Skip to main content

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

  • Letters to the Editor
  • Published:

Alzheimer disease PS-1 exon 9 deletion defined

Nature Medicine volume 5, page 1090 (1999)Cite this article

To the editor—The clinical, pathological, and genetic analyses of a Finnish pedigree (Finn2) with early-onset inherited Alzheimer disease (AD) have been reported1. This family demonstrated linkage to the PS1 region of chromosome 14, and analysis for PS1 mutations by RT–PCR and immunoblot demonstrated heterozygous deletion of exon 9, which has been shown to cause early-onset AD2. However, unlike a previously described family2, no splice acceptor site mutation was detected in Finn2, suggesting the presence of either a small genomic deletion that included exon 9 or of mutations elsewhere that could affect splicing.

The clinical, pathological and etiological importance of Δ9 mutations has been discussed1. In addition to the presence of 'cotton wool' plaques and the scarcity of congophilic cored plaques typical of AD, there seems to be an association with the PS1Δ9 or PS1Δ9 Finn mutations and the occurrence of spastic paraparesis. However, because spastic paraparesis has only been described in two of four families with Δ9 variations and because it may also be associated with other PS1 missense mutations3, the specific link between this symptom and Δ9 variations may be complex.

This is a preview of subscription content, access via your institution

Relevant articles

Open Access articles citing this article.

Access options

Buy this article

  • Purchase on SpringerLink
  • Instant access to the full article PDF.

USD 39.95

Prices may be subject to local taxes which are calculated during checkout

Figure 1: Genomic analysis of PS-1. PCR used intronic primers (2F, 5′–TTTAAATCTGCATATTTTCCAGCCAGGCATGAC–3′; 2R, 5′–AAAGCATTAGGTCTCATCCTTTAGTGCACG–3′) flanking exon 9, with the Expand Long PCR System.

References

  1. Crook, R. et al. A variant of Alzheimer's disease with spastic paraparesis and unusual plaques due to deletion of exon 9 of presenilin 1. Nature Med. 4, 452–455 (1998).

    Article  CAS  Google Scholar 

  2. Perez-Tur, J. et al. A mutation in Alzheimer's disease destroying a splice acceptor site in the presenilin 1 gene. NeuroReport 7, 204–207 (1995).

    Article  Google Scholar 

  3. Kwok, J.B.J. et al. Two novel (M233T and R278T) presenilin 1 mutations in early onset Alzheimer's disease and preliminary evidence for association of presenilin 1 mutations with a novel phenotype. NeuroReport 8, 1537–1542 (1997).

    Article  CAS  Google Scholar 

Download references

Author information

Authors and Affiliations

  1. Mayo Clinic, Jacksonville, 4500 San Pablo Road, Jacksonville, 32224, Florida, USA

    Guy Prihar, Jordi Perez-Tur, Richard Crook, Sarah Lincoln, Henry Houlden, Andrew Grover, Liisa Myllykangas & Mike Hutton

  2. Department of Clinical Neurosciences Helsinki University Central Hospital, FIN-00290, Finland

    Auli Verkkoniem

  3. Institut de Biomedicina de València, Unitat de Genètica Molecular, Jaume Roig, València, 11 E-46010, Spain

    Jordi Perez-Tur

  4. The Family Federation of Finland, P.O. Box 849, Helsinki, FIN-00101, Finland

    Mirja Somer

  5. The Department of Pathology Helsinki University Central Hospital, FIN-00290, Finland

    Anders Paetau, Liisa Myllykangas, John Hardy & Matti Haltia

  6. The Department of Pathology, University of Turku, Turku, FIN-20521, Finland

    Hannu Kalimo

Authors
  1. Guy Prihar
    View author publications

    Search author on:PubMed Google Scholar

  2. Auli Verkkoniem
    View author publications

    Search author on:PubMed Google Scholar

  3. Jordi Perez-Tur
    View author publications

    Search author on:PubMed Google Scholar

  4. Richard Crook
    View author publications

    Search author on:PubMed Google Scholar

  5. Sarah Lincoln
    View author publications

    Search author on:PubMed Google Scholar

  6. Henry Houlden
    View author publications

    Search author on:PubMed Google Scholar

  7. Mirja Somer
    View author publications

    Search author on:PubMed Google Scholar

  8. Anders Paetau
    View author publications

    Search author on:PubMed Google Scholar

  9. Hannu Kalimo
    View author publications

    Search author on:PubMed Google Scholar

  10. Andrew Grover
    View author publications

    Search author on:PubMed Google Scholar

  11. Liisa Myllykangas
    View author publications

    Search author on:PubMed Google Scholar

  12. Mike Hutton
    View author publications

    Search author on:PubMed Google Scholar

  13. John Hardy
    View author publications

    Search author on:PubMed Google Scholar

  14. Matti Haltia
    View author publications

    Search author on:PubMed Google Scholar

Corresponding author

Correspondence to Mike Hutton.

Rights and permissions

Reprints and permissions

About this article

Cite this article

Prihar, G., Verkkoniem, A., Perez-Tur, J. et al. Alzheimer disease PS-1 exon 9 deletion defined. Nat Med 5, 1090 (1999). https://doi.org/10.1038/13383

Download citation

  • Issue date:

  • DOI: https://doi.org/10.1038/13383

This article is cited by

Search

Advanced search

Quick links

Nature Briefing

Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily.

Get the most important science stories of the day, free in your inbox. Sign up for Nature Briefing