Correction to: Nature Communications https://doi.org/10.1038/s41467-024-49673-4, published online 29 June 2024
In the version of the article initially published, in the section “A systematic view on genetic maps of chemoresistance”, the sentence “Microtubule-related genes such as KIF1C…” has been corrected to “Microtubule-related genes such as KIFC1…” in the HTML and PDF versions of the article. In Supplementary Data 6, two oligo sequences were incorrectly written as ‘sgRNA_MMACHC-2_Forward: CACCGGGTGTATGCACACACCTGA’ and ‘sgRNA_MMACHC-2_Reverse: AAACTCAGGTGTGTGCATACACCC’. The correct version should be ‘sgRNA_MMACHC-2_Forward: CACCGCTAACACGGCCCAGATGGT’ and ‘sgRNA_MMACHC-2_Reverse: AAACACCATCTGGGCCGTGTTAGC’. A corrected version of Supplementary Data 6 is now available online.
Author information
Authors and Affiliations
Corresponding authors
Supplementary information
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Zhong, C., Jiang, WJ., Yao, Y. et al. Author Correction: CRISPR screens reveal convergent targeting strategies against evolutionarily distinct chemoresistance in cancer. Nat Commun 16, 1569 (2025). https://doi.org/10.1038/s41467-025-56972-x
Published:
Version of record:
DOI: https://doi.org/10.1038/s41467-025-56972-x