Structural insights into the human HRD1 ubiquitin ligase complex

Guo, Liling; Liu, Guoyun; He, Jingjing; Jia, Xiaoxiao; He, Yonglin; Wang, Zhenhua; Qian, Hongwu

doi:10.1038/s41467-025-61143-z

Download PDF

Article
Open access
Published: 01 July 2025

Structural insights into the human HRD1 ubiquitin ligase complex

Nature Communications volume 16, Article number: 6007 (2025) Cite this article

4925 Accesses
5 Citations
1 Altmetric
Metrics details

Subjects

Abstract

In the endoplasmic reticulum (ER), defective proteins are cleaned via the ER-associated protein degradation (ERAD) pathway. The HRD1 ubiquitin ligase complex, with HRD1, SEL1L, XTP3B or OS9 and Derlin family proteins as the core components, plays essential roles in the recognition, retrotranslocation, and ubiquitination of luminal ERAD substrates. However, the molecular basis is unclear. Here, we determine the cryo-EM structure of the human HRD1-SEL1L-XTP3B complex at 3.3 Å resolution. HRD1 is a dimer, but only one protomer carries the SEL1L-XTP3B complex, forming a 2:1:1 complex. Careful inspection of the EM map reveals a trimmed N-glycan sandwiched by XTP3B and SEL1L, and SEL1L may also contribute to the recognition of the trimmed glycan. The complex undergoes dramatic conformational changes when coexpressed with Derlin proteins. The HRD1 dimer is broken, and two HRD1-SEL1L-XTP3B (1:1:1) units are joined together by a four-helix bundle formed by two SEL1L molecules. The four-helix bundle also touches the micelle, resulting in a bent transmembrane region. These findings indicate that Derlins engagement may induce local curvature in the ER membrane. Cell-based functional assays are conducted to verify the structural observations. Our work provides a structural basis for further mechanistic elucidation of mammalian HRD1 complex-mediated ERAD.

Structural basis and pathological implications of the dimeric OS9-SEL1L-HRD1 ERAD Core Complex

Article Open access 27 January 2026

Direct observation of autoubiquitination for an integral membrane ubiquitin ligase in ERAD

Article Open access 13 February 2024

SEL1L-HRD1 interaction is required to form a functional HRD1 ERAD complex

Article Open access 16 February 2024

Introduction

Protein folding is tightly controlled in the endoplasmic reticulum (ER)¹. Defective proteins are cleaned from the ER via the well-known ER-associated protein degradation pathway (ERAD), during which misfolded proteins undergo recognition, retrotranslocation, ubiquitination, and finally degradation by cytosolic proteasomes^2,3. ERAD substrate ubiquitination is catalyzed by E3 ligases located on the ER membrane with a cytosolic catalytic domain. In yeast, the ERAD-related E3 ligases include HMG-CoA reductase degradation protein 1 (Hrd1) and degradation of alpha2 10 (DOA10), of which Hrd1 is better understood⁴. Hrd1 is involved in the ERAD of luminal (ERAD-L) and membrane substrates (ERAD-M)⁵. On the ER membrane, Hrd1 is stabilized by another ER membrane protein, Hrd3⁶, which interacts with a luminal lectin (yOS9) and mediates substrate loading from yOS9 onto the Hrd1 ubiquitin ligase^7,8,9,10.

In mammalian cells, the ERAD system is more complicated, with more than dozens of E3 ligases on the ER membrane¹¹. HRD1, a mammalian Hrd1 homolog, is also an ER membrane-associated E3 ligase involved in the degradation of ER luminal substrates^12,13,14,15. Like Hrd1, mammalian HRD1 is also stabilized by the suppressor/enhancer of Lin-12-like protein (SEL1L), which is orthologous to Hrd3¹⁶. SEL1L also mediates substrate loading onto HRD1 via direct interaction with luminal lectins, including OS9 and XTP3B^17,18. OS9, the mammalian ortholog of yOS9, possesses one mannose 6-phosphate receptor homology (MRH) domain to recognize trimmed N-glycans on misfolded glycoproteins¹⁷. XTP3B has two MRH domains^19,20, with the N-terminal domain (MRH1) being essential for trimmed glycan recognition and the C-terminal domain (MRH2) potentially involved in direct interaction with SEL1L¹⁸. In addition to these SEL1L-dependent interactors, there are also SEL1L-independent interactors in the mammalian HRD1 complex, such as FAM8A1 and HERP1^21,22, which makes the mammalian HRD1 complex more complicated than its yeast homolog. Furthermore, the mammalian HRD1 complex seems to be more dynamic with adaptive organization to achieve substrate-specific degradation²¹.

As one of the most conserved branches of ERAD, the mammalian HRD1 ubiquitin ligase complex is essential for multiple significant physiological processes, including metabolic regulation^23,24,25, maintenance of intestinal homeostasis^26,27, maintenance and regulation of immune cell functions^{28,29,30,31,32}, prohormone maturation^33,34, and maintenance of β-cell maturation and identity³⁵. HRD1-mediated ERAD has been reported to be associated with kidney diseases³⁶, obesity³³, liver cirrhosis³⁷ and diabetes^35,38. Recently, several mutations in the core components of HRD1 complexes have been reported to cause embryonic lethality, developmental delay and other disorders after birth^39,40.

Despite these significant physiological roles, the molecular basis of the HRD1 complex remains unclear because of the limited structural information. The first reported structure was the yeast Hrd1-Hrd3 complex⁴¹, in which Hrd1 is a dimer. A follow-up study suggested that yeast Hrd1 may function monomerically and form a 1:1 complex with Der1 to thin the membrane at the interface⁴². In mammals, the tetrameric structure of Derlin1 and its complex structure with hexameric VCP were reported recently^43,44. Although yeast Der1 shares sequence similarity with these mammalian Derlin proteins, it lacks the SHP box, which mediates direct interactions between Derlin proteins and the VCP complex, the energy provider for substrate retrotranslocation. In yeast, another Derlin protein, Dfm1, has been reported to possess an SHP box that interacts with the yeast VCP complex⁴⁵. These findings suggest that the mammalian HRD1 complex is distinct from its yeast homolog, underscoring the necessity for structural investigation of the mammalian HRD1 complex.

Here, we present structural investigations of the mammalian HRD1 complex by determining the cryo-EM structures of human HRD1-SEL1L-XTP3B both in the presence and absence of Derlin proteins. Despite the partial reconstitution of the HRD1 complex by overexpression, our structural analysis provides the basis for the specificity of the MRH domain in recognizing trimmed N-glycans and suggests the involvement of SEL1L in glycan recognition. These structures also reveal dramatic conformational changes in SEL1L induced by Derlin family proteins.

Results

Structural determination of the human HRD1-SEL1L-XTP3B complex

Initially, we sought to purify the native HRD1 complex for structural determination. After genetically engineering tandem FLAG and strep tags at the C-terminus of the endogenous HRD1 gene in HEK293T cells, we isolated the native HRD1 complex via affinity purification (Supplementary Fig. 1a). Immunoblot analysis confirmed the copurification of key HRD1 complex components endogenously, including SEL1L, XTP3-B, and Derlin1. However, the native HRD1 complex may not be suitable for structural determination because of its low yield and heterogeneous behaviors (Supplementary Fig. 1b, c). We therefore attempted to reconstitute a subcomplex by overexpressing HRD1, SEL1L and XTP3B in HEK293 cells. Even though the stoichiometry of the HRD1 complex may be altered under conditions of HRD1 overexpression²², the structure of the reconstituted HRD1-SEL1L-XTP3B complex could provide valuable insights into the HRD1-SEL1L and SEL1L-XTP3B interfaces.

First, we cloned the HRD1, SEL1L, and XTP3B genes from the HEK293 cDNA library. Unexpectedly, a short transcript of SEL1L was cloned, which lacked the first 63 nucleotides of exon 4 and the entire exon 12 (69 nucleotides), resulting in the absence of residues 114-134 and 396-418 in the final protein products (Supplementary Fig. 1d). After searching the NCBI library, this short transcript was found to be the predicted transcript variant X3 of SEL1L (XM_054376559.1). We name this transcript SEL1L_X3 hereafter_, and the full-length transcript is named SEL1L_FL. Despite the internal deletions of 44 residues, SEL1L_X3 exhibited normal efficiency in reducing the accumulation of the endogenous ERAD substrate CD147⁴⁶ compared with the full-length transcript (Fig. 1a), indicating that SEL1L_X3 remains functional.

**Fig. 1: Structural determination of the human HRD1-SEL1L_FL-XTP3B complex.**

SEL1L_FL and SEL1L_X3 were then expressed with full-length HRD1 and XTP3B to obtain the HRD1-SEL1L_FL-XTP3B and HRD1-SEL1L_X3-XTP3B complexes, respectively. Both complexes exhibited favorable behavior in size exclusion chromatography (SEC) (Fig. 1b, Supplementary Fig. 1e). The peak fractions were concentrated for cryo-EM sample preparation, resulting in homogenous particles and promising 2D averages (Supplementary Fig. 1f). Large datasets were therefore collected to determine the cryo-EM structures of HRD1-SEL1L_FL-XTP3B and HRD1-SEL1L_X3-XTP3B at 3.3 Å and 3.5 Å, respectively (Supplementary Figs. 2, 3, and Supplementary Table 1).

We then built an atomic model of HRD1-SEL1L-XTP3B on the basis of the HRD1-SEL1L_FL-XTP3B map. The AlphaFold2-predicted models⁴⁷ facilitated model building for regions with moderate resolutions. In the HRD1-SEL1L_FL-XTP3B map, most parts of the transmembrane region (TMD) were poorly resolved, not allowing sidechain assignment (Supplementary Fig. 2). Fortunately, this region was better resolved in the HRD1-SEL1L_X3-XTP3B map with C2 symmetry. Hence, the TMD was built on the basis of the HRD1-SEL1L_X3-XTP3B map, which was docked into the HRD1-SEL1L_FL-XTP3B map to generate the final HRD1-SEL1L-XTP3B model (Supplementary Fig. 4 and Supplementary Table 1).

Finally, the TMDs (1–266) of HRD1 and the MRH1 domain of XTP3B were built, but the RING finger domain on HRD1 and the MRH2 domain on XTP3B were unsolved. In addition to the MRH1 domain, four β-sheets and a helix were resolved for XTP3B to constitute a new domain (4β1α) to interact with SEL1L. The yeast Hrd3 was reported to contain 12 Sel1-like repeats (SLRs)⁴¹, each consisting of an N-terminal helix (N-helix), a loop, and another C-terminal helix (C-helix). All 12 SLRs were assigned to SEL1L in the HRD1-SEL1L-XTP3B complex (Supplementary Figs. 4, 5; Supplementary Table 1).

In the structure, HRD1 is a dimer, which is consistent with previous reports⁴⁸. However, only one HRD1 protomer can bind the SEL1L-XTP3B unit, resulting in a 2:1:1 complex (Fig. 1c, d). Docking another SEL1L to the free HRD1 protomer led to heavy clashes between the original SLR6-7 and the docked SLR6-7. This analysis may explain why the 2:2:2 complex was not observed (Supplementary Fig. 6a). Interestingly, the 2:2:2 complex was observed in the SEL1L_X3-corresponding map (Supplementary Fig 3c). After careful analysis, clashes are avoided because SLR4-6 of SEL1L_X3 are flexible after the internal deletion of 396-418 residues, which constitute the C-helix of SLR4 and the N-helix of SLR5 (Supplementary Figs. 5b, c and 6a). Because there are no previous reports about the SEL1L_X3 isoform, we focused our analysis on the 2:1:1 complex and regarded it as the HRD1-SEL1L-XTP3B complex unless otherwise specified.

HRD1 dimeric interface

Two HRD1 molecules are observed in both the SEL1L_FL- and SEL1L_X3- corresponding complexes (Fig. 1c, d, and Supplementary Fig. 3c). Owing to the well-resolved TMD in the HRD1-SEL1L_X3-XTP3B map with C2 symmetry, we focused on this map to analyze the dimerization of HRD1. The yeast homolog yHrd1 was also first reported as a dimer⁴¹. Structural comparison revealed that the HRD1 dimer is distinct from the yHrd1 dimer (Supplementary Fig. 6b). The yHrd1 dimer is stabilized by a more extended interface contributed by TM1/2/3/4/8⁴¹. However, the HRD1 dimeric interface is primarily composed of hydrophobic residues from TM3 and TM8, including Thr86/Cys89/Leu90/Thr93/Val94/Phe99 on TM3 and Phe240/Leu242 on TM8. A π-interaction network composed of Trp82/Tyr83 (TM3) and Arg246/Tyr249 (TM8) may also contribute to dimer formation (Fig. 2a, Supplementary Fig. 6b). Mutations at these residues diminished the interaction between Strep-tagged HRD1 and FLAG-tagged HRD1 when coexpressed in HEK293F cells (Fig. 2b), confirming our structural observations.

Here, the HRD1 complexes were purified using decylmaltose neopentylglycol (DMNG) as the solubilized detergent; under these conditions, the yHrd1 complex was purified to be monomeric⁴². This finding suggested that hHRD1 may function in a different oligomeric state than yHrd1 does. Supporting this, most residues constituting the dimeric interface are unconserved in yeast but identical from Danio rerio to Homo sapiens, including Trp82, Tyr83, Thr86, Cys89, Leu90, Thr93, and Val94 (Fig. 2c). When mutations were introduced to disrupt the dimeric interface, HRD1 variants presented reduced ubiquitination activity and decreased efficiency in eliminating accumulated CD147 (Fig. 2d, Supplementary Fig. 6c), highlighting the essential roles of these interfacial residues.

Nevertheless, we cannot entirely dismiss the possibility that the observed dimerization of HRD1 may be an artifact of HRD1 overexpression. After single-cell sorting, we isolated a heterozygous clone containing both tagged and wild-type HRD1 alleles. Coimmunoprecipitation experiments demonstrated the efficient coprecipitation of untagged HRD1 with tagged HRD1 (Supplementary Fig. 6d), indicating the presence of native complexes containing multiple HRD1 molecules.

The interface between HRD1 and SEL1L

Although the HRD1-SEL1L-XTP3B complex was reconstituted through overexpression, its structure could provide a valuable basis for analyzing the HRD1-SEL1L and SEL1L-XTP3B interfaces. Here, we analyze this interface based on the HRD1-SEL1L_FL-XTP3B structure. SEL1L binds to a luminal helix (LH) between TM1 and TM2 on HRD1 via a concave interface composed of SLR11/12 and the C-terminal amphipathic helix (APH), which is consistent with that observed in the yeast Hrd1-Hrd3 complex⁴¹ (Fig. 2e, Supplementary Fig. 6e). The hydrophobic residues on LH (Phe29/Tyr30/Val33/Val34) are stabilized by the nonpolar residues from SEL1L, including Ala664/Phe668/Ala694/Ala701/Pro704/Leu707/Ala708, among which Phe668 may also π-interact with Tyr30 on LH, which is consistent with previous prediction and validation³⁹ (Fig. 2e). Additionally, Gln28 on HRD1 may form a hydrogen bond with Asp635/Tyr639/Gln665 on Sel1L (Fig. 2e). Consistent with these structural observations, HRD1 mutations (F29E/Y30E and Q28E) reduced HRD1-SEL1L complex formation, as well as substrate ubiquitination and clearance (Supplementary Fig. 6f–h). The SEL1L-F668A mutant was also found to have similar effects, despite its low expression levels (Supplementary Fig. 6f–h).

The interface between SEL1L and XTP3B

SEL1L serves as an adapter to interact with XTP3B or OS9 and loads misfolded glycoproteins to the HRD1 ubiquitin ligase^{17,18,19,49,50}. Our structures revealed the details of the interaction between XTP3B and SEL1L.

Although full-length XTP3B was expressed, the MRH2 domain was invisible (Fig. 3a, Supplementary Fig. 5d). The resolved MRH1 and 4β1α domains sit at the top of SEL1L, forming extensive interactions with N-terminal SLRs (SLR1-3) and C-terminal SLRs (SLR10-12), respectively (Fig. 3a). The interaction between SEL1L and XTP3B was almost disrupted when the 4β1α domain was deleted, while it was almost unchanged when the MRH1 or MRH2 domains were deleted (Supplementary Fig. 7b). These findings suggest that the MRH domains do not contribute much to XTP3B interaction with SEL1L, which is consistent with previous observations that the MRH domain of Yos9 does not make strong contact with Hrd3 in the yeast homology complex⁴². After superimposing the SEL1L-XTP3B complex with the yeast Hrd3-Yos9 complex relative to SEL1L/Hrd3, the 4β1α domain is located at a similar position as the β-sheet domain of Yos9 (Supplementary Fig. 7a). The MRH1 domain undergoes a 50° rotation away from the putative polypeptide-binding groove relative to the MRH domain of Yos9⁴² (Supplementary Fig. 7a), consistent with the proposal that the flexibility of the MRH domain is essential for loading the substrate into the groove⁴².

**Fig. 3: The SEL1L-XTP3B interface and a trimmed N-glycan sandwiched between SEL1L and XTP3B.**

The 4β1α domain constitutes a hydrophobic groove to interact with hydrophobic residues on the C-helix of SLR2, including Ala276/Leu279/Val280/Tyr281/Thr283/Phe284/Leu287. Several polar interactions may also contribute to the interaction between the 4β1α domain and N-terminal SLRs (Fig. 3a). The interface between the MRH1 domain and C-terminal SLRs is mediated primarily by polar and charged residues. Glu228 and Thr230 on MRH1 potentially interact in a polar manner with Asp683, His685, and Arg689 on SLR12. Asp39 on XTP3B forms an electrostatic bond with Arg620 on SEL1L. Both HRD1-SEL1L-XTP3B complex formation and CD147 clearance were impacted when these charged residues on SEL1L were substituted with alanine (Fig. 3b and Supplementary Fig. 7c).

A trimmed N-glycan sandwiched by SEL1L and XTP3B

After checking the EM maps in detail, extra density was observed to be sandwiched by the MRH1 domain of XTP3B and SLR12 of SEL1L in our structures (Fig. 3c). When superimposing the MRH1 domain of XTP3B with the structure of the MRH domain of OS9⁵¹, the extra density overlaps with the glycan ligands (Supplementary Fig. 7d), strongly suggesting that the extra density belongs to a glycan molecule. We therefore attempted to dock an N-glycan into the extra density. Eventually, a demannosylated glycan lacking the terminal mannoses at the B and C arms fits perfectly with the extra density (Fig. 3c, Supplementary Fig. 7e, f), consistent with previous reports that the MRH domain recognizes mannose-trimmed N-glycans^52,53,54.

There are two possible sources of the trimmed N-glycan: an endogenous substrate or one component of the HRD1 complex. Mapping the predicted N-glycosylation sites in the HRD1-SEL1L-XTP3B complex revealed that all N-glycosylation sites were far from the observed N-glycan (Supplementary Fig. 7g), ruling out the second possibility. We therefore speculated that the N-glycan may come from an endogenous substrate. Supporting this, the N-glycan connects to some unsolved densities that are near the predicted substrate binding groove⁴² (Supplementary Fig. 7h).

After modeling the trimmed N-glycan into the density, the mannose-trimmed C arm occupies the glycan binding pocket of the MRH1 domain without any space to accommodate another mannose moiety (Fig. 3d), providing a structural explanation for the recognized specificity of the MRH domain on N-glycans lacking the terminal mannose on Arm-C⁵³. On Arm-C, the terminal Man5_C forms hydrogen bonds with Gln133/Arg207/Glu228/Tyr234 on the MRH1 domain (Fig. 3d). In support of this, the XTP3B-R207A variant lost the ability to rescue the degradation of glycoproteins in OS9/XTP3B double knockout cells¹⁸. More interestingly, the trimmed B arm is primarily coordinated by SEL1L with hydrogen bonds between terminal Man5_B and Lys688/Asp692 on SLR12 (Fig. 3d). The K688A/D692A mutant exhibited a reduced capacity to eliminate endogenous CD147 without influencing the formation of the HRD1-SEL1L-XTP3B complex (Fig. 3b, Supplementary Fig. 7c). This structural observation and functional validation indicate the participation of SEL1L in substrate recognition.

Structural determination of HRD1-SEL1L-XTP3B in presence of Derlin1

Human Derlins have also been reported to be essential components of the HRD1 ubiquitin ligase complex^22,48,55. Among the three human Derlins, Derlin1 has been homogeneously purified for structural determination⁴³. We therefore initially attempted to purify the HRD1-SEL1L-XTP3B-Derlin1 complex by overexpressing all these components in HEK293 cells, aiming to elucidate the roles of Derlins in the complex. As the C-terminal region of HRD1 is highly dynamic and invisible in the aforementioned structures, we applied a truncated HRD1 construct by deleting the C-terminal residues after Gln341. Eventually, the complex was purified homogenously in the presence of 0.005% GDN, and the structure was solved at 3.5 Å resolution with cryo-EM (Supplementary Fig. 8 and Supplementary Table 1).

According to the EM map, the luminal regions were built with two SEL1L molecules and two XTP3B molecules. Despite the modest local resolution at the TMD, two HRD1 molecules can be docked into the map indubitability (Fig. 4a, b). In contrast to the direct contacts between two HRD1 molecules in the aforementioned structures, two HRD1 molecules are separated by some transmembrane segments in the central region of the TMD in this new map (Fig. 4a). Although these transmembrane segments may belong to Derlin1, we were unable to dock the recently published Derlin1 structure⁴³ into these densities. Furthermore, we did not identify suitable densities that could be fitted with the Derlin1 structure, potentially because of the high flexibility of Derlin1 relative to other components. We therefore designated this structure as HRD1-SEL1L-XTP3B (state D1) to reflect a novel conformation of HRD1-SEL1L-XTP3B in presence of Derlin1. The HRD1-SEL1L-XTP3B (state D1) model consists of three components, HRD1, SEL1L, and XTP3B, with two molecules for each component.

**Fig. 4: Cryo-EM structural analysis of the HRD1-SEL1L-XTP3B (state D1 or state D2).**

Derlin1 has broader functional roles, and Derlin2 has been specifically linked to the HRD1-SEL1L complex for the degradation of ER luminal glycoproteins^22,48,56,57. We therefore attempted to determine the structure of the HRD1-SEL1L-XTP3B-Derlin2 complex using the same strategy. Finally, we resolved this structure at 3.7 Å resolution (Supplementary Fig. 9). Similar to the HRD1-SEL1L-XTP3B (state D1) structure, we were able to unambiguously assign two HRD1, two SEL1L, and two XTP3B molecules, but we did not find suitable densities for Derlin2 (Fig. 4c). This structure was therefore designated HRD1-SEL1L-XTP3B (state D2) as well. HRD1-SEL1L-XTP3B (state D2) has a similar structural organization to that of HRD1-SEL1L-XTP3B (state D1) (Fig. 4a, c), and we chose HRD1-SEL1L-XTP3B (state D1) as a representative model for further structural analysis because of its relatively high resolution.

Structural analysis of the HRD1-SEL1L-XTP3B (state D1) structure

The HRD1-SEL1L-XTP3B (state D1) structure can be separated into two similar units, each containing one molecule for each component. Two HRD1-SEL1L-XTP3B units are joined together via an extensive interface between two SEL1L molecules (Fig. 4a, b). In each unit, SEL1L possesses similar interfaces as our previous descriptions to interact with HRD1 and XTP3B (Supplementary Fig. 10a). In contrast to the HRD1-SEL1L-XTP3B complex, two HRD1 molecules are separated in the HRD1-SEL1L-XTP3B (state D1) structure by some unsolved transmembrane segments in the central region (Fig. 4a–c).

An unexpected observation is that SEL1L undergoes structural rearrangements to form a four-helix bundle, the ends of which are two flexible loops that contact the unsolved transmembrane segments (Fig. 4a, b). The details of this structural rearrangement are discussed in the next section. The flexible loops consist of 484-495 residues, which form the N-helix of SLR7 in the original HRD1-SEL1L-XTP3B complex. To validate the essential roles of these loops, we generated three mutants within this region: D484A/Q486A/L487A (A484-487), Q488A/L489A/S491A (A488-491), and M492A/Y493A/Y494A/N495A (A492-495). All these mutations resulted in diminished capacities to eliminate the accumulation of endogenous CD147 (Fig. 4d), underscoring the critical role of these loops in the ERAD pathway.

Taken together, the HRD1-SEL1L-XTP3B (state D1) structure reveals three distinct interaction sites on SEL1L that contact the TMD (Fig. 4a): two sites interact with two HRD1 molecules (Site A and Site B), and the third site contacts the middle region of the TMD (Site C). These sites are not coplanar, potentially resulting in the observed bent micelle (Fig. 4a).

Structural rearrangements of SEL1L in the HRD1-SEL1L-XTP3B (state D1) structure

The major parts of SEL1L remained unchanged in the HRD1-SEL1L-XTP3B (state D1) structure, whereas SLR4-5 were unsolved potentially due to their flexibility, and SLR6-7 underwent dramatic structural rearrangements (Fig. 5a, Supplementary Fig. 10a, and Supplementary Movie 1). Specifically, the C-helix of SLR7 undergoes a 140° rotation relative to the N-helix of SLR8 (Fig. 5a, Supplementary Movie 1). Two glycine residues (Gly516/Gly517) are located at the linker between the C-helix of SLR7 and the N-helix of SLR8, ensuring flexibility for structural rearrangements (Supplementary Fig. 10b). Alanine substitution of these glycine residues resulted in an obvious reduction in the capacity to eliminate CD147 accumulation (Fig. 5c), indicating the essential roles of structural rearrangements in SEL1L function.

**Fig. 5: Structural rearrangements of SEL1L to form a four-helix bundle.**

These structural rearrangements result in a long helix composed of the C-helix of SLR7 and the N-helix of SLR8 (Fig. 5a). The N-helix of SLR7 is rearranged into a flexible loop to interact with the TMD, as we introduced in the former section (Figs. 4b and 5a). At the N-terminus of the flexible loop, the C-helix of SLR6 was resolved to be antiparallel to the C-helix of SLR7 (Fig. 5a). SLR4-5 and the N-helix of SLR6 were unsolved. In the HRD1-SEL1L-XTP3B (state D1) structure, two SEL1L molecules undergo similar structural rearrangements as our previous descriptions, and each contributes the C-helices of SLR6 and SLR7 to form a four-helix bundle at the dimeric interface (Fig. 5b and Supplementary Movie 1).

The four-helix bundle is primarily stabilized by a π-interaction network with four aromatic residues from each SEL1L molecule, including Tyr467/Phe474 on the C-helix of SLR6 and Tyr503/Phe510 on the C-helix of SLR7 (Fig. 5b). Alanine substitutions of these residues reduced the capacity to eliminate CD147 accumulation in the cell, indicating that four-helix bundle formation is essential for the function of SEL1L (Fig. 5c). Additionally, several hydrophobic residues may also contribute to the stabilization of the four-helix bundle. In addition to the four-helix bundle, SLR3 and SLR8 also contribute to the formation of the dimeric interface between two SEL1L molecules via hydrophobic interactions and several hydrogen bonds (Fig. 5b). Introducing mutations at the residues (Y523A/N524A/Q527A) reduced the elimination of endogenous CD147 as well (Fig. 5c).

Although the two SEL1L molecules in the HRD1-SEL1L-XTP3B (state D1) structure look similar, obvious differences were observed when superimposing their structures. A 9 Å movement is observed between the C-helix of SLR6 (Fig. 5d). Additionally, similar structural configurations of SEL1L were observed in the HRD1-SEL1L-XTP3B (state D2) structure, suggesting that these Derlin-induced conformational changes in the HRD1-SEL1L complex represent a conserved feature across paralogs (Fig. 4c).

Discussion

The HRD1 ubiquitin ligase complex is essential for the ER-associated degradation of luminal misfolded proteins. Here, we present structural investigations of the overexpressed HRD1-SEL1L-XTP3B complex, both with and without Derlin proteins. Even though the stoichiometry of the HRD1 complex may be altered in these overexpression systems²², the structures we present here provide valuable insights into the HRD1-SEL1L and SEL1L-XTP3B interfaces and establish a structural basis for a deeper mechanistic understanding of HRD1 complex-mediated ERAD.

Given that the stoichiometry of the HRD1 complex could be altered in the overexpression systems²², our initial goal was to purify the native HRD1 complex for structural determination. Although we successfully isolated the native HRD1 complex with endogenous affinity tags, the purified native complex was too heterogeneous for structural determination (Supplementary Fig. 1b, c), likely because of the highly dynamic nature of the native HRD1 complex. Given these challenges, determining the structure of the native complex would be a formidable task. In the absence of an available structure of the native complex, the structures presented in our study, despite being derived from overexpressed complexes, could provide basic structural information for further mechanistic exploration of HRD1-mediated ERAD.

Here, we resolved the structure of the HRD1-SEL1L-XTP3B complex in the presence and absence of Derlin proteins (Derlin1 or Derlin2) by co-expressing their components in HEK293 cells. After comparison of these structures, we observed dramatic conformational changes in the HRD1-SEL1L-XTP3B complex induced by Derlin proteins. The HRD1 dimer is broken, resulting in a 1:1:1 HRD1-SEL1L-XTP3B unit. SEL1L undergoes dramatic structural rearrangements to generate one pair of antiparallel helices formed by the C-helices of SLR6 and SLR7 (Fig. 5a). Then, two HRD1-SEL1L-XTP3B units contribute two pairs of antiparallel helices to form a four-helix bundle, resulting in a 2:2:2 complex (Fig. 5b). However, the relevance of this structural observation to the ERAD process remains to be elucidated.

Although we observed obvious conformational changes in the HRD1-SEL1L-XTP3B complex after the inclusion of Derlin proteins, it remains unclear how Derlin proteins induce these changes, as the Derlin proteins could not be accurately modeled in our HRD1-SEL1L-XTP3B (state D1 or D2) structures. In the HRD1-SEL1L-XTP3B (state D1 or D2) structures, two HRD1 molecules are separated by some transmembrane segments (Fig. 4a, c), which are likely contributed by Derlin proteins. Owing to the poor resolution of these segments, this speculation should be reconfirmed. To accurately localize the position of Derlin proteins within the HRD1 complex, it may be necessary to introduce other factors, such as FAM8A1, HERP, and VIMP, to further stabilize Derlin proteins in the complex.

In this study, we also identified a short isoform of Sel1L, SEL1L_X3, which has a normal ability to clean ERAD substrates compared with full-length SEL1L (Fig. 1a). SEL1L_X3 maintains almost identical interfaces as SEL1L_FL to interact with HRD1 and XTP3B. Each protomer in the HRD1 dimer can bind to SEL1L_X3, whereas only one protomer can bind to SEL1L_FL. The physiological role of SEL1L_X3 is unclear and needs further investigation.

Despite these uncertainties, our structural and functional investigations elucidate the HRD1-SEL1L and SEL1L-XTP3B interfaces within the HRD1 complex, provide the structural basis for the specificity of MRH1 to recognize trimmed N-glycans, reveal the involvement of SEL1L in the recognition of trimmed N-glycans, and present dramatic conformational changes in the complex induced by Derlin proteins. Although our overexpression strategy may alter the stoichiometry of the HRD1 complex and the physiological relevance of these structural observations to the ERAD process remains to be clarified, our structures provide a crucial foundation for the mechanistic understanding of mammalian HRD1 complex-mediated ERAD in the future.

Methods

CRISPR/Cas9-based knockout (KO) and knock-in (KI) HEK293T cells

To generate SEL1L- and HRD1-knockout cells, sgRNA oligonucleotides designed for the human SEL1L and HRD1 genes were inserted into the pSpCas9 (BB)-2A-Puro vector (Addgene, 48139). The resulting vectors were transfected into HKE293T cells with Lipofectamine 3000. The cells were selected with 1 μg/ml puromycin and isolated via single-cell sorting. The knockouts of the HRD1 and SEL1L genes were validated by immunoblotting with HRD1-specific and SEL1L-specific antibodies, respectively. The following primers were designed to generate the guide RNA for HRD1 and SEL1L.

HRD1

Forward primer sequence: CACCGTGATGGGCAAGGTGTTCTT

Reverse primer sequence: AAACAAGAACACCTTGCCCATCAC.

SEL1L

Forward primer sequence: CACCGGAGGGAAGATGGCAGACTG

Reverse primer sequence: AAACCAGTCTGCCATCTTCCCTCC.

To label endogenous HRD1 with FLAG and Strep tags, single-guide RNA (sgRNA) sequences targeting the desired genomic region (shown in Supplementary Fig. 1a) were cloned into the PX459 vector. The homologous recombination repair template DNA was created by cloning the left (695 bp long) and right (569 bp long) homology arms, together with the GFP sequence, into the pcDNA 3.1 vector. A Cas9- and sgRNA-expressing plasmid (PX459) and the plasmid containing the repair template were transfected into HEK293T cells via polyethylenimine (Yeasen Biotechnology (Shanghai)). After 24 h, the cells were selected with 2 μg/ml puromycin for several days. Immunoblotting was used for screening.

The following primers were designed to generate the guide RNA for knocking in HRD1:

Forward primer sequence: CACCGCTCAAAAGAGCAGAGGCTG

Reverse primer sequence: AAACCAGCCTCTGCTCTTTTGAGC

Native HRD1 complex purification

HEK293T cells (Invitrogen) stably expressing Strep and Flag-tagged endogenous HRD1 were cultured in DMEM (Gibco) supplemented with 10% FBS and 1% penicillin‒streptomycin at 37 °C under 5% CO₂. At ~90% confluence, cells from 110 plates (15 cm × 15 cm) were harvested, resuspended in lysis buffer (25 mM Tris pH 8.0, 150 mM NaCl, and protease inhibitor cocktail (Amresco), and solubilized with 1% (w/v) DMNG (Sigma) at 4 °C for 2 h. Following centrifugation at 20,000 × g for 60 min, the supernatant was loaded onto Strep-Tactin XT 4Flow resin (IBA Lifesciences). The resin was washed with Buffer A (25 mM Tris pH 8.0, 150 mM NaCl, 0.005% GDN (Anatrace)) and eluted with Buffer A containing 50 mM biotin. The eluate was then incubated with anti-FLAG M2 affinity resin (Sigma), washed with Buffer A, and eluted with Buffer A supplemented with 0.2 mg/mL FLAG peptide. The purified complexes were concentrated and subjected to size-exclusion chromatography (Superose 6 Increase 10/300 GL, Cytiva) in Buffer A. Peak fractions were collected for subsequent biochemical analyses. The essential components of the HRD1 complex in the native complex were confirmed by immunoblotting analysis with specific antibodies, including rabbit anti-SEL1L (Proteintech, 29801-1-AP), rabbit anti-HRD1 (Proteintech, 13473-1-AP), rabbit anti-XTP3B (Proteintech, 29773-1-AP), and rabbit anti-DERL1 (Abcam, ab176732) antibodies.

Protein expression and purification

The cDNAs of human HRD1 (accession: NM_172230.3), SEL1L_FL (accession: NM_005065.6), SEL1L_X3 (accession: XM_054376559.1), XTP3B (accession: NM_015701.5), Derlin1 (accession: NM_024295.6) and Derlin2 (accession: NM_016041.5) were amplified from the HEK293T cell-derived cDNA library and subcloned separately into the pCAG vector. The HRD1-SEL1L-XTP3B complex was expressed with a C-terminal Flag tag on HRD1 and a C-terminal 10×His tag on XTP3B for affinity purification. The HRD1-SEL1L-XTP3B-Derlins complexes were expressed with a C-terminal Flag tag on Derlin proteins and a C-terminal 10×His tag on HRD1. Full-length HRD1 was expressed to assemble the HRD1-SEL1L-XTP3B complex, whereas a truncated version of HRD1 (1-341) was expressed to purify the HRD1-SEL1L-XTP3B-Derlins complex. All the mutants were generated via a standard two-step PCR-based strategy. HEK293F cells (Invitrogen) were cultured in SMM 293T-TII medium (Sino Biological Inc.) at 37 °C under 5% CO₂. When the cell density reached 2.4 × 10⁶ cells/mL, a mixture of expression plasmids and polyethylenimine (Yeasen Biotechnology (Shanghai)) was added to the cell culture to initiate the transient expression of human Hrd1 complexes following a standard transfection protocol.

Approximately 48 h after transfection, the HEK293F cells were collected by centrifugation at 3800 × g for 10 min and resuspended in lysis buffer containing 25 mM Tris (pH 8.0), 150 mM NaCl, and a protease inhibitor cocktail (Amresco). The resuspended cells were solubilized with 1% (w/v) DMNG (Sigma) at 4 °C for 2 h. After centrifugation at 20,000 × g for 60 min, the supernatant was collected and applied to anti-Flag M2 resin (Sigma). The resin was rinsed with buffer A containing 25 mM Tris (pH 8.0), 150 mM NaCl and 0.005% (w/v) GDN (Anatrace) and eluted with buffer A plus 0.2 mg/mL Flag peptide. Then, the eluate was loaded onto Ni-NTA resin (Qiagen). After rinsing with buffer A, the complex was eluted with buffer A plus 250 mM imidazole. The eluate was concentrated and further purified by SEC (Superose 6 Increase 10/300 GL, Cytiva) in buffer A. The peak fractions were collected and concentrated for cryo sample preparation.

Biochemical validation of the interactions in the HRD1 complex

HRD1-HRD1 interactions

Strep-tagged HRD1 (HRD1-Strep) and FLAG-tagged HRD1 (HRD1-FLAG) variants were co-expressed in HEK293F cells. 48 h post-transfection, the cells were collected and solubilized with 1% (w/v) DMNG (Anatrace). The lysate was then centrifuged at 20,000 × g for 60 min, and the supernatant was subjected to affinity purification with Strep-Tactin XT 4Flow resin. After purification, the eluates were subjected to immunoblotting with anti-Strep and anti-FLAG antibodies. The expression levels of HRD1-FLAG and HRD1-Strep variants were assessed by immunoblotting before purification.

HRD1-SEL1L interactions

Flag-tagged HRD1 variants were co-expressed with SEL1L variants in HEK293F cells, following previously described protocols. 48 h post-transfection, the cells were collected and solubilized using 1% (w/v) DMNG (Anatrace). The lysate was then centrifuged at 20,000 × g for 60 min, and the supernatant was subjected to affinity purification with anti-Flag M2 resin. Following purification, the eluates were analyzed via SDS-PAGE. Prior to purification, the expression levels of the HRD1 and SEL1L variants were evaluated by immunoblotting.

SEL1L-XTP3B interactions

SEL1L variants were co-expressed with WT Flag-tagged HRD1 and XTP3B variants in HEK293F cells. 48 h post-transfection, the cells were collected and solubilized with 1% (w/v) DMNG (Anatrace). The lysate was then centrifuged at 20,000 × g for 60 min, and the supernatant was subjected to affinity purification with anti-Flag M2 resin. After purification, the eluates were subjected to SDS-PAGE analysis. The expression levels of SEL1L and XTP3B variants were assessed by immunoblotting before purification.

ERAD assay

The ERAD aasay was performed on HRD1-knockout (HRD1^–/−) and SEL1L-knockout (SEL1L^−/−) HEK293T cells with endogenous CD147 as an indicator of ERAD efficiency. HEK293T cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (Vivacell), 100 IU/mL penicillin, and 100 μg/mL streptomycin at 37 °C with 5% CO₂.

ERAD assay for HRD1 variants

HRD1^−/− HEK293T cells were seeded in 6-well plates at a density of 1.3 × 10⁶ cells per well. Six hours postseeding, each well was transfected with 2 µg of pCAG-HRD1 plasmid containing the indicated mutations using polyethylenimine as the transfection agent. After an additional 60 h of culture, the cells were harvested and lysed in buffer B containing 10 mM sodium pyrophosphate dibasic, 10 mM β-glycerophosphate, 4 mM EDTA, and 1% Triton X-100 on ice for 30 min. Then, the protein levels of HRD1 variants and endogenous CD147 in the cell lysates were analyzed by immunoblotting with HRD1-specific (Proteintech, 29801-1-AP) and CD147-specific (Proteintech, 11989-1-AP) antibodies, respectively.

ERAD assay for SEL1L variants

SEL1L^−/− HEK293T cells were seeded in 6-well plates at a density of 2.0 × 10⁶ cells per well. Six hours postseeding, each well was transfected with 2 µg of pCAG-SEL1L plasmid containing the indicated mutations using polyethylenimine as the transfection agent. After an additional 60 h of culture, the cells were harvested and lysed in buffer B on ice for 30 min. Then, the protein levels of SEL1L variants and endogenous CD147 in the cell lysates were analyzed by immunoblotting with SEL1L-specific (Proteintech, 29801-1-AP) and CD147-specific (Proteintech, 11989-1-AP) antibodies, respectively.

Substrate ubiquitination assay

HRD1^−/− HEK293T cells were seeded in 6-well plates at a density of 1.3 × 10⁶ cells per well. Six hours postseeding, each well was transfected with HRD1-Flag, HA-ubiquitin, CD147-Strep or empty vector plasmid using polyethylenimine as the transfection agent for 24 h. The cells were then treated with 50 μM MG132 proteasome inhibitor for 6 h, washed twice in ice-cold PBS and solubilized in lysis buffer (1% Triton X-100, 10 mM β-glycerophosphate, 10 mM sodium pyrophpsphate dibasic, and 4 mM EDTA). The lysates were centrifuged to obtain cytosolic proteins, which were then incubated with Strep-Tactin XT 4Flow resin (IBA-Lifesciences) for 2 h at 4 °C with gentle rotation. The beads were washed five times with lysis buffer, and the proteins were eluted with lysis buffer plus 50 mM biotin. The eluates were analyzed by immunoblotting with an anti-ubiquitin antibody.

SDS‒PAGE and immunoblotting

The cells were collected and lysed with buffer B on ice for 30 min at 4 °C. Proteins were denatured by heating at 95 °C for 8 min. Samples were subsequently separated via SDS‒PAGE and transferred to Immobilon-P PVDF membranes (Millipore, IPVH00010), which were then blocked with 5% nonfat milk in TBS (Biosharp, BL602A) plus 0.1% Tween-20 (TBST). The membranes were incubated with primary antibodies for 2 h at room temperature followed by three washes with TBST buffer. Then, the membrane was incubated with HRP-conjugated secondary antibodies for 1 h at room temperature. After three washes with TBST buffer, immunoreactive bands were detected with an enhanced chemiluminescence substrate (Proteintech, PK10003).

The following antibodies were used for immunoblotting: rabbit anti-SEL1L (Proteintech, 29801-1-AP), rabbit anti-HRD1 (Proteintech, 13473-1-AP), rabbit anti-CD147 (Proteintech, 11989-1-AP), and mouse anti-GAPDH (Proteintech, 60004-1-Ig). The following secondary antibodies were used: HRP-conjugated goat anti-rabbit IgG antibody (Proteintech, SA00001-2) and HRP-conjugated goat anti-mouse IgG antibody (Proteintech, SA00001-1).

Cryo-EM sample preparation and data collection

The cryo grids were prepared using Thermo Fisher Vitrobot Mark IV. Quantifoil R1.2/1.3 Cu grids were glow-discharged with air in a PDC-32G-2 plasma cleaner (Harrick) with a vacuum for 2 min and mid-force for 85 s. Aliquots of 3.5 μl of purified HRD1-SEL1L_X3-XTP3B, HRD1-SEL1L_FL-XTP3B, HRD1-SEL1L_FL-XTP3B-Derin1 (HRD1-SEL1L-XTP3B (state D1)), and HRD1-SEL1L_FL-XTP3B-Derlin2 (HRD1-SEL1L-XTP3B (state D2)) complexes concentrated to ~10 mg/mL, 12 mg/mL, 16 mg/mL, and 15 mg/mL, were applied to the glow-discharged grids, respectively. After blotting with filter paper for 3.5 s (100% humidity and 8 °C), the grids were plunged into liquid ethane cooled with liquid nitrogen.

The grid was loaded into a Titan Krios (FEI) electron microscope operating at 300 kV equipped with a BioQuantum energy filter and a K3 direct electron detector (Gatan). Images were automatically collected with EPU in the super-resolution mode. Defocus values varied from −1.5 to −1.7 μm. Image stacks were acquired with an exposure time of 3.8 s and fractionated into 32 frames with a total dose of 50 e^- Å⁻². The stacks were motion corrected with MotionCor2⁵⁸ and binned twofold, resulting in a pixel size of 1.07 Å/pixel, meanwhile dose weighting was performed⁵⁹. The defocus values were estimated with CTFFIND4⁶⁰.

Cryo-EM data processing

In total, 5476, 4193, 4460, and 1905 micrographs were collected for HRD1-SEL1L_X3-XTP3B, HRD1-SEL1L_FL-XTP3B, HRD1-SEL1L-XTP3B (state D1), and HRD1-SEL1L-XTP3B (state D2), respectively.

For structural determination of HRD1-SEL1L_X3-XTP3B, a partial dataset with 1216 micrographs was first applied to motion correction and particle picking, resulting in 888,468 particles. After 2D classification, a total of 221,959 particles were selected and subjected to Ab-Initio Reconstruction with 4 classes. The good class was selected as a good reference to select good particles from the full dataset, containing 3,386,651 particles. After Ab-Initio Reconstruction and Non-uniform Refinement, a 4.5 Å EM map was generated with 453,310 good particles. These good particles were used as seeds for seed-facilitated classification⁶¹ with C1 symmetry, resulting in 780,813 particles. After several runs of Ab-Initio reconstruction, 341,051 particles were eventually selected to build two 3.5 Å EM maps with C1 symmetry.

For the HRD1-SEL1L_FL-XTP3B complex, a total of 2,550,410 particles were selected from 4193 micrographs and subjected to Heterogeneous Refinement, Ab-Initio Reconstruction followed by Non-uniform Refinement, resulting in 320,529 particles with 3D reconstruction at 4.5 Å. These good particles were used as seeds for seed-facilitated classification, resulting in 592,494 particles. After one run of 3D classification, 307,706 particles were selected to yield a 3.3 Å 3D reconstruction.

For the 3D reconstruction of the HRD1-SEL1L-XTP3B (state D1) complex, a total of 3,003,132 particles were selected from 4460 micrographs and subjected to Heterogeneous Refinement, Ab-Initio Reconstruction followed by Non-uniform Refinement, resulting in a 3D reconstruction with 121,514 particles at 4.5 Å. These good particles were used as seeds for seed-facilitated classification, resulting in 607,275 particles. These good particles were subjected to 3D classification, resulting in 177,299 good particles. Another run of seed-facilitated classification was applied, and 279,932 good particles were selected. After one run of Ab-Initio Reconstruction, 187,000 good particles were selected to generate a 3.54 Å EM map. Eventually, the Local refinement was applied to further improve the map quality of the luminal domain of the complex.

For the 3D reconstruction of the HRD1-SEL1L-XTP3B (state D2) complex, a total of 1,495,358 particles were selected from 1905 micrographs and subjected to Heterogeneous Refinement, Ab-Initio Reconstruction followed by Non-uniform Refinement, resulting in a 3D reconstruction with 409,647 particles at 4.5 Å. These good particles were used as seeds for seed-facilitated classification, resulting in 407,481 particles. These good particles were subjected to Ab-Initio Reconstruction followed by Non-uniform Refinement, resulting in a 3.7 Å EM map.

Most data processing procedures were performed with cryoSPARC⁶² unless otherwise indicated. Resolutions were estimated with the gold-standard Fourier shell correlation 0.143 criterion⁶³ with high-resolution noise substitution⁶⁴. The local resolution maps were calculated using “Local Resolution Estimation” in cryoSPARC.

Model building and refinement

The structure of HRD1-SEL1L-XTP3B was built primarily according to the HRD1-SEL1L_FL-XTP3B map at 3.3 Å resolution. AlphaFold2-predicted models⁴⁷ facilitated model building for regions with moderate resolutions. The HRD1-SEL1L_X3-XTP3B map was used to build the TMD region. The resulting HRD1-SEL1L-XTP3B structure was used as an initial model to build the structures of HRD1-SEL1L-XTP3B (state D1) and HRD1-SEL1L-XTP3B (state D2). Manual adjustment was then made in Coot⁶⁵, and all structure refinement was carried out by PHENIX⁶⁶ in real space with secondary structure and geometry restraints. All the structure figures were prepared with PyMol, and all the EM maps were prepared with Chimera⁶⁷.

Statistics and reproducibility

No statistical methods were used to predetermine the sample size. The experiments were not randomized, and the investigators were not blinded to allocation during the experiments and outcome assessment. Each experiment was conducted independently at least three times with similar results.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

The cryo-EM maps have been deposited in the Electron Microscopy Data Bank (EMDB, https://www.ebi.ac.uk/pdbe/emdb/) under accession codes EMD-37166 (HRD1-SEL1L_X3-XTP3B (C1)), EMD-63459 (HRD1-SEL1L_X3-XTP3B (C2)), EMD-37167 (HRD1-SEL1L_FL-XTP3B), EMD-37168 (HRD1-SEL1L-XTP3B (state D1)), and EMD-63996 (HRD1-SEL1L-XTP3B (state D2)). The atomic coordinates have been deposited in the Protein Data Bank (PDB, http://www.rcsb.org) under accession codes 8KES (HRD1-SEL1L_X3-XTP3B (C1)), 9LWU (HRD1-SEL1L_X3-XTP3B (C2)), 8KET (HRD1-SEL1L_FL-XTP3B), 8KEV (HRD1-SEL1L-XTP3B (state D1)), and 9UAV (HRD1-SEL1L-XTP3B (state D2)). Published protein coordinates used in this study: 6VJY, 5V6P, 6VK1, 6VK3, 3AIH. Source data are provided with this paper.

References

Araki, K. & Nagata, K. Protein folding and quality control in the ER. Cold Spring Harb. Perspect. Biol. 3, a007526 (2011).
Article PubMed PubMed Central Google Scholar
Christianson, J. C. & Ye, Y. Cleaning up in the endoplasmic reticulum: ubiquitin in charge. Nat. Struct. Mol. Biol. 21, 325–335 (2014).
Article CAS PubMed PubMed Central Google Scholar
Preston, G. M. & Brodsky, J. L. The evolving role of ubiquitin modification in endoplasmic reticulum-associated degradation. Biochem. J. 474, 445–469 (2017).
Article CAS PubMed Google Scholar
Zattas, D. & Hochstrasser, M. Ubiquitin-dependent protein degradation at the yeast endoplasmic reticulum and nuclear envelope. Crit. Rev. Biochem. Mol. Biol. 50, 1–17 (2015).
Article CAS PubMed Google Scholar
Carvalho, P., Goder, V. & Rapoport, T. A. Distinct ubiquitin-ligase complexes define convergent pathways for the degradation of ER proteins. Cell 126, 361–373 (2006).
Article CAS PubMed Google Scholar
Gardner, R. G. et al. Endoplasmic reticulum degradation requires lumen to cytosol signaling. Transmembrane control of Hrd1p by Hrd3p. J. Cell Biol. 151, 69–82 (2000).
Article CAS PubMed PubMed Central Google Scholar
Gauss, R., Jarosch, E., Sommer, T. & Hirsch, C. A complex of Yos9p and the HRD ligase integrates endoplasmic reticulum quality control into the degradation machinery. Nat. Cell Biol. 8, 849–854 (2006).
Article CAS PubMed Google Scholar
Szathmary, R., Bielmann, R., Nita-Lazar, M., Burda, P. & Jakob, C. A. Yos9 protein is essential for degradation of misfolded glycoproteins and may function as lectin in ERAD. Mol. Cell 19, 765–775 (2005).
Article CAS PubMed Google Scholar
Bhamidipati, A., Denic, V., Quan, E. M. & Weissman, J. S. Exploration of the topological requirements of ERAD identifies Yos9p as a lectin sensor of misfolded glycoproteins in the ER lumen. Mol. Cell 19, 741–751 (2005).
Article CAS PubMed Google Scholar
Kim, W., Spear, E. D. & Ng, D. T. Yos9p detects and targets misfolded glycoproteins for ER-associated degradation. Mol. Cell 19, 753–764 (2005).
Article CAS PubMed Google Scholar
Olzmann, J. A., Kopito, R. R. & Christianson, J. C. The mammalian endoplasmic reticulum-associated degradation system. Cold Spring Harb. Perspect. Biol. 5, https://doi.org/10.1101/cshperspect.a013185 (2013).
Kaneko, M., Ishiguro, M., Niinuma, Y., Uesugi, M. & Nomura, Y. Human HRD1 protects against ER stress-induced apoptosis through ER-associated degradation. FEBS Lett. 532, 147–152 (2002).
Article CAS PubMed Google Scholar
Amano, T. et al. Synoviolin/Hrd1, an E3 ubiquitin ligase, as a novel pathogenic factor for arthropathy. Genes Dev. 17, 2436–2449 (2003).
Article CAS PubMed PubMed Central Google Scholar
Kikkert, M. et al. Human HRD1 is an E3 ubiquitin ligase involved in degradation of proteins from the endoplasmic reticulum. J. Biol. Chem. 279, 3525–3534 (2004).
Article CAS PubMed Google Scholar
Nadav, E. et al. A novel mammalian endoplasmic reticulum ubiquitin ligase homologous to the yeast Hrd1. Biochem. Biophys. Res. Commun. 303, 91–97 (2003).
Article CAS PubMed Google Scholar
Lilley, B. N. & Ploegh, H. L. Multiprotein complexes that link dislocation, ubiquitination, and extraction of misfolded proteins from the endoplasmic reticulum membrane. Proc. Natl Acad. Sci. USA 102, 14296–14301 (2005).
Article CAS PubMed PubMed Central Google Scholar
Christianson, J. C., Shaler, T. A., Tyler, R. E. & Kopito, R. R. OS-9 and GRP94 deliver mutant alpha1-antitrypsin to the Hrd1-SEL1L ubiquitin ligase complex for ERAD. Nat. Cell Biol. 10, 272–282 (2008).
Article CAS PubMed PubMed Central Google Scholar
van der Goot, A. T., Pearce, M. M. P., Leto, D. E., Shaler, T. A. & Kopito, R. R. Redundant and antagonistic roles of XTP3B and OS9 in decoding glycan and non-glycan degrons in ER-associated degradation. Mol. Cell 70, 516–530.e516 (2018).
Article PubMed PubMed Central Google Scholar
Hosokawa, N. et al. Human XTP3-B forms an endoplasmic reticulum quality control scaffold with the HRD1-SEL1L ubiquitin ligase complex and BiP. J. Biol. Chem. 283, 20914–20924 (2008).
Article CAS PubMed PubMed Central Google Scholar
Cruciat, C. M., Hassler, C. & Niehrs, C. The MRH protein Erlectin is a member of the endoplasmic reticulum synexpression group and functions in N-glycan recognition. J. Biol. Chem. 281, 12986–12993 (2006).
Article CAS PubMed Google Scholar
Christianson, J. C. et al. Defining human ERAD networks through an integrative mapping strategy. Nat. Cell Biol. 14, 93–105 (2011).
Article PubMed PubMed Central Google Scholar
Hwang, J. et al. Characterization of protein complexes of the endoplasmic reticulum-associated degradation E3 ubiquitin ligase Hrd1. J. Biol. Chem. 292, 9104–9116 (2017).
Article CAS PubMed PubMed Central Google Scholar
Bhattacharya, A. et al. Hepatic Sel1L-Hrd1 ER-associated degradation (ERAD) manages FGF21 levels and systemic metabolism via CREBH. EMBO J. 37, https://doi.org/10.15252/embj.201899277 (2018).
Liu, L. et al. ER-associated degradation preserves hematopoietic stem cell quiescence and self-renewal by restricting mTOR activity. Blood 136, 2975–2986 (2020).
Article CAS PubMed PubMed Central Google Scholar
Wei, J. et al. ER-associated ubiquitin ligase HRD1 programs liver metabolism by targeting multiple metabolic enzymes. Nat. Commun. 9, 3659 (2018).
Article PubMed PubMed Central Google Scholar
Sun, S. et al. Epithelial Sel1L is required for the maintenance of intestinal homeostasis. Mol. Biol. Cell 27, 483–490 (2016).
Article CAS PubMed PubMed Central Google Scholar
Sun, S. et al. IRE1alpha is an endogenous substrate of endoplasmic-reticulum-associated degradation. Nat. Cell Biol. 17, 1546–1555 (2015).
Article CAS PubMed PubMed Central Google Scholar
Ji, Y. et al. The Sel1L-Hrd1 endoplasmic reticulum-associated degradation complex manages a key checkpoint in B cell development. Cell Rep. 16, 2630–2640 (2016).
Article CAS PubMed PubMed Central Google Scholar
Yang, Y. et al. The endoplasmic reticulum-resident E3 ubiquitin ligase Hrd1 controls a critical checkpoint in B cell development in mice. J. Biol. Chem. 293, 12934–12944 (2018).
Article CAS PubMed PubMed Central Google Scholar
Xu, Y. et al. The ER membrane-anchored ubiquitin ligase Hrd1 is a positive regulator of T-cell immunity. Nat. Commun. 7, 12073 (2016).
Article CAS PubMed PubMed Central Google Scholar
Kong, S. et al. Endoplasmic reticulum-resident E3 ubiquitin ligase Hrd1 controls B-cell immunity through degradation of the death receptor CD95/Fas. Proc. Natl Acad. Sci. USA 113, 10394–10399 (2016).
Article CAS PubMed PubMed Central Google Scholar
Yang, H. et al. Hrd1-mediated BLIMP-1 ubiquitination promotes dendritic cell MHCII expression for CD4 T cell priming during inflammation. J. Exp. Med. 211, 2467–2479 (2014).
Article CAS PubMed PubMed Central Google Scholar
Kim, G. H. et al. Hypothalamic ER-associated degradation regulates POMC maturation, feeding, and age-associated obesity. J. Clin. Invest. 128, 1125–1140 (2018).
Article PubMed PubMed Central Google Scholar
Shi, G. et al. ER-associated degradation is required for vasopressin prohormone processing and systemic water homeostasis. J. Clin. Invest. 127, 3897–3912 (2017).
Article PubMed PubMed Central Google Scholar
Shrestha, N. et al. Sel1L-Hrd1 ER-associated degradation maintains β cell identity via TGF-β signaling. J. Clin. Invest. 130, 3499–3510 (2020).
Article CAS PubMed PubMed Central Google Scholar
Yoshida, S. et al. Endoplasmic reticulum-associated degradation is required for nephrin maturation and kidney glomerular filtration function. J. Clin. Invest. 131, https://doi.org/10.1172/JCI143988 (2021).
Wu, T. et al. Hrd1 suppresses Nrf2-mediated cellular protection during liver cirrhosis. Genes Dev. 28, 708–722 (2014).
Article CAS PubMed PubMed Central Google Scholar
Wu, T. et al. HRD1, an important player in pancreatic β-cell failure and therapeutic target for type 2 diabetic mice. Diabetes 69, 940–953 (2020).
Article CAS PubMed Google Scholar
Lin, L. L. et al. SEL1L-HRD1 interaction is prerequisite for the formation of a functional HRD1 ERAD complex. bioRxiv https://doi.org/10.1101/2023.04.13.536796 (2023).
Article PubMed PubMed Central Google Scholar
Weis, D. et al. Biallelic Cys141Tyr variant of SEL1L is associated with neurodevelopmental disorders, agammaglobulinemia, and premature death. J. Clin. Invest. 134, https://doi.org/10.1172/JCI170882 (2024).
Schoebel, S. et al. Cryo-EM structure of the protein-conducting ERAD channel Hrd1 in complex with Hrd3. Nature 548, 352–355 (2017).
Article CAS PubMed PubMed Central Google Scholar
Wu, X. et al. Structural basis of ER-associated protein degradation mediated by the Hrd1 ubiquitin ligase complex. Science 368, https://doi.org/10.1126/science.aaz2449 (2020).
Rao, B. et al. The cryo-EM structure of an ERAD protein channel formed by tetrameric human Derlin-1. Sci. Adv. 7, https://doi.org/10.1126/sciadv.abe8591 (2021).
Rao, B. et al. The cryo-EM structure of the human ERAD retrotranslocation complex. Sci. Adv. 9, eadi5656 (2023).
Article CAS PubMed PubMed Central Google Scholar
Sato, B. K. & Hampton, R. Y. Yeast Derlin Dfm1 interacts with Cdc48 and functions in ER homeostasis. Yeast 23, 1053–1064 (2006).
Article CAS PubMed Google Scholar
Tyler, R. E. et al. Unassembled CD147 is an endogenous endoplasmic reticulum-associated degradation substrate. Mol. Biol. Cell 23, 4668–4678 (2012).
Article CAS PubMed PubMed Central Google Scholar
Tunyasuvunakool, K. et al. Highly accurate protein structure prediction for the human proteome. Nature 596, 590–596 (2021).
Article CAS PubMed PubMed Central Google Scholar
Huang, C. H., Hsiao, H. T., Chu, Y. R., Ye, Y. & Chen, X. Derlin2 protein facilitates HRD1-mediated retro-translocation of sonic hedgehog at the endoplasmic reticulum. J. Biol. Chem. 288, 25330–25339 (2013).
Article CAS PubMed PubMed Central Google Scholar
Bernasconi, R., Galli, C., Calanca, V., Nakajima, T. & Molinari, M. Stringent requirement for HRD1, SEL1L, and OS-9/XTP3-B for disposal of ERAD-LS substrates. J. Cell Biol. 188, 223–235 (2010).
Article CAS PubMed PubMed Central Google Scholar
Bernasconi, R., Pertel, T., Luban, J. & Molinari, M. A dual task for the Xbp1-responsive OS-9 variants in the mammalian endoplasmic reticulum: inhibiting secretion of misfolded protein conformers and enhancing their disposal. J. Biol. Chem. 283, 16446–16454 (2008).
Article CAS PubMed PubMed Central Google Scholar
Satoh, T. et al. Structural basis for oligosaccharide recognition of misfolded glycoproteins by OS-9 in ER-associated degradation. Mol. Cell 40, 905–916 (2010).
Article CAS PubMed Google Scholar
Quan, E. M. et al. Defining the glycan destruction signal for endoplasmic reticulum-associated degradation. Mol. Cell 32, 870–877 (2008).
Article CAS PubMed PubMed Central Google Scholar
Hosokawa, N., Kamiya, Y., Kamiya, D., Kato, K. & Nagata, K. Human OS-9, a lectin required for glycoprotein endoplasmic reticulum-associated degradation, recognizes mannose-trimmed N-glycans. J. Biol. Chem. 284, 17061–17068 (2009).
Article CAS PubMed PubMed Central Google Scholar
Mikami, K. et al. The sugar-binding ability of human OS-9 and its involvement in ER-associated degradation. Glycobiology 20, 310–321 (2010).
Article CAS PubMed Google Scholar
Eura, Y., Miyata, T. & Kokame, K. Derlin-3 is required for changes in ERAD complex formation under ER stress. Int. J. Mol. Sci. 21, https://doi.org/10.3390/ijms21176146 (2020).
Lin, L. L. et al. SEL1L-HRD1 interaction is required to form a functional HRD1 ERAD complex. Nat. Commun. 15, 1440 (2024).
Article CAS PubMed PubMed Central Google Scholar
Leto, D. E. et al. Genome-wide CRISPR analysis identifies substrate-specific conjugation modules in ER-associated degradation. Mol. Cell 73, 377–389.e311 (2019).
Article CAS PubMed Google Scholar
Zheng, S. Q. et al. MotionCor2: anisotropic correction of beam-induced motion for improved cryo-electron microscopy. Nat. Methods 14, 331–332 (2017).
Article CAS PubMed PubMed Central Google Scholar
Grant, T. & Grigorieff, N. Measuring the optimal exposure for single particle cryo-EM using a 2.6 A reconstruction of rotavirus VP6. Elife 4, e06980 (2015).
Article PubMed PubMed Central Google Scholar
Rohou, A. & Grigorieff, N. CTFFIND4: Fast and accurate defocus estimation from electron micrographs. J. Struct. Biol. 192, 216–221 (2015).
Article PubMed PubMed Central Google Scholar
Wang, N. et al. Structural basis of human monocarboxylate transporter 1 inhibition by anti-cancer drug candidates. Cell 184, 370–383.e313 (2021).
Article CAS PubMed Google Scholar
Punjani, A., Rubinstein, J. L., Fleet, D. J. & Brubaker, M. A. cryoSPARC: algorithms for rapid unsupervised cryo-EM structure determination. Nat. Methods 14, 290–296 (2017).
Article CAS PubMed Google Scholar
Rosenthal, P. B. & Henderson, R. Optimal determination of particle orientation, absolute hand, and contrast loss in single-particle electron cryomicroscopy. J. Mol. Biol. 333, 721–745 (2003).
Article CAS PubMed Google Scholar
Chen, S. et al. High-resolution noise substitution to measure overfitting and validate resolution in 3D structure determination by single particle electron cryomicroscopy. Ultramicroscopy 135, 24–35 (2013).
Article CAS PubMed PubMed Central Google Scholar
Emsley, P., Lohkamp, B., Scott, W. G. & Cowtan, K. Features and development of Coot. Acta Crystallogr. D. Biol. Crystallogr. 66, 486–501 (2010).
Article CAS PubMed PubMed Central Google Scholar
Adams, P. D. et al. PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallogr. D. Biol. Crystallogr. 66, 213–221 (2010).
Article CAS PubMed PubMed Central Google Scholar
Pettersen, E. F. et al. UCSF Chimera-a visualization system for exploratory research and analysis. J. Comput. Chem. 25, 1605–1612 (2004).
Article CAS PubMed Google Scholar

Download references

Acknowledgements

We thank the Cryo-EM Center of the University of Science and Technology of China (USTC) for the EM facility support. We are grateful to Dr. Yong-Xiang Gao and all the other staff members at the Cryo-EM Center for their technical support on cryo-EM data collection. This work was supported by the National Key R&D Program of China (2024YFA1307900), the National Natural Science Foundation of China (32271241), the Fundamental Research Funds for the Central Universities (WK9100000031), “the Talent Fund Project of Biomedical Sciences and Health Laboratory of Anhui Province, University of Science and Technology of China” (BJ9100000003), and start-up funding from the University of Science and Technology of China (KY9100000034 and KJ2070000082). L.G. was supported by “USTC Research Funds of the Double First-Class Initiative” (YD9110002120).

Author information

These authors contributed equally: Liling Guo, Guoyun Liu, Jingjing He.

Authors and Affiliations

Department of General Medicine, The First Affiliated Hospital of USTC, MOE Key Laboratory for Membraneless Organelles and Cellular Dynamics, Hefei National Research Center for Interdisciplinary Sciences at the Microscale, Division of Life Sciences and Medicine, University of Science and Technology of China, Hefei, China
Liling Guo
Department of Cardiology, The First Affiliated Hospital of USTC, MOE Key Laboratory for Membraneless Organelles and Cellular Dynamics, Hefei National Research Center for Interdisciplinary Sciences at the Microscale, Division of Life Sciences and Medicine, University of Science and Technology of China, Hefei, China
Liling Guo, Guoyun Liu, Jingjing He, Xiaoxiao Jia, Yonglin He, Zhenhua Wang & Hongwu Qian

Authors

Liling Guo
View author publications
Search author on:PubMed Google Scholar
Guoyun Liu
View author publications
Search author on:PubMed Google Scholar
Jingjing He
View author publications
Search author on:PubMed Google Scholar
Xiaoxiao Jia
View author publications
Search author on:PubMed Google Scholar
Yonglin He
View author publications
Search author on:PubMed Google Scholar
Zhenhua Wang
View author publications
Search author on:PubMed Google Scholar
Hongwu Qian
View author publications
Search author on:PubMed Google Scholar

Contributions

H.Q. conceived the project and designed the experiments. L.G., G.L., and X.J. performed cloning and protein purification. J.H. prepared the cryo-EM samples and collected the data. H.Q. determined the structures. G.L. and L.G. performed the ERAD assays. J.H. and L.G. performed the cell-based pull-down assay. All the authors contributed to the data analysis and preparation of the manuscript. H.Q., Z.W., and Y.H. prepared the figures, and H.Q. wrote the manuscript.

Corresponding author

Correspondence to Hongwu Qian.

Ethics declarations

Competing interests

The authors declare no competing interests.

Peer review

Peer review information

Nature Communications thanks the anonymous reviewer(s) for their contribution to the peer review of this work. A peer review file is available.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Supplementary Information

Description of Additional Supplementary Files

Supplementary Movie 1

Reporting Summary

Peer Review file

Source data

Source Data

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

About this article

Cite this article

Guo, L., Liu, G., He, J. et al. Structural insights into the human HRD1 ubiquitin ligase complex. Nat Commun 16, 6007 (2025). https://doi.org/10.1038/s41467-025-61143-z

Download citation

Received: 23 September 2024
Accepted: 12 June 2025
Published: 01 July 2025
Version of record: 01 July 2025
DOI: https://doi.org/10.1038/s41467-025-61143-z