Abstract
Fungi have an essential role in deterioration of historical leather bindings, leading to major problems in the preservative state of these artifacts. This study aims to evaluate the efficiency of some fungicides and nanoparticles materials against fungal activity of historical leather bindings. Historical leather binding from an illuminated paper manuscript dating back to the Mamluk period (1250–1516 AD) at the Al-Azhar library, Cairo, Egypt was examined for fungal infection, and isolation. Results of the present study showed, 21 fungal isolates were isolated and identified using morphological and molecular techniques as Alternaria alternate (5%), Aspergillus fumigatus (43%), Aspergillus niger (43%), Aspergillus terrus (5%), and Penicillium chrysogenum (5%). All fungal isolates exhibited proteolytic activity. Aspergillus niger (2–7) and Aspergillus fumigatus (3–4) achieved the highest proteolytic activity amongst obtained fungal strains. Seven fungicides, difenoconazole, propiconazole, azoxystrobin, pyraclostrobin, boscalid, dimethomorph, and thiophanate-methyl as individual active ingredient and two mixtures [difenoconazole combined with propiconazole (1:1)] and [boscalid combined with pyraclostrobin (2:1)] were evaluated at different concentrations against A. fumigatus and A. niger. Additionally, the effect of titanium and silicon dioxides nanoparticles, against the highest proteolytic fungi A. fumigatus and A. niger was evaluated. The fungal growth inhibition was assessed by the disc diffusion method (DDM). The results revealed that individual or mixed boscalid and pyraclostrobin fungicides at 300 ppm achieved the highest inhibition activity against A. fumigatus, but the linear diagram showed that individual boscalid and pyraclostrobin fungicides at 200 ppm was the ideal concentration for application with the leather samples in the future study. The mixture of boscalid + pyraclostrobin (2:1) exhibited the best preservation effect against A. niger achieving 65.9%, and 82.4% microbial inhibition at 150, and 300 ppm, respectively, followed by individual boscalid fungicide.
Similar content being viewed by others
Introduction
Leather has been used since the dawn of civilization. Its durability, versatility, and natural beauty make it a popular choice for many applications such as clothing, bookbinding, and accessories [1,2,3,4]. Leather is primarily made up of the protein collagen, which has a distinct structural hierarchy that ranges from the molecular to microscopic levels [5, 6].
Various factors can impact historical organic objects, especially leather artifacts in museums and libraries. These factors include improper relative humidity, temperature, light exposure, pollutants, pests, microorganisms, and handling [7,8,9,10]. They can cause deterioration, resulting in issues like fading, discoloration, stains, and more [11,12,13,14,15].
Fungal deterioration is a significant factor in leather degradation, especially for historical leather artifacts [16, 17]. Fungi thrive in high humidity or moisture conditions, leading to discoloration, fiber weakening, and mold formation in leather. The presence of fungi accelerates the degradation process by breaking down the leather structure with enzymes. This breakdown is facilitated by the moisture and nutrients in the leather, creating an ideal environment for fungal growth. As the protein structure deteriorates, the leather loses strength, flexibility, and quality [18, 19].
Proteolytic fungi are a group of microorganisms that have the ability to break down proteins [20]. In the context of historical leather, proteolytic fungi play a crucial role in the degradation of the material. These fungi are often isolated from leather artifacts that have been exposed to environmental conditions conducive to fungal growth. The presence of proteolytic fungi on historical leather can lead to the deterioration of the material, as the enzymes produced by these fungi break down the protein structure of the leather. Understanding the types of proteolytic fungi present on historical leather can provide valuable insights into the degradation processes affecting these artifacts. By studying the characteristics and behavior of these fungi, researchers can develop strategies to mitigate their impact on the historical leather materials and preserve these valuable cultural artifacts for future generations [21].
Several species of proteolytic fungi have been isolated from historical materials. Some common types include Aspergillus niger, Penicillium chrysogenum, and Trichophyton mentagrophytes. These fungi are known for their ability to degrade collagen, a key protein in leather, leading to deterioration of historical leather artifacts. Understanding the activity and mechanisms of these proteolytic fungi is crucial for the preservation and conservation of historical leather items [22].
Some authors have used fungicides, particularly triazole to disinfect fungi isolated from organic materials such as wood and historical paper manuscripts [23, 24].
Fungicides offer several advantages when used in heritage and historical materials [20, 25]. Firstly, they provide a highly effective and targeted solution for controlling fungal growth, preventing further damage to valuable artifacts and structures [26]. Additionally, fungicides can be applied in a controlled manner, ensuring that only the affected areas are treated without causing harm to the surrounding materials. They also offer long-lasting protection, helping to prevent future fungal infestations and preserving the integrity of the heritage materials for years to come. Overall, fungicides are a valuable tool in the conservation and maintenance of heritage materials, offering a reliable and efficient way to combat fungal deterioration [20, 27, 28]. Difenoconazole and propiconazole are triazole fungicides composed of carbon, hydrogen, nitrogen, and chlorine atoms. Difenoconazole has a molecular formula of C19H17Cl2N3O3 [29], while propiconazole has a formula of C15H17Cl2N3O2 [30]. These systemic fungicides are effective in controlling various types of fungi. Triazole’s fungicides (difenoconazole and propiconazole) have low acute toxicity [31]. Voiculescu et al. [32] mentioned that the toxic effects of difenoconazole showed slightly acute toxicity. Pyraclostrobin (methyl 2-[1-(4-chlorophenyl) pyrazol-3-yloxymethil]-Nmethoxycarbanilate) [33] is a strobilurin fungicide [34]. Strobilurin is natural fungicidal derivative of b-methoxyacrylic acid, which is produced by different range of Basidiomycete wood rotting fungi (Strobilurus tenacellus (Pers.) Singer) [35]. Pyraclostrobin is eco-friendly fungicide and reduced environmental effects [36]. Boscalid (C18H12Cl2N2O), dimethomorph (C21H22ClNO4) and thiophanate-methyl (C8H10N2S) are chemical compounds that have a resistance against fungi.
Nanoparticles (NPs) and their metal oxides play a crucial role in preserving historical organic artifacts because of their unique physiochemical characteristics. Titanium and silicon dioxide nanoparticles possess specific properties such as chemical and thermal stability, non-toxicity, and antimicrobial effects against various fungi [19, 23].
The aim of this study was to investigate the effectiveness of fungicides in inhibiting fungi isolated from historical leather artifacts, and to determine the most suitable fungicides for treating fungal contamination on leather surfaces. This research will contribute to the development of effective preservation methods for historical leather items, ensuring their long-term conservation and protection from fungal deterioration.
Materials and methods
Infected leather binding
A leather binding from an illuminated paper manuscript dating back to the Mamluk period was examined for fungal infection. The manuscript is housed at the Al-Azhar library in Cairo, Egypt, with the public number 83,491. A visual assessment revealed signs of biological damage, including microbial stains on the leather cover (Fig. 1A) and insect damage (Fig. 1B, C).
Shows a historical leather binding from the Mamluk period at the Al-Azhar library in Cairo, Egypt. A The leather cover with microbial stains; B The lining of the leather cover; C The biological deterioration of the leather cover
Isolation method of fungi from infected historical leather binding
Sampling was conducted by swabbing the infected surfaces with sterilized cotton swabs and transferring the samples onto agar media. The malt-extract-agar media (MEA) was prepared with 20 g malt extract, 5 g yeast extract, and 20 g agar in 1000 ml distilled water. The agar used was of Bacteriological grade with moisture content less than 12%, insoluble matter less than 0.5%, and ashes less than 1.5% from Alpha Chemika. Plates were then incubated at 28–30 °C for 24–27 h, depending on the fungi being studied.
Isolation of Fungi from infected leather binding
Fungi were isolated and investigated following the method described by Abdel-Hamied et al. [23]. Samples were inoculated onto Petri plates containing malt extract agar medium contains (gl−1) 20 malt extract, 5 yeast extract, and 20 agar. The plates were incubated at 28 ± 2 °C for 5–7 days. The formed fungal colonies were picked up and purified by sub-culturing on malt extract agar medium. Finally, the purified fungal cultures were preserved on malt extract agar slants and stored at 4 °C.
Phenotypic identification of fungal isolates using a light microscope
For phenotypic identification, two fungal isolates were identified based on their morphological characteristics using a light microscope (Siemens X-Vision KS 300 model).
Molecular identification of the most effective fungi using DNA/PCR
The identification of the fungi causing more damage, such as A. fumigatus and A. niger, was carried out using partial 18 S rRNA gene sequencing. The fungal isolates were identified based on their specific gene sequences at SolGent Company in Daejeon, South Korea.
The fungal isolates were cultured for 7 days at 28 °C on Czapek’s agar (CZA) medium [23]. DNA extraction was carried out at the Molecular Biology Research Unit, Assiut University, Egypt, using the Patho-gene-spin DNA/RNA extraction kit from Intron Biotechnology Company, Korea. Fungal DNA samples were then sent to SolGent Company, Daejeon, South Korea, for polymerase chain reaction (PCR) and sequencing of the internal transcribed spacer (ITS) region of the fungal rDNA.
PCR was conducted using two universal primers, ITS1 (forward) and ITS4 (reverse), which were included in the reaction mixture. The primer sequences are as follows: ITS1 (5′ - TCC GTA GGT GAA CCT GCG G − 3′) and ITS4 (5′- TCC TCC GCT TAT TGA TAT GC -3′). For Aspergillus niger, PCR was carried out using Beta-tubulin primer pairs recommended by Glass and Donaldson [37]; Frisvad et al. [38] which were Bt2a F (5′ GGTAACCAAATCGGTGCTGCTTTC- 3′) and Bt2b R (5′ ACCCTCAGTGT AGTGACCCTTGGC 3). The purified PCR products were sequenced using the same primers with the addition of ddNTPs in the reaction mixture. The obtained sequences were analyzed using the Basic Local Alignment Search Tool (BLAST) on the National Center for Biotechnology Information (NCBI) website. Phylogenetic analysis of the sequences was performed using MegAlign (DNA Star) software version 5.05.
Protein activity screening
To assess the protein activity of the isolated fungi, applying skin milk-agar medium as described by Jasim et al. [39]. The medium contained (gl−1): casine enzymatic hydrolysis (5), glucose (1), skim milk (28), and agar (20). Petri dishes contain skim milk were inoculated with a loopful of fungal spores and incubated at 28 ± 2 °C for 72 h. After incubation, the presence of a translucent circle around the colonies indicated protein breakdown (casein in milk). A larger diameter of the translucent circle signified higher enzyme production activity by the fungus.
Preparation of standard inoculums from tested fungi
The fungal inoculum was prepared following the methods outlined by Calonne et al. [40]. The fungal isolate was cultured on Czapek’s agar slants for 48–72 h at 28 ± 2 °C. At the end of the incubation period, spores were collected by adding 5 mL of sterile distilled water to the culture and gently scraping the spores with a sterilized loop. The spore suspension from the fungal culture was then pooled and counted using a Neubauer hemocytometer slide. One milliliter of spore suspension containing 1 × 107–8 spores/mL was used for subsequent experiments.
Chosen fungicides
In this study, titanium and silicon dioxide nano-powders with sizes of 21 nm and 23 nm, respectively, were purchased from Sigma-Aldrich. Additionally, the following fungicides were used: difenoconazole, propiconazole, azoxystrobin, pyraclostrobin, boscalid, thiophanate-methyl, and dimethomorph. The analytical standard of selected fungicides were purchased from Dr. Ehrenstorfer GmbH in Augsburg, Germany. Ethyl alcohol absolute (ACS spectrophotometric grade, 95.0%) was purchased from Sigma Aldrich Company in Germany. All chemicals used were of analytical grade.
Preparation of the chosen fungicides
The fungicides were prepared at various concentrations. Azoxystrobin and difenoconazole were prepared at 1, 2.5, 5, 35, 50, and 100 ppm. Dimethomorph, propiconazole, and thiophanate-methyl were prepared at 50 and 100 ppm. Boscalid and pyraclostrobin were prepared at concentrations ranging from 25 to 300 ppm. Titanium and silicon dioxide nanoparticles were prepared at 5000 ppm and 10,000 ppm. The active ingredients were dissolved in acetonitrile to achieve the desired concentrations according to Esteve-Turrillas et al. [41].
A mixture of fungicides was prepared using different combinations. One mixture contained boscalid and pyraclostrobin in a 2:1 ratio at concentrations of 150 and 300 ppm. Another mixture consisted of difenoconazole and propiconazole in a 1:1 ratio at concentrations of 100 and 200 ppm. The preparations were carried out at the Central Agricultural Pesticides Laboratory in Giza, Egypt.
Assessment of antifungal activity of the chosen fungicides
The antifungal activity of the various used fungicides was assessed using the disc diffusion method as described by Helmi et al. [42]. Czapek’s agar medium plates were inoculated with 10 µl of standard inoculum containing 1 × 107–8 spores/ml. Whatman No. 1 filter paper discs (5 mm in diameter) were carefully placed on the medium using sterile forceps. Subsequently, 10 µl of each tested fungicide was added to the discs. Three replicated plates were prepared for each fungicide concentration. Acetonitrile was used as a negative control. The inoculated plates were then incubated at 28 ± 2 °C for 48–72 h. After incubation, the diameters of inhibition zones were measured around the discs on each plate. The percentage of inhibition rate was calculated as the ratio of the inhibition zone diameter to the diameter of the colony in dishes without fungicide (9.1 cm).
Statistical analysis
The obtained data were analyzed using Duncan’s Multiple Range Tests at 0.05, the data were analyzed using IBM ® SPSS Statistics software version 25. A one-way analysis of variance (ANOVA) was used to evaluate the significance of the variance.
Results and discussion
Identification of isolated fungi and evaluation of microbial proteolytic enzyme activity
Identification of isolated fungi from historical leather bindings using a light microscope
Based on microscopic analysis, five fungal species were identified (Table 1). These species include Alternaria alternate (1 colony; 5%), Aspergillus fumigatus (9 colonies; 43%), Aspergillus niger (9 colonies; 43%), Aspergillus terrus (1 colony; 5%), and Penicillium chrysogenum (1 colony; 5%).
Fungi thrive in leather binding due to its pH value (4–6 pH), which promotes their growth [43]. The proteinous fibrous collagen in leather serves as a good source for the growth of proteolytic fungi [15]. Aspergillus-related isolates were found to be dominant in historical leather binding at Al-Azhar library. Aspergillus sp., Penicillium sp., and Alternaria sp. have been identified as common fungal species degrading historical leather [15, 44]. Aspergillus, belonging to Ascomycota, plays a significant role in the deterioration and attack of leather. Aspergillus niger and Aspergillus fumigatus have been isolated from numerous tanned leather [45].
Hassan [46] identified Aspergillus terreus, Aspergillus flavus, Aspergillus niger from historical leather bookbinding that dating back to the seventeenth century AD at Al Azhar Al Sharif Grand Mosque. Mansour et al. [45] identified Aspergillus fumigatus as the most important species of fungi found on a leather binding from Mohammad Ali pasha’s time (1858).
Strzelczyk et al. [43] noted that vegetable-tanned leathers are more prone to fungal growth due to the organic materials present in the plants used in the tanning process. Fungi can degrade collagen fibers in proteinous materials, utilizing unbound amino acids [15, 45]. This degradation can lead to a loss of mechanical properties and the development of colored stains in historical leather [45, 46].
Protein activity in isolated fungi
Data illustrated in Table 1 showed that the lowest protease activity among all fungal isolates was observed in fungal isolate (3–1) identified as Alternaria alternata, with a clear zone of 2.17 cm. In contrast, fungal isolate (2–7) identified as Aspergillus niger exhibited the highest protease activity compared to other fungal isolates, with a clear zone of 5.5 cm. This was followed by fungal isolate (3–4) identified as Aspergillus fumigatus, which recorded a clear zone of 5.4 cm.
Fungi have proteolytic activities, leading to the formation of acids like citric and pyruvic acids from tannin materials such as catechin used in tanning. This accelerates the acidic hydrolysis of leather. Different fungal species cause varying damage to leather bindings.
It was found that both A. niger and A. fumigatus exhibited strong proteolytic activities, indicating their effective role in the historical leather deterioration, by decomposing protein in leather bindings. The fungi that attack tanned leather are frequently from lipolytic species, which use leather’s fats as carbon sources [46]. Aspergillus fungi have a high biodegradation role for different components of books, manuscripts [47], and pretentious components such as fats, keratin, and others [45] and cause chemical and esthetic biodeterioration for artifacts [48, 49]. Aspergilli are capable of producing different acids such as gluconic, citric, kojic, and itaconic acids. Additionally, these fungi can secrete various enzymes such as collagenases, keratinases, proteinase, metalloproteinase, and other enzymes that play an important role in the decomposition of the structural properties of historical leather (collagen fibers) [45].
Fungi can cause hydrolysis of the leather surface through enzymes. These hydrolyzed products serve as food for fungal growth [44, 50]. The enzymatic activity of fungi leads to the biodeterioration of manuscripts, resulting in material loss and enzymatic degradation [51].
Identification of the most effective fungi for protein through PCR analysis
The results of protein activity testing revealed that fungal isolates 2–7 and 3–4 exhibited the highest levels of protein activity. These isolates were morphologically identified as Aspergillus niger and Aspergillus fumigatus, respectively (Fig. 2A, B). Consequently, they were chosen for further investigation.
The optical microscope images for the highest proteolytic fungal isolates; A Aspergillus niger; B Aspergillus fumigatus
Blast analysis of the fungal isolate (2–7) sequences with 16 S rRNA gene sequences in the NCBI GenBank database (Fig. 3) revealed a high similarity to Aspergillus niger, with 99.28 − 100% identity and 95 − 100% coverage with various strains of A. niger. The identified Aspergillus niger AUMC15523 (542 letters) strain showed the closest match to the isolate: GGTGCTGCTTTCTGGTACGTATACAACTGCCATTGGATTGGGGATGGAACATCGTCTCTTAGGCTATCTCAGCTTGAGTTCAGATGTTGTCCATTAGGTACATGCTATCGGTCTAAGAACACGTCTAACAATTCAACAGGCAGACCATCTCTGGCGAGCACGGCCTTGACGGCTCCGGTGTGTAAGTGCAACTTTTTCACGCCTCTCAATTGGTCAACAATGGGCAAAGGGTTGGGTCTTCTGACACGCAGGATAGTTACAATGGCACCTCCGACCTCCAGCTGGAGCGCATGAACGTCTACTTCAACGAGGTGAGATCCATCGGACCTTTGCTTTTACACGACAATATCATCAATGTCCTAATCACTTCAGCAGGCTAGCGGTAACAAGTATGTTCCTCGTGCCGTCCTCGTCGACCTCGAGCCCGGTACCATGGACGCCGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGCCAGTCCGGTGCTGGTAACAACTGGGCCAAGGGTCACTAACCTTGAGG.
The sequencing results confirmed that the isolate (3–4) is Aspergillus fumigatus (Fig. 4) with a high level of identity (99.66 − 100%) and coverage (99–100%) compared to several strains of A. fumigatus, including the type strain ATCC 1022 (NR_121481). The DNA sequences of the nuclear ribosomal RNA gene operon were used for identification. AUMC15522 (582 letters): CGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTCTATCGTACCTTGTTGCTTCGGCGGGCCCGCCGTTTCGACGGCCGCCGGGGAGGCCTTGCGCCCCCGGGCCCGCGCCCGCCGAAGACCCCAACATGAACGCTGTTCTGAAAGTATGCAGTCTGAGTTGATTATCGTAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCCGTCCCCCTCTCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCTGCTCTGTAGGCCCGGCCGGCGCCAGCCGACACCCAACTTTATTTTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAAAAGCCGGAGGAA.
The phylogenetic tree based on beta-tubulin gene sequencing of rDNA of the fungal sample (Aspergillus niger AUMC15523) isolated in this study. The tree includes closely related strains accessed from GenBank, showing 99.28–100% identity and 95–100% coverage with several A. niger strains. Aspergillus flavus and Aspergillus ochraceus are included in the tree as outgroup strains
Shows a phylogenetic tree based on ITS sequences of rDNA of the fungal sample isolated in this study (Aspergillus fumigatus AUMC15522, indicated by an arrow) compared to closely related strains from GenBank. The sample showed high identity (99.66–100%) and coverage (99–100%) with various strains of A. fumigatus, including the type strain ATCC 1022 (NR_121481). Aspergillus niger was used as an outgroup strain
Selection of the effective fungicides and their concentrations for protecting leather samples againstAspergillus fumigatus
The first step
The fungicides azoxystrobin and difenoconazole were tested at various concentrations (1, 2.5, 5, 35, 50, and 100 ppm), along with nano forms of titanium and silicon dioxides at 5000 ppm (0.5%) and 10,000 ppm (1%) for their inhibitory effects on Aspergillus fumigatus. The results, presented in Table 2; Fig. 5, demonstrated that the inhibition activity increased with higher concentrations of all tested fungicides. The maximum inhibition activity for azoxystrobin and difenoconazole was observed at 35 ppm, while for titanium and silicon dioxides nano forms, it was at 10,000 ppm. The highest inhibition rate was 18% for 35 ppm difenoconazole and 15% for 35 ppm azoxystrobin. The nano form fungicides exhibited 14% and 12% inhibition at 10,000 ppm for titanium dioxides and silicon dioxides, respectively. These results highlight the efficacy of difenoconazole against Aspergillus fumigatus [52]. A fungus commonly associated with invasive aspergillosis. Triazole fungicides, like difenoconazole, are known to have antifungal properties against A. fumigatus [52].
The study found that titanium and silicon dioxide nanoparticles were ineffective against Aspergillus fumigatus. The effectiveness of nanoparticles varied depending on the type of fungus [42]. As a result, titanium and silicon dioxide nanoparticles will be excluded from further evaluation. In the next step, difenoconazole, azoxystrobin, and other fungicides will be tested at concentrations of 50 and 100 ppm.
The inhibition zones of nanoparticles of titanium and silicon dioxides, as well as difenoconazole and azoxystrobin against Aspergillus fumigatus
The second step
The fungicides azoxystrobin, pyraclostrobin, difenoconazole, propiconazole, boscalid, dimethomorph, and thiophanate-methyl were tested for their ability to inhibit the growth of Aspergillus fumigatus at concentrations of 50 and 100 ppm. The data in Table 3; Fig. 6 showed significant differences among the tested fungicides. Boscalid exhibited the highest inhibition rate at 46.2% and 54.9%, followed by pyraclostrobin at 36.3% and 40.7% at 50 and 100 ppm, respectively. Azoxystrobin had the lowest percentage of inhibition at 9.9% and 12.1%, followed by thiophanate-methyl at 12.1% and 14.3% at 50 and 100 ppm, respectively.
The results in Table 3; Fig. 6 show that difenoconazole and dimethomorph fungicides had similar inhibition rates at 50 and 100 ppm (17.6%, 22.1% and 15.4%, 19.8% respectively), with no significant differences between them. Propiconazole had slightly lower inhibition rates (14.3%, 17.6%) compared to boscalid (46.2%, 54.9%) and pyraclostrobin (36.3%, 40.7%).
Statistical analysis in Table 3 revealed that boscalid and pyraclostrobin exhibited the highest inhibition rates. Boscalid demonstrated the highest inhibition rate of 4.53, followed by pyraclostrobin with a rate of 3.51, both significant at p ≤ 0.05. The multiple correlation coefficient R2 was calculated to be 0.987, indicating that the model can explain 98.7% of the variation in the response. Consequently, these two fungicides were selected for further testing to determine the optimal concentration for achieving the highest inhibition.
The clear zone for Aspergillus fumigatus treated with various fungicides at concentrations of 50 and 100 ppm
The third step
Boscalid and pyraclostrobin fungicides showed the highest inhibition rates and were tested at higher concentrations to achieve maximum inhibition. The data in Table 4; Fig. 7 indicated that both boscalid and pyraclostrobin effectively controlled Aspergillus fumigatus. Boscalid inhibited 50% of growth at 100 ppm (54.9%), while pyraclostrobin achieved 58.2% inhibition at 150 ppm. Boscalid treatment resulted in the highest reduction of fungal growth across different concentrations, followed by pyraclostrobin [53]. Boscalid’s unique mode of action sets it apart from pyraclostrobin and other fungicides, offering new strategies for fungal resistance [54].
The evaluation of the two selected fungicides at concentrations ranging from 25 to 300ppm revealed a proportional increase in the inhibition rate with the concentration of the fungicide. The highest inhibition rates were observed at 300 ppm of boscalid and pyraclostrobin, with rates of 87.9% and 70.3%, respectively. The multiple correlation coefficient R2 value of 0.986 indicates that 98.6% of the variance in the dependent variable studied is explained by the variance in the independent variable.
The clear zone for Aspergillus fumigatus treated with different concentrations of boscalid and pyraclostrobin
The fourth step
The results of treatment with a mixture of difenoconazole and propiconazole (1:1) are shown in Table 5; Fig. 8. The mixture exhibited the third highest activity inhibition rate at 100 ppm (54.9%) and 200 ppm (60.4%), following individual fungicides boscalid and pyraclostrobin. This contrasts with the lower activity inhibition rates of difenoconazole (22.1%) or propiconazole (17.6%) alone at 100 ppm in the previous step.
The data from the fungicide mixing experiment (Table 5; Fig. 8) demonstrated that a combination of boscalid and pyraclostrobin in a 2:1 ratio effectively controlled Aspergillus fumigatus. This mixture achieved inhibition rates of 85.7% and 95.6% at concentrations of 150 and 300 ppm, respectively. It is commonly recommended to use fungicides with different modes of action in mixtures to manage resistance [53]. The combination of boscalid and pyraclostrobin has shown fungicidal activity against various fungi [53]. Boscalid is frequently detected in pesticide mixtures, and previous studies have highlighted the effectiveness of strobilurins like pyraclostrobin in fungicide combinations [53].
The linear diagram (Fig. 9) illustrates that at 200 ppm, boscalid caused 76.9% growth inhibition, while pyraclostrobin caused 63.7% inhibition. This suggests that 200 ppm is the optimal concentration. Therefore, future studies will evaluate the nano forms of boscalid and pyraclostrobin fungicides at 200 ppm.
The clear zone for Aspergillus fumigatus treated with mixed fungicides at various concentrations
The growth inhibition of Aspergillus fumigatus under different treatment concentrations ranging from 25 to 300 ppm
Selection of the effective fungicides and their concentrations for protecting leather samples against Aspergillus niger
The first step
The data from Table 6; Fig. 10 indicate that the impact of titanium dioxide nanoparticles (9.9%, 11.5%) and silicon dioxide nanoparticles (12.1%, 13.2%) at concentrations of 5000 and 10,000 ppm, respectively, on the inhibition rate of Aspergillus niger was minimal. This suggests that Aspergillus niger exhibits high resistance to the tested nanoparticles, possibly due to its production of chemical components like ascorbic acid. This finding aligns with previous research by Helmi et al. [42], who observed negligible inhibition zones (0 cm, 0 cm, 1.25 cm) when using titanium dioxide nanoparticles at concentrations of 5, 10, and 15 µg/ml against Aspergillus niger.
Treatment with azoxystrobin at 5 and 35 ppm resulted in a minor control (10.5%, 12.1%) of Aspergillus niger. Difenoconazole exhibited the highest effectiveness (11%, 12.1%, 14.3%, and 16.5%) at 1, 2.5, 5, and 35 ppm compared to other fungicides. Triazole molecules are commonly used to combat aggressive aspergillosis [52].
Based on the initial findings, titanium and silicon dioxide nanoparticles will not be included in the next phase of the study. Instead, difenoconazole, azoxystrobin, and other fungicides will be tested at higher concentrations (50 and 100 ppm) as the lower concentrations used in this study were found to be less effective.
The clear zone of Aspergillus niger treated with difenoconazole and azoxystrobin, as well as nanoparticles of titanium and silicon dioxides
The second step
The data from Fig. 11; Table 7 indicate that the boscalid fungicide treatment had the highest inhibition rates at 50 ppm (29.7%) and 100 ppm (38.5%). Boscalid is a commonly detected pesticide [53]. Dimethomorph showed no inhibition at both concentrations, while thiophanate-methyl and propiconazole had inhibition rates of 9.9% and 11% at 50 ppm, and 0% and 12.1% at 100 ppm, respectively. Propiconazole was effective at 100 ppm but had no effect at 50 ppm. Aspergillus niger is known for its resistance to fungicides [42].
The fungicides difenoconazole, azoxystrobin, and pyraclostrobin showed temporary effects on inhibition rates of 17.6% and 19.8%, 13.2% and 15.4%, and 11% and 13.2% at concentrations of 50 and 100 ppm, respectively.
The inhibition zone for Aspergillus niger treated with various fungicides at concentrations of 50 and 100 ppm
The third step
The data from Table 8; Fig. 12 show that the inhibition rate of fungi treated with boscalid increased with higher concentrations. The inhibition rates were 27.5%, 29.7%, 38.5%, 54.9%, 63.7%, 65.9%, and 72.5% at concentrations of 25, 50, 100, 150, 200, 250, and 300 ppm, respectively.
The individual fungicide boscalid has been shown to inhibit the growth of Aspergillus niger. Testing the effectiveness of mixing boscalid with other fungicides, such as pyraclostrobin, yielded positive results (Table 9; Fig. 13). This finding aligns with previous research by Serey et al. [55] who demonstrated that a combination of 200 mg/L boscalid and 100 mg/L pyraclostrobin effectively prevented rot caused by A. niger.
Following the successful performance of boscalid alone against Aspergillus niger, the fungicide was chosen for evaluation in nano form in the next phase. The linear diagram (Fig. 14) showed that the ideal concentration for inhibition rate was 200 ppm, which was selected for further evaluation in nano form.
The treatment with boscalid alone was effective against Aspergillus niger. The mixture of boscalid and pyraclostrobin (2:1) provided the best control for the fungus. In contrast, the combination of difenoconazole and propiconazole (1:1) had the lowest inhibition rates (27.5% and 46.1%) at 100 and 200 ppm, respectively, compared to other mixtures and individual boscalid. Cross-resistance between pyraclostrobin and boscalid indicated that their mechanisms of action are distinct [53].
The clear zone for Aspergillus niger treated with boscalid at various concentrations compared to the control
The clear zone of Aspergillus niger treated with mixed fungicides at various concentrations
The growth inhibition of Aspergillus niger under different concentrations of boscalid (25, 50, 100, 150, 200, 250, and 300 ppm)
Conclusion
In this study, twenty-one fungal isolates were obtained from the infected historical leather binding of an illuminated manuscript dating back to the Mamluk period at Al-Azhar library in Cairo, Egypt. The identified isolates included Aspergillus fumigatus (43%), Aspergillus niger (43%), Aspergillus terrus (5%), Alternaria alternate (5%), and Penicillium chrysogenum (5%). Protein activity screening was conducted for all identified isolates, with Aspergillus niger showing the highest proteolytic activity (5.5 cm) followed by Aspergillus fumigatus (5.4 cm). The two most potent proteolytic activity fungal isolates were identified as A. fumigatus AUMC 15,522 and A. niger AUMC 15,523 using 16 S rRNA gene sequencing. Seven fungicides and nanoparticles materials were evaluated against these isolates, with boscalid and pyraclostrobin showing better results against A. fumigatus. The mixture of boscalid + pyraclostrobin (2:1) exhibited good preservation effects against A. fumigatus, achieving 85.7% and 95.6% fungal inhibition at 150 and 300 ppm, respectively. For A. niger, individual boscalid fungicides were more effective compared to other fungicides and nanoparticles. The mixture of boscalid + pyraclostrobin (2:1) showed good antifungal activity, with 65.9% and 82.4% inhibition at 150 and 300 ppm, respectively. This study suggests further research to determine the optimal concentrations of boscalid and pyraclostrobin fungicides for protecting leather bindings against A. fumigatus and A. niger.
Data availability
No datasets were generated or analysed during the current study.
References
Abdel-Maksoud G, Omar SF, Hamed AA, Hassan RRA. Analytical techniques for condition assessment of leather binding of a historical manuscript from El-AzharAl-Sharif Library, Egypt. J Chem. 2024;67(7):141–50.
Vyskočilova G, Carşote C, Ševčik R, Badea E. Burial–induced deterioration in leather: a FTIR–ATR, DSC, TG/DTG, MHT and SEM study. H Sci. 2022;10(7):1–14.
Abdel-Maksoud G, Abdel-Hamied M, Abdelhafez AAM. Condition assessment of a mamluk historical illuminated leather binding at the library of mashiakht El-Azhar, Egypt. J Soc Leather Technol Chem. 2021;105(5):248–56.
Abdel-Hamied M, Abdelhafez AAM, Abdel-Maksoud G. Consolidation materials used with illuminated and non-illuminated paper manuscripts and historical leather bindings: a review. Pigment Resin Technol. 2024a. https://doi.org/10.1108/PRT-10-2023-0093.
Plavana V, Miub L, Gavrilyuk N. Evaluation of the amino acid composition, structure and Properties of Archaeological Leather. Proced Chem. 2013;8:279–83.
Abdel-Maksoud G, Abdel-Hamied M, Abdelhafez AAM. Evaluation of the condition of a mamluk-illuminated paper manuscript at Al-Azhar Library, Egypt. Pigment Resin Technol. 2023a;52(1):49–59.
Plavan V, Giurginc M, Budrugeac P, Vilsan M, Miu L. Evaluation of the physico—chemical characteristics of Leather samples of some historical objects from Kiev. Revista De Chim. 2010;61(7):627–31.
Zhang M, Fan J, Liu J, Chen Y, Lu Y, Lei Y, Kaya MGA, Tang K. A comprehensive evaluation of a historical leather armor from Yanghai Cemetery. Turpan Heri Sci. 2024;12(162):1–11.
Abdel-Maksoud G, Abdel-Hamied M, El-Shemy HA. Analytical techniques used for condition assessment of a late period mummy. J Cul Herit. 2021;48:83–92.
Hu Y, Liu J, Han G, Li X, Zhang Z, Zheng X, Wang F, Pei Y, Lei Y, Tang K. Artificial deterioration of vegetable-tanned leather under synergistic effect of temperature and humidity. J Cult Herit. 2022;53:118–26.
Abdel-Karim MH. The use of re-tainning materials for the treatment of vegetable tanned leather: article review. Bullet Facul Arts. 2019;53(2):61–84.
AbdelMaksoud G, Darwish SS, Mohamed WS, Elnagar KH, Hassaballah A. New approach for deacidifcation and consolidation of bone artifacts. Polym Bull. 2024;81:15127–52.
Abdel-Nasser M, Abdel-Maksoud G, Eid AM, Abdel-Rahman MA, Hassan SE, Abdel-Nasser A, Fouda A. Evaluating the efficacy of probiotic bacterial strain Lactobacillus plantarum for inhibition of fungal strains associated with historical manuscript deterioration: an experimental study. Fungal Biol. 2024;128:1992–2006.
Abdel-Maksoud G, Mohamed OA, Mohamed WS, Elnagar Kh, Abdallah A, Youssef R, Elsayed D, Labib N, Bayoumy AM, Elhaes H, Ibrahim MA. Physical prospective of polyamide 6 for the consolidation of fragile vegetable tanned Leather artifacts. J Cult Herit. 2024;67:32–41.
Koochakzaei A, Achachluei MM. Red stains on archaeological leather: degradation characteristics of a shoe from the 11th -13th centuries (seljuk period, Iran). J Amer Instit Conserv. 2015;54(1):45–56.
Ba Z, Zhang M, Chen Y, Cao Y, Hu Z, Kaya MGA, Tang K. Fungal deterioration on ancient leather artifacts. J Amer Leather Chem Assoc. 2023;118(12):529.
Sterflinger K, Pinzari F. The revenge of time: fungal deterioration of cultural heritage with particular reference to books, paper and parchment. Environ Microbiol. 2012;14(3):559–66.
Sizeland K, Edmonds RL, Basil-Jones MM, Kirby N, Hawley A, Mudie S, Haverkamp R. Changes to collagen structure during leather processing. J Agricult Food Chem. 2015;63(9):2499.
Zhang M, Hu Y, Liu J, Pei Y, Tang K, Lei Y. Biodeterioration of collagen-based cultural relics: a review. Fung Biol Rev. 2022;39:46–59.
Sterflinger K. Fungi: their role in deterioration of cultural heritage, fungal boil. Reviews. 2010;24:47–55.
AbdelMaksoud G, AbdelNasser M, Hassan S, Eid AM, AbdelNasser A, Fouda A. Biosynthesis of titanium dioxide nanoparticles using probiotic bacterial strain, Lactobacillus rhamnosus, and evaluate of their biocompatibility and antifungal activity. Biomass Convers Biorefin. 2024;14:23961–83.
Jasim AA, Hassan HA, Hassoni AA. Enzymatic estimation of some fungi isolated from manuscripts preserved at the Al-Hussein holy shrine. Inter J Health Sci. 2022;6(S3):5207–18.
Abdel-Hamied M, Abdel-Maksoud G, Abd-Alrahman SH, Abdelhafez AAM, Ahmed RF. Preliminary study for evaluation of some fungicides against aspergillus flavus isolated from historical illuminated paper manuscript dated back to the mamluk period. Biocatal Agric Biotechnol. 2024b;57(103113):1–15.
El-Gamal R, El-Nagar Kh, Tharwat NA, Abdel-Maksoud G. Colorimetry for evaluating the preservation efficiency of some triazole fungicides in archeological wooden artifacts. Pigment Resin Technol. 2024;53(1):94–102.
Calnan CN. Fungicides used on leathers, the Leather Conservation Centre. 1985;1–19.
Mabrouk N, Rashad Y, Elmitwalli H, Shabana Y, Sreenivasaprasad P, Elsayed Y. Assessment of some green fungicides against fungi isolated from different heritage sites and museums in Egypt. Sci Cult. 2023;9(3):101–12.
Cappitelli F, Cattò C, Villa F. The control of cultural heritage microbial deterioration. Microorganisms. 2020;8(1542):1–20.
Gikas GD, Parlakidis P, Mavropoulos T, Vryzas Z. Particularities of fungicides and factors affecting their fate and removal efficacy: a review. Sustainab. 2022;14(4056):1–23.
Anastassiadou M, Bernasconi G, Brancato A, Cabrera LC, Ferreira L, Greco L, Jarrah S, Kazocina A, Leuschner R, Magrans JO, Miron I, Nave S, Pedersen R, Reich H, Rojas A, Sacchi A, Santos M, Pia Scarlato A, Theobald A, Vagenende B, Verani A. Modification of the existing maximum residue levels for difenoconazole in leafy brassica. Europ Food Saf Authorit J. 2021;19(2):6407.
Kucharska K, Wachowska U, Czaplicki S. Wheat phyllosphere yeasts degrade propiconazole. BMC Microbiol. 2020. https://doi.org/10.1186/s12866-020-01885-6.
Environmental protection agency. Federal Register. Rules and Regulations. 1999;64(105), 29581–29589.
Voiculescu DI, Roman DL, Ostafe V, Isvoran A. A cheminformatics study regarding the human health risks assessment of the stereoisomers of difenoconazole. Molecules. 2022;27:4682.
Yang M, Zhang J, Zhang J, Rashid M, Zhong G, Liu J. The control effect of fungicide pyraclostrobin against freckle disease of banana and its residue dynamics under field conditions. J Environ Sci Health Part B. 2018;53(9):615–21.
Fraser M, Strelkov SE, Turnbull GD, Ahmed HU, Barton W, Hwang S. Evaluation of pyraclostrobin as a component in seed and foliar fungicides for the management of blackleg (Leptosphaeria Maculans) of canola (Brassica napus). Canad J Plant Sci. 2020;100:549–59.
Joshi J, Sharma S, Guruprasad KN. Foliar application of pyraclostrobin fungicide enhances the growth, rhizobial-nodule formation and nitrogenase activity in soybean (var. JS-335). Pesticide Biochem Physiol. 2014;114:61–6.
Sánchez-Torres P. Molecular mechanisms underlying fungicide resistance in citrus postharvest green mold. J Fungi. 2021. https://doi.org/10.3390/jof7090783.
Glass NL, Donaldson GC. Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous Ascomycetes. Appl Environ Microbiol. 1995;61(4):1323–30.
Frisvad JC, Larsen YO, Larsen TO. Aspergillus niger. In: Frisvad JC, Samson RA, editors. The Fungal Genomics Handbook. Cambridge: Academic Press; 2005. p. 123–36.
Jasim AA, Mohammed BT, Lahuf AA. Molecular and enzymatic properties of fungi isolated from historical manuscripts preserved at the Al-Hussein Holy Shrine. Biochem Cellul Archives. 2019;19(2):4295–305.
Calonne M, Fontaine J, Debiane D, Laruelle F, Grandmougin-Ferjani A, Sahraoui AL. Side effects of the sterol biosynthesis inhibitor fungicide, propiconazole, on a beneficial arbuscular mycorrhizal fungus. Commun Agricult Appl Biolog Sci. 2011;76(4):891–902.
Esteve-Turrillas FA, Mercader JV, Agulló C, Marzo J, Abad-Somovilla A, Abad-Fuentes A. Design and development of heterologous competitive immunoassays for the determination of boscalid residues. Analyst. 2014;139:3636–44.
Helmi FM, Ali NM, Ismael SM. Nanomaterials for the inhibition of microbial growth on ancient Egyptian funeral masks. Mediterr Archaeol Archaeomet. 2015;15(3):87–95.
Strzelczyk AB, Kuroczkin J, Krumbein WE. Studies on the microbial degradation of ancient leather bookbindings: part I. Inter. Biodeter. 1987;23:3–27.
Rathore DS, Chauhan S. Effect of climatic conditions on the succession of microflora on vegetable tanned leather (sheep) during storage. J Environ Res Develop. 2009;4(1):116–23.
Mansour M, Hassan R, Salem M. Characterization of historical bookbinding leather by FTIR, SEM-EDX and investigation of fungal species isolated from the, leather. Egypt J Archaeol Restor Stud. 2017;7(1):1–10.
Hassan RRA. Analytical study of a manuscript, ‘Tafsir Al Khazin ’—the seventeenth century AD. Curr Sci Inter. 2015;4(2):196–207.
El Bergadi F, Laachari F, Elabed S, Mohammed IH, Ibnsouda SK. Cellulolytic potential and filter paper activity of fungi isolated from ancients manuscripts from the Medina of Fez, Annal. Microbiol. 2014;64:815–22.
Hassan RRA, Hassan HM, Mohamed YA, Ismail MEM, Farid Y, Mohamed H, Ismail SH, Salem MZM, Abdel-Hamied M. ZnO, TiO2 and Fe3O4/ carbopol hybrid nanogels for the cleaner process of paper manuscripts from dust stains and soil remains. Herit Sci. 2023;11:221.
Abdel–Hamied M, Hassan HM, Mohamed YA, Ismail MEM, Farid Y, Mohamed H, Ismail SH, Salem MZM, Hassan RRA. Hybrid nanogels and their roles in eliminating soot stains from historical paper manuscripts. Heri Sci. 2024;12(1):104.
Rathore DS. Study of fungal diversity on different types of finished Leather and Leather Article. Res J Recent Sci. 2015;4:228–34.
Lintang W, Susetyo-Salim T, Oetari A, Sjamsuridzal W. Deteriorated old manuscripts from Banyumas, collection of Library of Universitas Indonesia. IOP Conf Series Earth Environ Sci. 2021;948:012031.
Léchenault-Bergerot C, Morin-Crini N, Rocchi S, Lichtfouse E, Chanet G, Crini G. Hemp to limit diffusion of difenoconazole in vegetable garden soils. Heliyon. 2019;5(e02392):1–6.
Avenot HF, Sellam A, Karaoglanidis G, Michailides TJ. Characterization of mutations in the Iron-sulphur subunit of Succinate Dehydrogenase correlating with Boscalid Resistance in Alternaria alternata from California Pistachio. Phytopathol. 2008;98(6):736–42.
Gabriolotto C, Monchiero M, Nègre M, Spadaro D, Gullino ML. Effectiveness of control strategies against Botrytis Cinerea in vineyard and evaluation of the residual fungicide concentrations. J Environ Sci Health Part B. 2009;44:389–96.
Serey RA, Torres R, Latorre BA. Pre- and post-infection activity of new fungicides against Botrytis Cinerea and other fungi causing decay of table grapes. Ciencia E Investigación Agrar. 2007;34(3):215–24.
Funding
Open access funding provided by The Science, Technology & Innovation Funding Authority (STDF) in cooperation with The Egyptian Knowledge Bank (EKB).
Author information
Authors and Affiliations
Contributions
Mostafa Abdel-Hamied: Conceptualization, manuscript administration, methodology, validation, formal analysis, investigation, data curation, writing—original draft preparation, writing-review and editing. Ahmed A. M. Abdelhafez: Methodology, validation, formal analysis, investigation, data curation, writing—original draft preparation, review and editing, Rania F. Ahmed: Methodology, validation, formal analysis, investigation, data curation, writing-review and editing, Sherif H. Abd-Alrahman: Methodology, validation, formal analysis, investigation, data curation, writing-review and editing, Gomaa Abdel-Maksoud: Conceptualization, manuscript administration, methodology, validation, formal analysis, investigation, data curation, writing—original draft preparation, writing-review and editing.
Corresponding author
Ethics declarations
Competing interests
The authors declare no competing interests.
Additional information
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
About this article
Cite this article
Abdel-Hamied, M., Abdelhafez, A.A.M., Ahmed, R.F. et al. Evaluation of some fungicides for inhibiting proteolytic fungi isolated from leather binding of a historical manuscript dated back to the Mamluk period. Herit Sci 12, 429 (2024). https://doi.org/10.1186/s40494-024-01511-y
Received:
Accepted:
Published:
Version of record:
DOI: https://doi.org/10.1186/s40494-024-01511-y
