was strictly dependent on TPO (Fig. 1a–d). These cells proliferated for extended periods of time, and karyotype analysis after one year of continuous cell culture showed no detectable abnormalities (Supplementary Fig. 1a, b). Thus, TPO in context with conditionally activated Hoxa7 can be used to generate genetically stable, growth-factor-dependent cell lines.

**Fig. 1: Generation of conditionally immortalized hematopoietic progenitor cell lines based on *Hoxa7* and TPO.**

Phenotype analysis and megakaryocyte potential of Hoxa7-TPO cells in vitro

Consistent with their blast-like morphology, flow cytometry analysis showed that Hoxa7-TPO cells expressed the progenitor marker c-kit at high levels, but were negative for cell lineage markers, including Ter119, CD41, CD16/32, B220, CD11c, CD115, CD4, and CD8 (Fig. 1e and Supplementary Fig. 2). CD34 and Sca-1, which are expressed on early hematopoietic stem and progenitor cells (HSPC) were not expressed at detectable levels. Interestingly, CD150, which is expressed at high levels in progenitor cells with MK and erythroid potential (Pre MegE) and CD105, which is increasingly up-regulated during RBC development, were expressed at robust levels on Hoxa7-TPO cells (Fig. 1e)⁹.

To determine if Hoxa7-TPO cells could differentiate in vitro into MKs, we removed estrogen (to deactivate Hoxa7) and continued to culture the cells in medium containing TPO. Under these conditions the cells ceased to proliferate, and after 4 days, they had formed large cells with up to 16 nuclei (32 N) that were indistinguishable from primary MKs (Supplementary Fig. 3b and Fig. 2a–c). The homogeneity of Hoxa7-TPO-derived cells allowed direct analysis without further enrichment, while BM-derived MKs required enrichment by BSA gradient, a commonly used method to increase homogeneity of primary MKs¹⁰. Similar to BM-derived MKs, Hoxa7-TPO-derived MKs produced proplatelets, which could be detected by phase contrast microscopy, but were particularly apparent when analyzed by differential interphase contrast (DIC) microscopy (Fig. 2d, e)^11,12. Quantitative analysis showed a similar percentage of Hoxa7-TPO- and BM-derived MKs participating in proplatelet formation (Fig. 2f). A more detailed kinetics analysis of Hoxa7-TPO cells during TPO-driven cell differentiation using flow cytometry (CD41, CD42d, Hoechst H33342) and microscopy showed that the cells start to increase their size already by day 1 after estrogen withdrawal, with increasing surface expression of CD41 and CD42d at day 2 (Fig. 2g–j and Supplementary Fig. 3b). Cells containing more than one nucleus indicative of endomitosis became apparent at day 3, after which cell differentiation was rapidly progressing and largely completed by day 5, although polyploidy was further increased at day 7 (Fig. 2h). As noted, a particularly obvious aspect of this process employing Hoxa7-TPO cells is the homogeneity of the mature MK cell population generated, which sets it apart from primary BM cultures. Together, the data suggest that Hoxa7-TPO cells have MK potential that can be realized in vitro to generate homogenous, mature MK cell populations of essentially unlimited cell numbers that resemble phenotypically primary MKs.

**Fig. 2: Phenotype analysis and in vitro MK differentiation of Hoxa7-TPO cells.**

Transcriptional analysis of Hoxa7-TPO cells and primary hematopoietic cell types

To further characterize Hoxa7-TPO cells, we performed RNAseq analyses of four independently established bulk cell populations, either in their non-differentiated state or after differentiation in the presence of TPO for four days. Interestingly, gene expression-based correlation analyses with defined primary hematopoietic cell populations (available through Hemopedia¹³) showed the strongest correlation of non-differentiated Hoxa7-TPO cells with bi-potent megakaryocyte/ erythroid progenitors (MEP), followed by immature MK and colony-forming units-erythroid (CFUE). Less differentiated HSPC, including long-term hematopoietic stem cells (LT-HSC) and MPP, as well as myeloid progenitors (granulocyte monocyte progenitors (GMP) and lymphoid progenitors (common lymphoid progenitors (CLP), Pro B-cells) were more distantly related (Fig. 3a). Global comparison of non-differentiated vs. differentiated cells illustrated a massive change in gene expression (Fig. 3b and Supplementary Data 1). Cells differentiated in the presence of TPO had lost apparent similarity to progenitor cells, but exhibited a very strong correlation with MKs, followed by reticulocytes (Fig. 3c). Up-regulation of two MK signature genes, Pf4 and Vwf, in TPO-differentiated Hoxa7-TPO cells was confirmed by Q-PCR (Fig. 3d). The fundamental changes in gene regulation during cell differentiation were recapitulated on the level of lineage-defining factors, including Mpl and Itga2b, as expected (Supplementary Fig. 4). They were also recapitulated by gene ontology analyses, illustrating for example up-regulation of autophagy-related genes and down-regulation of RNA synthesis-related genes in mature MK (Supplementary Fig. 5 and Supplementary Data 2). This analysis also shows the down-regulation of mitotic cell cycle-related genes in mature MK (and their up-regulation in RBC, see below), which is consistent with the negative correlation of cell cycle kinetics and MK differentiation of primary MEP (Supplementary Fig. 5)¹⁴. Taken together, the data show that Hoxa7-TPO-derived mature MKs resemble transcriptionally their primary counterparts. The close relationship with MEP and co-expression of CD105 and CD150 indicated that Hoxa7-TPO cells might have both MK and erythroid potential.

**Fig. 3: Transcriptomics-based comparative analysis of Hoxa7-TPO cells and primary hematopoietic cell types.**

In vivo potential of Hoxa7-TPO cells

To evaluate the in vivo lineage potential of Hoxa7-TPO cells, we established cell lines using BM from GFP-transgenic mice, which express GFP in all hematopoietic lineages, facilitating their identification by flow cytometry¹⁵. Cells grown in the presence of TPO and estrogen were adoptively transferred to lethally irradiated mice (along with a small number of GFP-negative BM helper cells from isogenic mice), and the generation of GFP⁺ Hoxa7-TPO-derived cells was analyzed in the peripheral blood (PB) over time. One week after transfer, substantial levels of Hoxa7-TPO-derived platelets were apparent in all mice adoptively transferred with independently established Hoxa7-TPO cell populations (Fig. 4a, b). Cell size of Hoxa7-TPO-derived platelets was comparable to BM-derived platelets under various conditions, including mice transferred with Hoxa7-TPO cells and mice transplanted with GFP + BM to mimic adoptive transfer conditions (Supplementary Fig. 6). Owing to the low number of BM cells transferred (2x10e5 cells) and the early time point of analysis, endogenous, host-derived platelets in Hoxa7-TPO-transferred mice likely represent exclusively cells that survived irradiation, rather than de-novo, donor-derived cells. To analyze morphological and functional aspects of Hoxa7-TPO-derived platelets, we transferred non-differentiated Hoxa7-TPO cells into PF4-Cre-iDTR mice, in which MK and platelets can be eliminated efficiently by in vivo administration of diphtheria toxin (DT), thereby increasing the percentage of Hoxa7-TPO-derived mature platelets (see Methods section). 6 days after transfer, platelets were isolated and analyzed by immuno-fluorescence with antibodies against β-tubulin, von Willebrand factor (vWF) and GFP, the latter identifying Hoxa7-TPO-derived cells. As shown in Fig. 4c, Hoxa7-TPO-derived cells showed a typical platelet morphology as reflected by a classic tubulin ring surrounding granular vWF, similar to endogenous platelets of untreated control mice. Moreover, when plated on fibrinogen, both Hoxa7-TPO-derived and endogenous platelets exhibited characteristic, actin-dependent spreading of platelets (Fig. 4d).

Hoxa7-TPO-derived platelets largely disappeared by day 14 after transfer, consistent with terminal differentiation accompanied by loss of self-renewal of Hoxa7-TPO cells in the absence of exogenous estrogen and the relatively short half-life of mouse platelets (Fig. 4a)¹⁶. In contrast, GFP+ Ter119+ RBC were detected at day 7 after Hoxa7-TPO cell transfer, reached peak levels at day 14 and remained present after six weeks, reflecting the 38 to 52 day in vivo half-life of RBC¹⁷ (Fig. 4a, b). Morphologically Hoxa7-TPO-derived RBC were indistinguishable from endogenous cells (Fig. 4e). We noted a population of GFP⁺ Ter119^- RBC, which was detected primarily at early time points and progressively lost thereafter (Fig. 4a). Morphologically, these cells were very similar to Ter119⁺ RBC (Fig. 4e). We speculate that these cells represent less mature RBC, which may be generated under the very particular conditions in irradiated mice. This interpretation is consistent with the smaller percentage of these cells found in endogenous RBC populations, which consist largely of aged cells that persist after lethal irradiation. The Hoxa7-TPO cells produced very few white blood cells (WBC) in vivo, in contrast to Hoxb8-FL cells, which represent conditionally immortalized WBC progenitors, but lack potential for platelet and RBC development⁴ (Fig. 4f). To exclude the possibility that the bi-lineage potential of Hoxa7-TPO cell populations was due to a mixture of cells with lineage potential for either platelets or RBC, we established single cell clones and evaluated their lineage potential in adoptive transfer experiments. Most clones maintained both platelet and RBC potential, similar to what we observed in bulk cell (non-clonal) populations (Fig. 4g, h). While the overall lineage output of individual clones varied, platelet and RBC potential correlated quite well, as reflected by a Pearson correlation index of 0.46 (Supplementary Fig. 7). As such, some clones appeared to possess an overall higher lineage potential. However, we note that the cloning procedure itself may exert stress on the cell lines, which may contribute to differences in linage output. Cryopreserving established Hoxa7-TPO cells in liquid nitrogen did not reduce cell performance as assessed by recovery and adoptive transfer of Hoxa7-TPO cells that had been cryopreserved for 4 years in liquid nitrogen (Supplementary Fig. 8a–c). Together with results obtained by flow cytometry and gene expression analyses, the data suggest that Hoxa7-TPO cells correspond closely to primary MEP, with potential for megakaryocyte and erythroid lineages.

Functional analysis of Hoxa7-derived platelets

Thrombin treatment of platelets induces their activation markers and aggregation, reflecting essential, physiological functions. To determine if Hoxa7-TPO-derived platelets maintained these effector functions, we analyzed platelets from the PB of adoptively transferred mice in comparison to endogenous platelets from the same mice. Hoxa7-TPO-derived platelets showed thrombin-induced CD62P up-regulation comparable to endogenous platelets (Fig. 5a and Supplementary Fig. 8d). Moreover, thrombin treatment resulted in aggregation of Hoxa7-TPO-derived platelets, reflected by loss of single platelets, which was largely comparable to their endogenous counterparts (Fig. 5b). Slight differences may be due to the fact that Hoxa7-TPO-derived platelets represent newly generated (younger) cells, while endogenous platelets are largely composed of older cells that persist after lethal irradiation. Thus, the data suggest that Hoxa7-derived platelets are functionally active.

**Fig. 5: Functional analysis of Hoxa7-TPO-derived platelets.**

To confirm and extend the functional activity of the Hoxa7-TPO-derived platelets, we studied their hemostatic efficacy in a cremaster arteriole vascular injury in situ microscopy model in which thrombus formation can be visualized in real time¹⁸. To limit the contribution of the endogenous platelets, we used previously described Mpl^-/- mice as the recipients, in which platelet counts are reduced by approximately 60–80% compared to wildtype (WT) C57B/6 mice¹⁹. Three distinct groups of mice were studied, i.e., (i) untreated Mpl^-/- control mice, (ii) irradiated Mpl^-/- control mice receiving only a small number of wildtype helper BM cells, and (iii) irradiated Mpl^-/- mice receiving wildtype BM helper cells plus non-differentiated Hoxa7-TPO cells (Fig. 5c). Whole blood flow cytometry analysis from these mice showed that the relative number of platelets was ~4–6% of the total cells. In mice transplanted with BM plus Hoxa7-TPO cells, roughly two-thirds of platelets were derived from the Hoxa7-TPO cells (Fig. 5d). All three groups were studied for hemostatic efficacy by in situ microscopy of clot formation following laser injury to cremaster arterioles. Compared to untreated Mpl^-/- mice or Mpl^-/- mice transplanted with only BM helper cells, the concurrent presence of BM- and Hoxa7-TPO-derived platelets led to a more vigorous thrombus formation at the site of injury, with Hoxa7-TPO-derived platelets contributing the majority of clot formation (~60%)(Fig. 5c–g and Supplementary Fig. 9). Interestingly, the presence of Hoxa7-TPO-derived platelets increased the incorporation of endogenous (Mpl-deficient) platelets into thrombi significantly, likely compensating for the functional deficiency of Mpl-deficient platelets (Fig. 5f, g). Thus, Hoxa7-TPO-derived platelets exhibit hemostatic function, as evidenced by their contribution to thrombus formation after arteriole vascular injury.

RBC development of Hoxa7-TPO cells in vivo

We isolated Hoxa7-TPO-derived reticulocytes from mice and analyzed their gene expression profile, which confirmed their close relation to primary reticulocytes and dissimilarity to other hematopoietic cell types (Fig. 6a)²⁰. Similar to Hoxa7-TPO-derived MK, the gene expression profile of Hoxa7-TPO-derived reticulocytes was fundamentally different from the parent undifferentiated cells grown in estrogen-containing medium. In particular, differentiation to the RBC lineage was associated with induction of signature erythroid genes, such as Zfpm1, Alad, Hbb and Hba and regulation of proteolysis- and RNA-metabolic processes identified by Gene Ontology analysis (Supplementary Figs. 4 and 5). As noted, mitotic cell cycle-related genes were up-regulated in RBC compared to undifferentiated cells, consistent with the positive correlation of cell cycle kinetics and RBC differentiation (Supplementary Fig. 5)¹⁴. Hoxa7-TPO-derived RBC exhibited a classic hemoglobin α/β profile characteristic of adult-type mouse RBC, similar to endogenous RBC (Fig. 6b). Last, based on established maturation steps defined using forward scatter and CD44 expression of Ter119-positive cells, we analyzed the maturation of GFP + , Hoxa7-TPO-derived erythroid progenitors over time²¹. While Hoxa7-TPO cells were merely detectable in the BM at day 1-3 after adoptive transfer, proerythroblasts appeared at day 4, then declined in frequency two days later (Fig. 6c, d). Basophilic RBC appeared on day 4 and day 6, followed by the appearance of polychromatic and orthochromatic erythroblasts. Reticulocytes and mature RBC were detected on day 6 after adoptive transfer (Fig. 6c, d). These data show that after adoptive transfer, Hoxa7-TPO cells can form committed erythroid progenitors that undergo synchronous terminal maturation with a trajectory that defines normal erythropoiesis. Moreover, the resultant RBCs exhibit normal morphology and hemoglobin content and in vivo lifespan.

**Fig. 6: Analysis of Hoxa7-TPO-derived RBC.**

RBC development of Hoxa7-TPO cells in vitro

Given the RBC potential of Hoxa7-TPO cells in vivo, we tested if Hoxa7-TPO cells could also differentiate into RBC in vitro simply by removing estrogen and culturing the cells in the presence of erythropoietin (EPO). Indeed, as assessed by flow cytometry, the cells survived largely in the presence of EPO and started to reduce CD44 expression after day 4, accompanied by up-regulation of Ter119 in ~25% of the cells (Fig. 7a and Supplementary Fig. 3c). This phenotype was also accompanied by a progressive reduction of cell size, as apparent by microscopy using phase contrast and May-Grünwald-Giemsa-staining (Fig. 7b, c). Flow cytometry sorting based on staining for Ter119 and the DNA dye Hoechst 33342, followed by cytospin/ May-Grünwald-Giemsa staining revealed late stage nucleated erythroblasts, enucleated cells (reticulocytes) and extruded nuclei (pyrenocytes) (Fig. 7d). As expected, cells differentiated under these conditions displayed a red cell pellet, reflecting hemoglobinization (Fig. 7e). We also tested the formation of burst forming units-erythroid (BFU-E) and colony forming units-erythroid (CFU-E) using the commercial MegaCult system (StemCell), but did not observe such colonies. We speculate that colony formation may depend on factors absent in our in vitro-culture system (provided by the in vivo BM environment), which will however require further studies. In any case, Hoxa7-TPO cells display RBC potential in vivo and in vitro.

**Fig. 7: In vitro cell differentiation of Hoxa7-TPO cells in the presence of EPO.**

Alteration of cell cycle kinetics biases the differentiation of Hoxa7-TPO cells

Cell cycle kinetics can influence MEP differentiation toward RBC (cell cycle activation) or MK (cell cycle slowing)¹⁴. To investigate if Hoxa7-TPO cells recapitulated this MEP property, we established cell culture conditions suitable for simultaneous differentiation of both MK and RBC, and added all-trans retinoic acid (ATRA), which downregulates cyclins and cyclin-dependent kinases, reducing cell cycle progression²². Indeed, ATRA treatment increased the number of Hoxa7-TPO-derived MK and, simultaneously, reduced the number of RBC precursors (Fig. 7f). As noted, these data are also consistent with described ontogeny analysis, showing up- and down-regulated mitotic cell cycle-related genes in Hoxa7-TPO-derived RBC and MK, respectively (Supplementary Fig. 5). Thus, Hoxa7-TPO cells differentiate according to cell cycle cues in a similar manner as primary MEP¹⁴.

Hoxa7-TPO cells as tool for CRISPR/Cas9-mediated loss-of-function studies

An important future application for Hoxa7-TPO cells will be to analyze gene function by genetic modification. This includes generation of Hoxa7-TPO cells from BM of genetically modified mice or, alternatively, the genetic modification of established wild-type Hoxa7-TPO cells by gain- or loss-of-function approaches, including retroviral overexpression or CRISPR/Cas9-mediated deletion of genes of interest. To test this concept, we used CRISPR/ Cas9-mediated non-homologous end joining to disrupt three different genes with important functions in RBC or platelet development: (i) Nfe2, which encodes a transcription factor that is essential for normal MK and platelet production^20,23; (ii), Gp1ba, which encodes the CD42b subunit of the platelet vWF receptor and is mutated in Bernard-Soulier syndrome, a macrothrombocytopenia with platelet dysfunction and bleeding diathesis^24,25,26,27; and (iii) Klf1, which encodes a transcription factor that positively regulates differentiation of MEPs into erythroid precursors and their maturation into RBCs. Biallelic disruption of Klf1 causes defective erythropoiesis and increased platelet numbers^28,29. We achieved efficient targeting of Nfe2, Gp1ba and Klf1 with Cas9 and specific gene-targeting small guide RNAs (sgRNAs)(Supplementary Fig. 10). Disruption of Nfe2 or Gp1ba led to strong reductions in platelet numbers without significant impact on RBC generation, consistent with the known functions of these genes (Fig. 8a). Reduced platelet numbers from GP1BA-deficient cells were accompanied by increased cell size, as apparent by IF analysis and flow cytometry, recapitulating the platelet phenotype of the Bernard-Soulier syndrome (Fig. 8b, c and Supplementary Fig. 11). Abnormally increased platelet size and reduced platelet production were particularly profound with Gp1ba sgRNA-2, which was associated with a higher targeting efficiency than Gp1ba sgRNA-1. Contrasting with the effects of Gp1ba or Nfe2 on platelet production, disruption of Klf1 in Hoxa7-TPO cells led to a strong reduction of RBC output in vivo and significantly increased platelet numbers, similar to observations in Klf1-targeted mice (Fig. 8a)^{28,30,31,32,33}. Together, these findings demonstrate that Hoxa7-TPO cells represent a facile model for examining human blood disorders and for analyzing efficiently the gene regulatory networks that control platelets and RBC formation from MEPs.

**Fig. 8: CRISPR/ Cas9-mediated deletion of key differentiation factors.**

Discussion

This work describes a simple method to generate hematopoietic progenitor cells lines with erythroid and MK potential. Similar to earlier methods that target WBC precursors, this approach is based on regulated Hox gene expression in combination with a defined growth factor, which block cell differentiation and promote cell proliferation, respectively³⁴. An important observation from these studies was that the growth factor present during ex vivo expansion of Hox gene-expressing cells resulted in the expansion of specific progenitors from a mixed BM population⁵. For example, while GM-CSF in context with regulated Hox gene led to expansion of a macrophage precursor, FLT3L promoted expansion of a multipotent progenitor cell type with myeloid and lymphoid potential³⁴. Consistent with the current study, the TPO receptor is expressed on MEPs, but not committed myeloid/ lymphoid progenitors, which likely explains how TPO selectively expands Hox-expressing MEP-like cells, while other progenitors and more differentiated cells are lost during cell propagation. Although there was some variation related to the output of RBC and platelets in vivo, all cell lines established and, importantly, all clones derived thereof, exhibited dual lineage potential, suggesting an overall homogenous nature of established cell lines. Homogeneity is also supported by transcriptional analyses, which further supports the close relationship of Hoxa7-TPO with MEP and a more distant relationships to all other progenitor cell types. While karyotype analysis indicated that Hoxa7-TPO cells are genetically stable for up to one year, functional analyses including cell cloning and sgRNA treatment, were restricted to ~8 weeks of continuous in vitro cell culture. As for any other cell line, it seems advisable to restrict cell culture periods as far as possible to avoid changes in key parameters, such as differentiation potential.

Whether the Hoxa7 gene is specifically required for MEP expansion or if other Hox genes such as Hoxb8, can be used to expand cells with similar lineage potential, remains unexplored. Likewise, whether the approach described here can be used to conditionally immortalize human MEP requires further study. In general, the factors governing Hox gene specificity remain largely unexplored. This is at least in part due to their low expression levels, their short residence time on chromatin, their cooperation with other proteins regulating specificity and, not least, the low number of endogenous, hematopoietic cells available for investigation³⁴. Regarding the latter aspect, the Hoxa7-TPO cell line described here may be a useful tool to define Hoxa7-specific functions in MEPs.

Upon repression of Hoxa7 by estrogen withdrawal, Hoxa7-TPO cells differentiate via a series of defined precursors into mature RBC and platelets, which are largely indistinguishable from their primary counterparts with respect to morphology, gene transcription and function, e.g. platelet aggregation and thrombus formation. As such, this method facilitates the analysis of erythroid and MK cell differentiation and the functional investigation of the respective mature cell progeny. Various cellular systems to investigate MK and/or RBC development have been established. This includes MK cell lines (MEG-01, K562, 3T3-L1 preadipocytes), embryonic stem (ES)-cell/ induced pluripotent stem cell (iPS)-derived MKs, conditionally immortalized MK progenitors and ex vivo isolated, primary cells. These systems, however, have limitations related to partial or defective terminal cell differentiation (MK cell lines), complexity and duration of cell generation (ES/ iPS cells), restriction to the MK/ platelet lineage (conditional MK progenitors) or relatively low cell numbers available for manipulation and analysis (primary cells)^{35,36,37,38,39,40,41}. Related to the erythroid lineage, similar systems have been established, including cell lines (MEDEP, HUDEP, HiDEP, EJ, BEL-A, BEL-C, JK-1), ES/ iPS-derived RBC and isolation of primary cells^{42,43,44,45,46,47}. These systems, however, show similar limitations related to their terminal differentiation commitment (cell lines), complexity and time constraints (ES/ iPS cells) and relatively low cell numbers available (primary cells). Last, various leukemic cell lines with erythroid and megakaryocytic potential are available, such as K562, HEL and MEG-01, whose differentiation can be induced by compounds, such as PMA, hemin or butyric acid. However, these cell lines harbor various, partly characterized mutations, exhibit only limited terminal differentiation capacity and applications are limited to in vitro experiments^{48,49,50,51,52}. To the best of our knowledge, Hoxa7-TPO cells represent the only cell system that (i) provides essentially unlimited numbers of bi-potent cells closely related to MEP, a cell type that is exceedingly rare and difficult to isolate and (ii) is amenable to facile genetic manipulation followed by in vitro and in vivo applications. The capacity of Hoxa7-TPO cells to faithfully recapitulate MEP’s physiology is evidenced by our findings that their bi-potential differentiation is influenced by disruption of Klf1 and interference with cell cycle progression, both of which favor megakaryopoiesis. In summary, our findings indicate that this cell system has a wide range of possible applications to explore the biology of MEP, erythroid and MK lineages.

Methods

Reagents and plasmids

The following monoclonal antibodies were used in flow cytometry and immunofluorescence: TER-119-Pecy7 (TER-119), CD41-BV421 (MWReg30), CD34-PE (SA376A4), CD16/CD32-PE (93), CD11c-PerCP-Cy5.5 (N418), CD42d-APC (1C2); B220-PE (RA3-6B2), CD62P- PerCP-eFluor710 (Psel.KO2.3), CD115-APC (AFS98), CD11b-BV421 (M1/70), donkey anti-mouse IgG- Alexa Fluor™ 488, all donkey anti-rabbit IgG- Alexa Fluor™ 488 (all from Thermo Fisher Scientific); CD8a-APC (53-6.7), CD4-APC (RM4-5), C-KIT-APC (2B8), CD71-PE (C5) (all from Becton Dickinson). Sca-1-PE (E13-161.7), LY6G-Pecy7 (1A8), Ly6C-APC (HK1.4), CD150-APC (TC15-12F12.2), CD105-Pecy7 (MJ7/18), CD44-PerCP-Cy5.5 (IM7) and CD42d- Percp-cy5.5 (1C2) (all from Biolegend). Anti-GFP-Alexa Fluor™ 647 (Boster Bio). Anti-β1-tubulin (Sigma). Anti-VWF (Santa Cruz Biotech). Anti-CD41a-Alexa Fluor 647 (clone MWReg30, BD Biosciences).

The following reagents were used: β–estradiol (Sigma-Aldrich), recombinant mouse growth factors SCF, TPO, IL–3, IL–6, EPO (Peprotech), Hirudin (Aniara Diagnostic), fibronectin (Sigma-Aldrich), Hoechst H33342 (Thermo Fisher Scientific), ATRA (Sigma-Aldrich), Alexa Fluor™ 488-Phalloidin conjugate (Thermo Fisher Scientific). A list of reagents used in this study is provided in Supplementary Data 3.

Mouse Hoxa7 cDNA was cloned into MSCVneo (BD Biosciences) downstream of a triple hemagglutinin (HA) epitope tag. The hormone binding domain of the mutagenized estrogen receptor (ERHBD G400V) was cloned in frame between HA–tag and Hoxa7, generating the final MSCV–ERHBD–Hoxa7 vector. The correct sequence of the expression cassette was confirmed by DNA sequencing.

Virus production

The plasmids MSCV–ERHBD–Hoxa7 and the ecotropic packaging vector pCL–Eco (Imgenex) were co–transfected into HEK293T cells using Lipofectamine 2000 (Invitrogen). 18 hours after transfection, the supernatant (SN) was replaced by fresh growth medium (DMEM (Invitrogen), supplemented with 10% (v/v) fetal bovine serum (FBS, Hyclone), 50 mM 2–mercaptoethanol, antibiotics (penicillin G (100 IU/ml) and streptomycin sulfate (100 IU/ml) and Pyruvate (1 mM)), followed by incubation for 24 hours and collection of virus– containing supernatant. Replication-deficient lentivirus was generated using Lipofectamine 2000 (Invitrogen)–based transient transfection of HEK293T cells using a four-plasmid system that was generously provided by I. Verma. Cas9-mediated deletion of genes in Hoxa7-TPO cells was done on the basis of cells transduced with the lentiviral CAS9 expression vector lentiCas9-Blast (Addgene, no. 52962)⁵³. Single-guide RNAs (sgRNAs) were expressed by lentiviral delivery of specific sgRNA using the lentiviral vector lentiGuide-Puro (Addgene, no. 52963)⁵³. Transduced cells were selected with puromycin (10 µg/ml) and used as polyclonal cell populations.

Generation and cell culture of Hoxa7-TPO progenitor cell lines

BM cells were harvested by flushing femurs and tibias of 4–8 week old female mice with 10 ml RP10 (RPMI 1640 (Invitrogen), supplemented with 10 % (v/v) FBS, 50 mM 2–mercaptoethanol and antibiotics (penicillin G (100 IU/ml) and streptomycin sulfate (100 IU/ml)), pelleted by centrifugation, resuspended in 4 ml RP10, loaded on 3 ml Ficoll-Paque (GE Healthcare) and separated by centrifugation at 450 g for 30 min. The entire supernatant was collected (discarding only 500 μl including the cell pellet), diluted with 45 ml of PBS containing 1% FBS, pelleted at 800 g for 10 min, followed by resuspension in 10 ml RP10, centrifugation at 450 g for 5 min and resuspension at a concentration of 5 × 10⁵ cells/ml in RP10 containing recombinant mouse IL–3 (10 ng/ml), IL–6 (20 ng/ml) and 100 ng/ml recombinant SCF (R&D Systems). After two days of cell culture, cells were collected and resuspended in progenitor outgrowth medium (POM), i.e., X-VIVO10 (Lonza) containing 10 % (FBS, Hyclone), 50 mM 2-mercaptoethanol, antibiotics (penicillin G (100 IU/ml) and streptomycin sulfate (100 IU/ml)), supplemented with 1 μM β–estradiol and murine TPO (20 ng/ml). 3 × 10⁵ cells were dispensed in 1 ml per well in a 12–well plate and infected with the MSCV–ERHBD–Hoxa7 vector by spin inoculation at 1500 g for 60 min in the presence of Lipofectamine (0.1 %, Invitrogen). After spinoculation, cells were diluted by adding 1.5 ml POM for 24 h, followed by replacement of 2 ml of the cell culture medium with fresh POM. During the following cell culture period, cells were transferred to new wells containing fresh medium every 3–4 days. Once the cell populations were stably expanding, cells were kept at concentrations between 1 × 10⁵ and 1.5 × 10⁶ cells/ml.

Mouse strains and adoptive transfer of Hoxa7-TPO cells

All mouse studies were carried out in accordance with protocols approved by the Institutional Animal Care and Use Committees at the St. Jude Children’s Research Hospital, the University of Utah and the Children’s Hospital of Philadelphia. Transgenic mice with pancellular EGFP expression under control of an H2Kb enhancer/promoter were generously provided by Derek Persons¹⁵. PF4-Cre-iDTR transgenic mice were generated as previously described by crossing the PF4-Cre strain (Jackson Laboratories, stock #008535) with the ROSA26iDTR strain (Jackson Laboratories, stock #007900)^54,55,56. Mpl^-/- mice were obtained from Dr. Wei Tong at the Children’s Hospital of Philadelphia¹⁹. For in vivo reconstitution experiments, 5 × 10⁶ GFP⁺ Hoxa7-TPO cells, together with 2 × 10⁵ BM cells from C57BL/6 J mice were transferred into lethally irradiated C57BL/6 J recipient female mice via tail vain or retro-orbital injection. Irradiation doses were 950 rad (cesium-137) for transfer experiments into wt mice, 2 × 500 rad (Radsource RS2000) for experiments using PF4-Cre-iDTR mice and 1000 rad (XRAD320, Precision) for experiments using Mpl^-/- mice. At the different time points after the transfer, PB was collected by retro-orbital bleeding, or mice were sacrificed and organs were harvested. Complete blood counts (CBC) were measured using the Forcyte Hematology System (Oxford Science). Single cell suspensions were analyzed by flow cytometry.

Adoptive transfer of Hoxa7-TPO cells for immunofluorescence analysis

For analysis of endogenous and Hoxa7-TPO-derived platelets, PF4-Cre-iDTR mice (6–8 weeks old) were injected intraperitoneally with one dose of diphtheria toxin (DT, 400 ng), followed by two additional doses of DT (200 ng) administered every other day to deplete endogenous MKs and platelets. One day after the last DT treatment, mice were lethally irradiated (2 ×500 rad at an interval of 3 hours, Radsource RS2000), followed by intravenous injection of Hoxa7-TPO cells (2 x 10e7)(day 0) along with unfractionated BM cells (2 x 10e5) from PF4-Cre-iDTR mice that had been treated with DT using the same regimen. Additional Hoxa7-TPO cells (2 x 10e7) were transferred on day 1. On day 6, whole blood was collected via cardiac puncture. Blood from various experimental groups was pooled and washed platelets were isolated in Tyrodes buffer.

For analysis of platelets derived from sgRNA-treated Hoxa7-TPO cells, PF4-Cre-iDTR mice (8–12 weeks old) were injected intraperitoneally with a single dose of DT (400 ng). Three days after DT treatment, mice were lethally irradiated (2 ×500 rad at an 3 hour interval, Radsource RS2000) and transplanted with 4 x 10e7 control or Gp1ba-deleted Hoxa7-TPO cells, along with BM cells (2 x 10e5) from PF4-Cre-iDTR mice that had undergone the same DT treatment (day 0). On day 5, whole blood was collected via cardiac puncture. A fraction of PB from each mouse was used for flow cytometry analysis. The remaining blood from each control and experimental group was pooled and used for immunofluorescence analysis.

Immunofluorescence analysis of platelets

Chamber slides were coated with 200 µL of poly-L-lysine (0.1 mg/mL) or fibrinogen (100 µg/ml) in a 37 °C humidified chamber for 1 hr. Slides were rinsed 3x with PBS and blocked with BSA (0.1 %) in PBS for 30 min. Washed platelets were prepared in modified Tyrodes buffer at a density of 2 x10e7 cells/mL left to rest for 30 minutes. 1.5x10e6 total platelets per slide were spread on coated cover-glass for 45 minutes at 37 °C under humidified conditions. Unbound platelets were washed away (3x gentle PBS washes) and adhered cells were fixed using paraformaldehyde (4 %) in PBS for 10 minutes at room temperature, followed by blocking with FBS (2 %) in PBS for 1 h. Immunostaining was performed using primary antibodies specific to β1-tubulin and vWF at 1:100 dilutions overnight at 4 °C under humidified conditions. Chamber slides were washed 3x with PBS and incubated with Alexa Fluor™ 488 donkey Anti-Mouse IgG, Alexa Fluor™ 488 donkey Anti-Rabbit secondary antibodies at a 1:1000 dilution, and an anti-GFP Alexa Fluor™ 647 at a 1:100 dilution for 45 min at room temperature in the dark. Platelets spread on fibrinogen were stained using Alexa Fluor™ 488-Phalloidin conjugate at a 1:50 dilution and anti-GFP Alexa Fluor™ 647 at a 1:100 dilution. Chamber slides were washed 3x with PBS, and mounted with coverslips using Prolong Glass before curing overnight in the dark. Images were obtained using a Leica TCS SP5 II Confocal microscope and a 60x oil objective.

Intravital cremaster arteriole laser injury studies

These studies were conducted using a confocal intravital imaging system as previously described¹⁸. A 100 μl bolus of Alexa Fluor 647-labeled anti-CD41 F(ab′)2 (0.3 µg/g mouse, clone MWReg30, BD Bioscience) in PBS was infused into the mice via a jugular vein cannula to visualize platelets. Arterioles (20-40 μm diameter) were injured using an SRS NL100 pulsed nitrogen dye laser (440 nm) aimed at the endothelial lining. Brightfield and timelapse images were captured on the injuries made in each mouse and analyzed using Slidebook 6.0 software (Intelligent Imaging Innovations) to determine the area and fluorescent intensity of platelets.

Activation of platelets in whole blood

Platelet activation was determined as described previously⁵⁷. In brief, 500 µl blood was drawn from the vena cava inferior using a 1 ml syringe containing 50 µl sodium citrate (3.2%).40 µl of whole blood were seeded into half-area 96-well microtiter plates (Greiner Bio-One) coated with hydrogenated gelatin (0.75% w/v, Sigma). For stimulation, collagen (Chronolog) was added at a final concentration of 2 µg/ml and incubated for 5 min at 37 °C on a plate shaker at 1200 rpm. 5 µl of treated blood were transferred into 45 µl acid citrate dextrose solution (5 mM glucose, 6.8 mM trisodium citrate, 3.8 mM citric acid) and 50 µl PBS/0.5% FBS containing CD42d-APC were added and incubated for 20 min, followed by addition CountBright Absolute counting beads (Thermo Fisher Scientific) and flow cytometry analysis. The percent loss of single platelets was calculated using the formula: [unstimulated platelet number minus collagen-stimulated platelet number]/ unstimulated cd42d positive platelet number x 100.

Activation of Platelets in platelet rich plasma (PRP)

1 ml mouse blood was drawn from the vena cava inferior using a 1 ml syringe containing 100 µl Sodium Citrate (3.2 %). 2 ml of wash buffer (13.4 mM NaCl, 0.3 mM KCL, 0.03 mM NaH2PO4, 0.5 mM HEPES, 0.5 mM Glucose, 0.2 mM MgCl2, 11 mM NaHCO3, 2 mg/ml BSA, 1 mM EGTA, pH 6.8) was added, and blood was centrifuged at 190 g for 3 min. The top layer representing PRP was transferred to a new 15 ml falcon tube and prostaglandin E1 (PGE1) was added to a final concentration of 1 µM to prevent premature platelet activation. Cells were collected by centrifugation (1450 g, 8 min) and resuspended in 1 ml of final resuspension buffer (13.4 mM NaCl, 0.3 mM KCL, 0.03 mM NaH2PO4, 0.5 mM HEPES, 0.5 mM Glucose, 0.2 mM MgCl2, 11 mM NaHCO3, 2 mg/ml BSA, pH 7.2). 2 µl of washed platelets were added to 98 µl of final resuspension buffer containing antibodies against CD62P, CaCl2 (1 mM) and Thrombin (2 U/ml (Sigma-Aldrich)) and incubated for 20 min at 37 °C. Thereafter, samples were diluted with 200 µl of resuspension buffer and analyzed immediately by flow cytometry.

Hemoglobin fractionation

RBC sorted by Fluorescence-activated Cell Sorting (FACS) were lysed in Hemolysate reagent (Helena Laboratories) and collected by centrifugation (1000 g,10 min). Analysis of globin chains in the supernatant was performed by ion exchange (IE) and reverse phase (RP)-HPLC (Prominence UFLC, Shimadzu). Proteins eluting from the column were quantified by light absorbance at 220, 280, and 415 nm with a diode array detector.

In vitro MK differentiation and proplatelet generation

Hoxa7-TPO cells were washed twice with PBS containing FBS (2 %) and cultured for different periods of time in POM supplemented with TPO (20 ng/ml) to generate MK. MK were evaluated by phase contrast microscopy, cytospin and May-Grünwald-Giemsa-staining and flow cytometry as described in figure legends. MK ploidy was determined by flow cytometry based on Hoechst H33342 staining. For proplatelet production, TPO (50 ng/ml) and hirudin (100 anti-thrombin units) were added to Hoxa7-TPO or BM cultures throughout cell differentiation (4 days), and mature MKs were isolated using a BSA gradient and seeded at 1x10e5 cells per well in a 24-well plate, either left uncoated (for phase contrast microscopy) or coated with fibrinogen (100 μg/ml)(for proplatelet quantification and DIC microscopy)⁵⁸. Proplatelet formation was assessed 12 h later using phase-contrast or DIC microscopy.

In vitro erythroid cell differentiation and enucleation analysis

Hoxa7-TPO cells were washed twice with PBS containing 2% FBS and seeded into 12-well plates coated with fibronectin (2.5 μg per square centimeter) at a density of 2x10e5 cells per well in 2 ml POM supplemented with EPO (1 ng/ml). On day 6 after plating, the medium was replaced with 2 ml POM containing 20% FBS without EPO for 24 hours. Cells were analyzed by flow cytometry and May-Grünwald-Giemsa staining. For enucleation assessment on day 7, cells were stained with antibodies against Ter-119 and Hoechst 33342, followed by flow cytometry analysis. Various fractions, including extruded nuclei, as well as nucleated and enucleated cell populations, were FACS-sorted, stained with May-Grünwald-Giemsa, and analyzed by microscopy.

Dual MK/ Erythroid differentiation assay and cell cycle inhibition

To evaluate the effect of cell cycle kinetics on the lineage bias of Hoxa7-TPO cells, an optimized dual megakaryocyte (MK) and erythroid (E) differentiation assay was used. Hoxa7-TPO cells were washed twice with PBS containing FBS (2 %) and seeded into uncoated 12-well plates (2 x 10e5 cells per well) in POM (2 ml) containing TPO (1 ng/ml) and EPO (1 ng/ml). In some conditions ATRA (50 nM) or its solvent DMSO was added. Five days later, cells were analyzed by flow cytometry to quantify MK (CD41⁺ CD42d⁺) and erythroid cells (FSC-A^low SSC-A^low CD44^low CD41^-).

Computational analysis of RNA-seq data from Hoxa7-TPO cell lines

Public murine microarray data (GSE77098) was imported into Partek Genomics Suite 6.6 and rma normalized. A Kruskal Wallis test was applied to each probeset across selected categories. Those data that passed the Bonferroni threshold at 5 percent were retained. Data were then imported into STATA/MP 15.1 and filtered to retain the highest expressing probe-set per gene symbol. Each gene was then assigned to the signature category that had the highest median expression. Next, the data were matched by gene symbol to RNAseq log 2 FPKM data, where values for genes within a signature were averaged for each signature and each RNAseq sample. These sample signatures were then z-score normalized across samples, creating a −2 to 2 scale. The resultant z-scores were subsequently imported and visualized in R version 3.5.1 using the pheatmap package. RNAseq data of non-differentiated and differentiated Hoxa7-TPO cells are available from NCBI GEO (GSE244976).

Computational analysis of lineage-defining factors and over-representation analysis

Raw RNA-seq reads were first processed with TrimGalore (v0.6.10) to remove adapters and low quality reads. Filtered reads were then mapped to the mouse genome (GRCm39.112) with the STAR aligner (v2.7.11a), using the “--quantMode GeneCounts” option to generate gene-level read counts. Raw counts were then processed using the R package DESeq2 (v1.42.1) for differential expression analysis comparing undifferentiated Hoxa7-TPO cells to differentiated ones (MK and RBC, separately). Genes with a Benjamini-Hochberg corrected p-value < 0.05 were considered significantly differentially expressed. These genes were then interpolated to experimentally defined bone-marrow MK and RBC markers reported in the CellMarker 2.0 database⁵⁹. Differentially expressed genes were also used for an over-representation analysis of Gene Ontology “Biological Process” terms (Fisher’s exact test), with upregulated and downregulated genes analyzed separately. Gene Ontology terms with a Benjamini-Hochberg corrected p-value < 0.05 were considered significantly enriched. The code used for the over-representation analysis is available at Github (https://github.com/mmarchetti90/project_setup_assistant/blob/main/code_base/term_enrichment/ora/enrichment_analysis_1.py)

Quantitative PCR (Q-PCR)

Total RNA was extracted using the RNeasy Plus Universal Mini Kit (Qiagen) and reverse-transcribed into cDNA using the iScript™ cDNA Synthesis Kit (Bio-Rad). Q-PCR was performed using the ViiA™ 7 Real-Time PCR System (Applied Biosystems) with SYBR™ Green dye (Applied Biosystems). The primer sequences used were as follows: Vwf: Forward: TCATCGCTCCAGCCACATTCCATA, Reverse: AGCCACGCTCACAGTGGTTATACA; Pf4: Forward: TTCTGGGCCTGTTGTTTCTG, Reverse: GATCTCCATCGCTTTCTTCG; Gapdh: Forward: AGGTTGTCTCCTGCGACTTCA, Reverse: CCAGGAAATGAGCTTGACAAAG. Gene expression levels were quantified using the standard curve method and normalized to Gapdh expression.

Analysis of sgRNA targeting efficiency

DNA was extracted from cells using the PureLink Genomic DNA Mini Kit (Life Technologies). A first-round PCR amplification was conducted using a 2x Phusion High-Fidelity PCR Master Mix using gene-specific primers. A second PCR amplification reaction was performed with primers containing sample-specific adapters (Illumina). PCR products were sequenced on a MiSeq platform (Illumina) with 2 ×150-bp paired-end reads. Sequence alignment and mutation detection were performed using CRISPResso2 software. The gRNA sequences and first-round PCR primers are listed in Supplementary Table 1.

Statistics and reproducibility

Statistical analyses were performed using data from at least three independent biological and/or technical replicates. Data distribution was assessed using the Shapiro-Wilk test. Group differences were evaluated using two-tailed unpaired t-tests or one-way analysis of variance (ANOVA) followed by Tukey’s test for multiple comparisons. For select pairwise comparisons, Cohen’s d was calculated post hoc to estimate effect size and aid interpretation. No statistical method was used to predetermine sample size. No data were excluded from the analyses. The experiments were not randomized. The Investigators were not blinded to allocation during experiments and outcome assessment. Statistical significance was defined as P < 0.05, with significance levels indicated as follows: *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

Relevant data supporting the findings of this study are available upon request from the corresponding author, respectively have been deposited at NCBI GEO under accession code GSE244976. Source data are provided with this paper.

Code availability

The code used for this study is available at GitHub [https://github.com/mmarchetti90/project_setup_assistant] and has been archived on Zenodo at https://doi.org/10.5281/zenodo.15626059 (release v1.0.0)⁶⁰.

References

Pronk, C. J. et al. Elucidation of the phenotypic, functional, and molecular topography of a myeloerythroid progenitor cell hierarchy. Cell Stem Cell 1, 428–442 (2007).
Article CAS PubMed Google Scholar
Pronk, C. J., Attema, J., Rossi, D. J., Sigvardsson, M. & Bryder, D. Deciphering developmental stages of adult myelopoiesis. Cell Cycle 7, 706–713 (2008).
Article CAS PubMed Google Scholar
Wang, G. G. et al. Quantitative production of macrophages or neutrophils ex vivo using conditional Hoxb8. Nat. Methods 3, 287–293 (2006).
Article CAS PubMed Google Scholar
Redecke, V. et al. Hematopoietic progenitor cell lines with myeloid and lymphoid potential. Nat. methods 10, 795–803 (2013).
Article CAS PubMed PubMed Central Google Scholar
Collins, E. M. & Thompson, A. HOX genes in normal, engineered and malignant hematopoiesis. Int J. Dev. Biol. 62, 847–856 (2018).
Article CAS PubMed Google Scholar
So, C. W., Karsunky, H., Wong, P., Weissman, I. L. & Cleary, M. L. Leukemic transformation of hematopoietic progenitors by MLL-GAS7 in the absence of Hoxa7 or Hoxa9. Blood 103, 3192–3199 (2004).
Article CAS PubMed Google Scholar
Bach, C. et al. Leukemogenic transformation by HOXA cluster genes. Blood 115, 2910–2918 (2010).
Article CAS PubMed Google Scholar
Tora, L. et al. The cloned human oestrogen receptor contains a mutation which alters its hormone binding properties. EMBO J. 8, 1981–1986 (1989).
Article CAS PubMed PubMed Central Google Scholar
Pronk, C. J. & Bryder, D. Flow cytometry-based identification of immature myeloerythroid development. Methods Mol. Biol. 699, 275–293 (2011).
Article CAS PubMed Google Scholar
Vijey, P., Posorske, B. & Machlus, K. R. In vitro culture of murine megakaryocytes from fetal liver-derived hematopoietic stem cells. Platelets 29, 583–588 (2018).
Article CAS PubMed PubMed Central Google Scholar
Radley, J. M. & Scurfield, G. The mechanism of platelet release. Blood 56, 996–999 (1980).
Article CAS PubMed Google Scholar
Choi, E. S., Nichol, J. L., Hokom, M. M., Hornkohl, A. C. & Hunt, P. Platelets generated in vitro from proplatelet-displaying human megakaryocytes are functional. Blood 85, 402–413 (1995).
Article CAS PubMed Google Scholar
de Graaf, C. A. et al. Haemopedia: an expression atlas of murine hematopoietic cells. Stem Cell Rep. 7, 571–582 (2016).
Article Google Scholar
Lu, Y. C. et al. The Molecular signature of megakaryocyte-erythroid progenitors reveals a role for the cell cycle in fate specification. Cell Rep. 25, 2083–2093.e2084 (2018).
Article CAS PubMed PubMed Central Google Scholar
Dominici, M. et al. Transgenic mice with pancellular enhanced green fluorescent protein expression in primitive hematopoietic cells and all blood cell progeny. Genesis 42, 17–22 (2005).
Article CAS PubMed Google Scholar
Ault, K. A. & Knowles, C. In vivo biotinylation demonstrates that reticulated platelets are the youngest platelets in circulation. Exp. Hematol. 23, 996–1001 (1995).
CAS PubMed Google Scholar
O’Connell, K. E. et al. Practical murine hematopathology: a comparative review and implications for research. Comp. Med. 65, 96–113 (2015).
PubMed PubMed Central Google Scholar
Neyman, M., Gewirtz, J. & Poncz, M. Analysis of the spatial and temporal characteristics of platelet-delivered factor VIII-based clots. Blood 112, 1101–1108 (2008).
Article CAS PubMed PubMed Central Google Scholar
de Sauvage, F. J. et al. Physiological regulation of early and late stages of megakaryocytopoiesis by thrombopoietin. J. Exp. Med. 183, 651–656 (1996).
Article PubMed Google Scholar
Romeo, P. H. et al. Megakaryocytic and erythrocytic lineages share specific transcription factors. Nature 344, 447–449 (1990).
Article CAS ADS PubMed Google Scholar
Liu, J. et al. Quantitative analysis of murine terminal erythroid differentiation in vivo: novel method to study normal and disordered erythropoiesis. Blood 121, e43–e49 (2013).
Article CAS PubMed PubMed Central Google Scholar
Dimberg, A. et al. Retinoic acid-induced cell cycle arrest of human myeloid cell lines is associated with sequential down-regulation of c-Myc and cyclin E and posttranscriptional up-regulation of p27(Kip1). Blood 99, 2199–2206 (2002).
Article CAS PubMed Google Scholar
Peters, L. L. et al. Mouse microcytic anaemia caused by a defect in the gene encoding the globin enhancer-binding protein NF-E2. Nature 362, 768–770 (1993).
Article CAS ADS PubMed Google Scholar
Bernard, J. & Soulier, J. P. On a new variety of congenital thrombocytary hemo-ragiparous dystrophy]. Sem. Hop. 24, 3217–3223 (1948).
CAS PubMed Google Scholar
Nurden, A. T. & Caen, J. P. Specific roles for platelet surface glycoproteins in platelet function. Nature 255, 720–722 (1975).
Article CAS ADS PubMed Google Scholar
Clemetson, K. J., McGregor, J. L., James, E., Dechavanne, M. & Luscher, E. F. Characterization of the platelet membrane glycoprotein abnormalities in Bernard-Soulier syndrome and comparison with normal by surface-labeling techniques and high-resolution two-dimensional gel electrophoresis. J. Clin. Investig. 70, 304–311 (1982).
Article CAS PubMed PubMed Central Google Scholar
Ware, J., Russell, S. & Ruggeri, Z. M. Generation and rescue of a murine model of platelet dysfunction: the Bernard-Soulier syndrome. Proc. Natl. Acad. Sci. USA 97, 2803–2808 (2000).
Article CAS ADS PubMed PubMed Central Google Scholar
Frontelo, P. et al. Novel role for EKLF in megakaryocyte lineage commitment. Blood 110, 3871–3880 (2007).
Article CAS PubMed PubMed Central Google Scholar
Tewari, R. et al. Erythroid Kruppel-like factor (EKLF) is active in primitive and definitive erythroid cells and is required for the function of 5’HS3 of the beta-globin locus control region. EMBO J. 17, 2334–2341 (1998).
Article CAS PubMed PubMed Central Google Scholar
Tallack, M. R. & Perkins, A. C. Megakaryocyte-erythroid lineage promiscuity in EKLF null mouse blood. Haematologica 95, 144–147 (2010).
Article PubMed Google Scholar
Kuvardina, O. N. et al. RUNX1 represses the erythroid gene expression program during megakaryocytic differentiation. Blood 125, 3570–3579 (2015).
Article CAS PubMed PubMed Central Google Scholar
Hariharan, P., Colah, R., Ghosh, K. & Nadkarni, A. Differential role of Kruppel like factor 1 (KLF1) gene in red blood cell disorders. Genomics 111, 1771–1776 (2019).
Article CAS PubMed Google Scholar
Siatecka, M. & Bieker, J. J. The multifunctional role of EKLF/KLF1 during erythropoiesis. Blood 118, 2044–2054 (2011).
Article CAS PubMed PubMed Central Google Scholar
Luo Z., Rhie S. K., Farnham P. J. The enigmatic HOX genes: can we crack their code? Cancers (Basel) 11, (2019).
Ogura, M. et al. Establishment of a novel human megakaryoblastic leukemia cell line, MEG-01, with positive Philadelphia chromosome. Blood 66, 1384–1392 (1985).
Article CAS PubMed Google Scholar
Gewirtz, A. M., Burger, D., Rado, T. A., Benz, E. J. Jr. & Hoffman, R. Constitutive expression of platelet glycoproteins by the human leukemia cell line K562. Blood 60, 785–789 (1982).
Article CAS PubMed Google Scholar
Matsubara, Y., Suzuki, H., Ikeda, Y. & Murata, M. Generation of megakaryocytes and platelets from preadipocyte cell line 3T3-L1, but not the parent cell line 3T3, in vitro. Biochemical biophysical Res. Commun. 402, 796–800 (2010).
Article CAS Google Scholar
Nakamura, S. et al. Expandable megakaryocyte cell lines enable clinically applicable generation of platelets from human induced pluripotent stem cells. cell stem cell 14, 535–548 (2014).
Article CAS PubMed Google Scholar
Montenont, E. et al. CRISPR-edited megakaryocytes for rapid screening of platelet gene functions. Blood Adv. 5, 2362–2374 (2021).
Article CAS PubMed PubMed Central Google Scholar
Fujimoto, T. T., Kohata, S., Suzuki, H., Miyazaki, H. & Fujimura, K. Production of functional platelets by differentiated embryonic stem (ES) cells in vitro. Blood 102, 4044–4051 (2003).
Article CAS PubMed Google Scholar
Noh, J. Y. et al. Inducible Gata1 suppression expands megakaryocyte-erythroid progenitors from embryonic stem cells. J. Clin. Investig. 125, 2369–2374 (2015).
Article PubMed PubMed Central Google Scholar
Hiroyama, T. et al. Establishment of mouse embryonic stem cell-derived erythroid progenitor cell lines able to produce functional red blood cells. PloS one 3, e1544 (2008).
Article ADS PubMed PubMed Central Google Scholar
Kurita, R. et al. Establishment of immortalized human erythroid progenitor cell lines able to produce enucleated red blood cells. PloS one 8, e59890 (2013).
Article CAS ADS PubMed PubMed Central Google Scholar
Scully, E. J. et al. Generation of an immortalized erythroid progenitor cell line from peripheral blood: A model system for the functional analysis of Plasmodium spp. invasion. Am. J. Hematol. 94, 963–974 (2019).
Article CAS PubMed PubMed Central Google Scholar
Daniels, D. E. et al. Reproducible immortalization of erythroblasts from multiple stem cell sources provides approach for sustainable RBC therapeutics. Mol. Ther. Methods Clin. Dev. 22, 26–39 (2021).
Article CAS PubMed PubMed Central Google Scholar
Trakarnsanga, K. et al. An immortalized adult human erythroid line facilitates sustainable and scalable generation of functional red cells. Nat. Commun. 8, 14750 (2017).
Article CAS ADS PubMed PubMed Central Google Scholar
Kanjee, U. et al. CRISPR/Cas9 knockouts reveal genetic interaction between strain-transcendent erythrocyte determinants of Plasmodium falciparum invasion. Proc. Natl. Acad. Sci. USA 114, E9356–E9365 (2017).
Article CAS PubMed PubMed Central Google Scholar
Shelly, C., Petruzzelli, L. & Herrera, R. PMA-induced phenotypic changes in K562 cells: MAPK-dependent and -independent events. Leuk. J. Leuk. Soc. Am., Leuk. Res. Fund., UK 12, 1951–1961 (1998).
CAS Google Scholar
Murate, T. et al. The close relationship between DNA replication and the selection of differentiation lineages of human erythroleukemia cell lines K562, HEL, and TF1 into either erythroid or megakaryocytic lineages. Exp. cell Res. 208, 35–43 (1993).
Article CAS PubMed Google Scholar
Alitalo, R. Induced differentiation of K562 leukemia cells: a model for studies of gene expression in early megakaryoblasts. Leuk. Res. 14, 501–514 (1990).
Article CAS PubMed Google Scholar
Murate, T. et al. Aphidicolin, an inhibitor of DNA replication, blocks the TPA-induced differentiation of a human megakaryoblastic cell line, MEG-O1. Blood 78, 3168–3177 (1991).
Article CAS PubMed Google Scholar
Long, M. W., Heffner, C. H., Williams, J. L., Peters, C. & Prochownik, E. V. Regulation of megakaryocyte phenotype in human erythroleukemia cells. J. Clin. Investig. 85, 1072–1084 (1990).
Article CAS PubMed PubMed Central Google Scholar
Sanjana, N. E., Shalem, O. & Zhang, F. Improved vectors and genome-wide libraries for CRISPR screening. Nat. methods 11, 783–784 (2014).
Article CAS PubMed PubMed Central Google Scholar
Wuescher, L. M., Takashima, A. & Worth, R. G. A novel conditional platelet depletion mouse model reveals the importance of platelets in protection against Staphylococcus aureus bacteremia. J. Thrombosis Haemost. JTH 13, 303–313 (2015).
Article CAS Google Scholar
Tiedt, R., Schomber, T., Hao-Shen, H. & Skoda, R. C. Pf4-Cre transgenic mice allow the generation of lineage-restricted gene knockouts for studying megakaryocyte and platelet function in vivo. Blood 109, 1503–1506 (2007).
Article CAS PubMed Google Scholar
Buch, T. et al. A cre-inducible diphtheria toxin receptor mediates cell lineage ablation after toxin administration. Nat. methods 2, 419–426 (2005).
Article CAS PubMed Google Scholar
Armstrong, P. C. et al. Novel whole blood assay for phenotyping platelet reactivity in mice identifies ICAM-1 as a mediator of platelet-monocyte interaction. Blood 126, e11–e18 (2015).
Article PubMed PubMed Central Google Scholar
Mott, K. & Schulze, H. Isolation, in vitro differentiation, and culture of murine megakaryocytes from fetal liver and adult bone marrow. Curr. Protoc. 3, e783 (2023).
Article CAS PubMed Google Scholar
Hu, C. et al. CellMarker 2.0: an updated database of manually curated cell markers in human/mouse and web tools based on scRNA-seq data. Nucleic acids Res. 51, D870–D876 (2023).
Article CAS PubMed Google Scholar
Marchetti M. Murine hematopoietic progenitor cell lines with erythroid and megakaryocyte potential. Zenodo, https://doi.org/10.5281/zenodo.15626059 (2025).

Download references

Acknowledgements

This work was supported by the American Lebanese Syrian Associated Charities (ALSAC), NIH grant R35HL150698 to M.P., NIH grants R01 AI145877 and RO1 AI170942 to H.H.

Author information

Peng Xu
Present address: Cyrus Tang Medical Institute, Soochow University, Suzhou, The People’s Republic of China
These authors contributed equally: Ruiqiong Wu, Faraz Salehi.

Authors and Affiliations

Department of Hematology, St. Jude Children’s Research Hospital, Memphis, TN, USA
Ruiqiong Wu, Peng Xu, Yong Cheng & Mitchell J. Weiss
Laboratory of Innate Immunity and Signal Transduction, Department of Pathology, Division of Microbiology & Immunology, University of Utah School of Medicine, Salt Lake City, UT, USA
Faraz Salehi, Vanessa Redecke & Hans Häcker
Department of Bone Marrow Transplantation, St. Jude Children’s Research Hospital, Memphis, TN, USA
Zhijun Ma
Department of Human Genetics, Utah Center for Genetic Discovery, University of Utah, Salt Lake City, UT, USA
Marco Marchetti
Department of Computational Biology, St. Jude Children’s Research Hospital, Memphis, TN, USA
David Finkelstein
University of Utah Molecular Medicine Program, Department of Pathology, Division of Microbiology & Immunology, University of Utah School of Medicine, Salt Lake City, Utah, USA
Kimberly A. Queisser & Aaron C. Petrey
Department of Pediatrics, Division of Hematology, Children’s Hospital of Philadelphia, Philadelphia, PA, USA
Conroy O. Field, Hyun Sook Ahn & Mortimer Poncz

Authors

Ruiqiong Wu
View author publications
Search author on:PubMed Google Scholar
Faraz Salehi
View author publications
Search author on:PubMed Google Scholar
Vanessa Redecke
View author publications
Search author on:PubMed Google Scholar
Zhijun Ma
View author publications
Search author on:PubMed Google Scholar
Marco Marchetti
View author publications
Search author on:PubMed Google Scholar
David Finkelstein
View author publications
Search author on:PubMed Google Scholar
Peng Xu
View author publications
Search author on:PubMed Google Scholar
Yong Cheng
View author publications
Search author on:PubMed Google Scholar
Kimberly A. Queisser
View author publications
Search author on:PubMed Google Scholar
Aaron C. Petrey
View author publications
Search author on:PubMed Google Scholar
Conroy O. Field
View author publications
Search author on:PubMed Google Scholar
Hyun Sook Ahn
View author publications
Search author on:PubMed Google Scholar
Mortimer Poncz
View author publications
Search author on:PubMed Google Scholar
Mitchell J. Weiss
View author publications
Search author on:PubMed Google Scholar
Hans Häcker
View author publications
Search author on:PubMed Google Scholar

Contributions

R.W. and F.S. performed experiments, analyzed data and compiled part of the Material and Methods section. Z.M. and V.R. performed experiments. M.M. and D.F. performed bioinformatics analyses. K.A.Q. and A.C.P. planned, conducted and analyzed ex vivo platelet morphology experiments. C.O.F. and H.S.A. performed the arteriole injury model and analyzed data. M.P. provided guidance for in vivo platelet experiments. Y.C. analyzed sgRNA targeting efficiency. P.X. and M.J.W. conducted hemoglobin analysis. H.H. conceived and supervised the project, performed experiments, analyzed data, and wrote the manuscript. All authors edited the manuscript.

Corresponding author

Correspondence to Hans Häcker.

Ethics declarations

Competing interests

The authors declare no competing interests.

Peer review

Peer review information

Nature Communications thanks Catherine Leon, and the other, anonymous, reviewer(s) for their contribution to the peer review of this work. A peer review file is available.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Supplementary Information

Description of Additional Supplementary Files

Supplementary Data 1

Supplementary Data 2

Supplementary Data 3

Reporting Summary

Transparent Peer Review file

Source data

Source Data

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Wu, R., Salehi, F., Redecke, V. et al. Murine hematopoietic progenitor cell lines with erythroid and megakaryocyte potential. Nat Commun 16, 7283 (2025). https://doi.org/10.1038/s41467-025-62668-z

Download citation

Received: 31 October 2023
Accepted: 29 July 2025
Published: 07 August 2025
DOI: https://doi.org/10.1038/s41467-025-62668-z