Introduction

As an essential member of the soil microflora, soil fungi (along with other microorganisms) participate in the material cycle and energy flow in ecosystems. Fungi play an especially vital role in organic decomposition, carbon and nitrogen storage, biogeochemical cycles, soil stabilization, and plant parasitism1,2,3,4,5, and fungal diversity has been recognized as a critical indicator of soil health6,7. Research on the soil ecological environment, especially on the diversity of fungi in some important ecological regions, has recently gained much attention. More specifically, the role of soil microorganisms in promoting the regulatory mechanism of plant communities has become increasingly recognized. Thus, the microbial diversity on the surface and subsurface has remained a significant theme on recent ecological research8. For instance, in China, fungal flora and soil diversity have been reported in the Changbai Mountains, three nature reserves in Jiuzhaigou County, and Mount Gongga9,10.

The genus Trichoderma, which includes more than 200 species in various geographical regions and climatic zones around the world, a number that is regularly increasing11,12,13, is the most common fungi in soil and rotting wood14,15. Trichoderma have a fine metabolic regulation that is able to respond to environmental changes and to nutrient and oxygen limitations. They therefore produce a range of enzymes to degrade homopolysaccharides and heteropolysaccharides, which are important carbon sink ecosystem. Some species of Trichoderma have a powerful phosphate-solubilizing ability, whereas other species act as industrial enzymes for the preparation of cellulose, hemicellulase, xylanase, chitinase, protease, and antibiotics in agricultural production16,17,18,19,20,21,22. In addition, the genus has been confirmed to be associated with the ability to control plant pathogens, promote plant growth, stimulate plant immunity and remediate soil contaminants23,24,25,26.

Hypocrea and Trichoderma were once treated as two separate genera, although studies by the Tulasne brothers indicated that Hypocrea is a sexual morph (teleomorph) of Trichoderma. Combining Hypocrea and Trichoderma, Doi et al.27,28,29,30,31,32,33,34,35,36,37,38 summarized previously reported species and revised nearly 50 new species of the genus based primarily on morphological characteristics. However, distinguishing Trichoderma species using traditional morphological methods is difficult and inaccurate39. Due to the overlap between intraspecific and interspecific sequence differences in the nuclear rDNA ITS region, it is not suitable for multiple gene identification. Multiple molecular techniques have been applied for identifying Trichoderma; for example the genes encoding RNA polymerase II subunit B (rpb2), transcription elongation factor 1 alpha (tef1) and ATP citrate lyase (acl1) have commonly been used either individually or in combination40,41,42,43,44,45,46,47. A combination of phylogenetic analyses of multiple genes and morphological characteristics has been widely used to study fungal diversity, and nearly a hundred new species of this genus have been recorded in various ecological zones worldwide40,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60.

Wetlands represent a significant land resource and a source of natural resources with various functions, such as forest, cultivated land and sea. These areas are rich in biological diversity in terms of both the ecological landscape and the human living environment. The Zoige alpine wetland is one of the most important wetlands in China because of its complex natural environment, abundant ecological resources, and unique climatic conditions. Although reports have addressed the local soil active organic carbon, vegetation, animal community, gas flux, functional bacteria and microorganism methanogens61,62,63,64,65,66,67,68, the ecology of soil fungi is poorly understood, and recent comprehensive reports on Trichoderma are not available for any region, including the Zoige alpine wetland ecological region in China. Only Feng et al.69 have analyzed the fungal community structure in the soil of this region via a combination of BIOLOG analysis and traditional cultural methods. Because morphological and molecular tools are ideal for assessments of the species diversity in all geographical regions, the work described here was designed to investigate the species diversity of the genus Trichoderma in the unique ecological environment of the Zoige alpine wetland, with an emphasis on four major soil types (peat soil, meadow soil, subalpine meadow soil, and aeolian sandy soil). Our results may be used as a reference for a greater understanding of soil microorganisms in various ecological regions, ecological rehabilitation and reconstruction, and microbial resources.

Results

Trichoderma species collection

Eighty strains were obtained from 100 soil samples collected from Zoige alpine wetland ecological regions in China. Details of the strains isolated from soil samples are given in Table 1. All strains were subsequently used for morphological identification, while fifty-seven were used for phylogenetic analysis.

Table 1 Details of 80 Trichoderma isolates from the Zoige alpine wetland in this study.

Phylogenetic analysis

The ITS region used preliminarily as a species identification criterion was applied to TrichOKey at www.ISTH.info70. However, the ITS region has a low number of variable sites and long insertions in certain species; thus, it is unsuitable for a phylogenetic reconstruction of this group41. Our study successfully amplified most fragments of the genes tef1, rpb2, and acl1. We also designed a pair of new primers based on the full-length tef1 gene, 5′-GAGAAGTTCGAGAAGGTGAGC-3′ and 5′-ATGTCACGGACGGCGAAAC-3′, with which a 1.4-kb fragment was amplified for most isolates.

All samples analyzed in our study were divided into 4 primary clades based on the gpd gene region, including 49 strains from the T. harzianum complex, 3 T. rossicum strains, 1 T. polysporum strain and one unknown species (4 Trichoderma sp. strains) (Fig. 1). Maximum parsimony analysis was conducted among 101 strains, with Protocrea farinosa (CPK 2472) and P. pallida (CBS 299.78) used as outgroup (Table 2). The dataset for the rpb2, tef1 and acl1 genes contained 3403 characteristics, among which 1152 were parsimony-informative, 988 were variable and parsimony-uninformative, and 1263 were constant. The most parsimonious trees are shown in Fig. 2 (tree length = 5054, consistency index = 0.6005, homoplasy index = 0.3995, retention index = 0.8105, rescaled consistency index = 0.4867).

Figure 1
Figure 1The alternative text for this image may have been generated using AI.
Full size image

Neighbor-joining tree based on partial gpd gene sequences from 57 Trichoderma isolates. Parsimony bootstrap values of more than 50% are shown at nodes.

Table 2 Trichoderma strain included in the multi-gene sequence analysis, with details of clade, strain number, location, and GenBank accessions of the sequences generated.
Figure 2
Figure 2The alternative text for this image may have been generated using AI.
Full size image

Maximum parsimony tree of Trichoderma species inferred from the combined rpb2, tef1 and acl1 partial sequences. Maximum parsimony bootstrap values above 50% are shown at nodes. The tree was rooted with Protocrea farinose and P. pallida Isolates from this study are shown in red (new species in bold).

The phylogram showed that 57 stains belonged to the following four clades: Harzianum, Polysporum, Stromaticum, and Longibrachiatum. The strains of the first three clades with neighboring named species were well supported by bootstrap values greater than 90%. The Harzianum clade contained T. alni, T. atrobrunneum, T. harzianum and T. pyramidale of the Trichoderma species complex. The Polysporum clade contained only T. polysporum, and the Stromaticum clade contained T. rossicum. The Longibrachiatum clade contained four strains of Trichoderma sp., T25, T43, T44 and T48, which were separated from any other known taxa of this clade showed a low bootstrap value (MPBP = 62%) with T. citrinoviride and T. saturnisporum. We thus regarded it as a new species and named it Trichoderma zoigense, as described in the next section.

Growth rates

As shown in Fig. 3, the genus Trichoderma from Zoige alpine wetland ecological regions was able to grow in a range from 15 to 35 °C, and the suitable growth temperature for most species ranged from 20 to 30 °C. All seven species identified had normal viability at relatively low temperature (15 °C), and they rarely grew well over 35 °C except for T. zoigense. For T. atrobrunneum, T. harzianum and T. pyramidale, the optimum growth temperature on CMD was 25 to 30 °C. T. alni and T. rossicum preferred a cool growth environment, with an optimum temperature of 25 °C, whereas T. zoigense was more partial to a hot environment, with an optimum temperature of 30 °C, and it even grew well up to 35 °C. T. polysporum was the only slow-growing species that grew with less than 6.0 mm/day between 15 and 30 °C and did not survive at 35 °C. The above results showed that all species had different growth rates but were not completely differentiated from each other on CMD. These species were roughly divided into four groups based on their optimum growth temperature.

Figure 3
Figure 3The alternative text for this image may have been generated using AI.
Full size image

Growth rates of 7 species of Trichoderma on CMD given as mm per day at five temperatures. The values were the means of 3–5 experiments, with 1–3 representative isolates per species.

Relationship with ecological factors

Our results revealed a substantial disparity in the number and distribution of Trichoderma species among Zoige alpine wetland ecological regions (Tables 3, 4). Table 3 showed that T. harzianum was found in all four soil types, but most isolates of this species were obtained from peat soil. T. rossicum, T. alni and T. zoigense were also present in meadow soil and subalpine meadow soil, whereas T. atrobrunneum was found in aeolian sandy soil and peat soil. T. polysporum was found only in peat soil.

Table 3 Isolation frequency of Trichoderma species in different soil types (%).
Table 4 Isolation frequency of Trichoderma species in different soil layers (%) species.

In regard to the different soil layers shown in Table 4, T. harzianum was widely distributed in the five soil layers at depths of 0–100 cm. T. rossicum, T. alni and T. zoigense were isolated mainly from the soil layers at depths of 0–50 cm. Both T. atrobrunneum and T. pyramidale were isolated from depths of 0–10 cm, and T. polysporum was found only in the soil layers at depths of 50–100 cm.

Regarding isolation frequency, T. harzianum was the most common of the seven species with a 23% isolation frequency, and it was therefore the dominant species in the zone, while the rare species T. polysporum and T. pyramidale had the lowest isolation frequencies at 1%.

Taxonomy

New species

Trichoderma zoigense G.S. Gong & G.T. Tang, sp. nov. (Fig. 4).

Figure 4
Figure 4The alternative text for this image may have been generated using AI.
Full size image

Cultures and asexual morph of Trichoderma zoigense. (a–d). Cultures at 20 °C [(a) on CMD, 7 days; (b) on MEA, 4 days; (c) on PDA, 4 days; and (d) on SNA, 7 days]. (e) Conidiation tuft (CMD, 4 days). (f–k) Conidiophores and phialides (CMD, 5–7 days). (l) Chlamydospores (PDA, 8 days). (m) Conidia (CMD, 5 days). Scale bars: (e) = 2 mm; (f–m) = 10 μm.

MycoBank: MB 82114.

Typification: CHINA. SICHUAN PROVINCE: Zoige Alpine Wetland, on soil, 29 June 2013, G.S. Gong T44 (holotype CGMCC3.20145). GenBank: ITS = KX632531; TEF = KX632588; RPB2 = KX632645; ACL1 = KX632702; GPD = KX632759.

Etymology: zoigense (Latin), the specific epithet about the place where the type was found.

Description: Cultures and anamorph: optimal growth at 25 °C on all four media. On CMD after 72 h, growth is 25–28 mm at 20 °C and 28–31 mm at 25 °C. Colony is dense and has a wavy to crenate margin. Surface becomes distinctly zonate and white to grayish-green but celadon to atrovirens later, and it is granular in the center and distinctly radially downy outside and shows whitish surface hyphae and reverse-diffusing croci to pale brown pigment (Fig. 4a). Aerial hyphae are numerous to punctate and long, forming radial strands, with white mycelial patches appearing in aged cultures (Fig. 4e). Autolytic excretions are rare, with no coilings observed. Conidiation was noted after 3–4 d at 25 °C, a yellow or greenish color appears after 7 days, conidiation is effuse, and in intense tufts, erect conidiophores occur around the plug and on aerial hyphae. They are mainly concentrated along the colony center, show a white color that turns green, and then finally degenerate, with conidia often adhering in chains. Conidiophores are short and simple with asymmetric branches. Branches produce phialides directly. Phialides are generally solitary along main axes and side branches and sometimes paired in the terminal position of the main axes, sometimes in whorls of 2–3. Phialides are 4.5–10.5 × 2–5 μm (\(\overline{x }\) = 7.5 ± 1.5 × 3 ± 0.5, n = 50) and 1.5–2.5 μm (\(\overline{x }\) = 2 ± 0.2) wide at the base, lageniform or ampulliform, mostly uncinate or slightly curved, less straight, and often distinctly widened in the middle (Fig. 4f–k). Conidia are 3–4.5 × 2.3–4 μm (\(\overline{x }\) = 3.5 ± 0.3 × 3 ± 0.3, n = 50) and initially hyaline, and they turn green and are oblong or ellipsoidal, almost with constricted sides, and smooth, eguttulate or with minute guttules, with indistinct scars (Fig. 4m).

On PDA, after 72 h, growth is 35–41 mm at 20 °C and 50–55 mm at 25 °C; and mycelium covers the plate after 5 days at 25 °C. Colonies are dense with wavy to crenate margins; and mycelia are conspicuously differentiated in width of the primary and secondary hyphae. Surface becomes distinctly zonate, yellowish-green to prasinous in color and celadon to atrovirens later, and it is farinose to granular in the center, distinctly radially downy outside, with whitish of surface hyphae and reverse-diffusing brilliant yellow to fruit-green pigment (Fig. 4c). Aerial hyphae are numerous, long and ascend several millimeters, forming radial strands, with white mycelial patches appearing in aged cultures. Autolytic excretions are rare; and no coilings are observed. Odor is indistinct or fragrant. Chlamydospores examined after 7 days at 4.5–9 × 4.5–7.5 μm (\(\overline{x }\) = 6 ± 1.1 × 6 ± 0.7, n = 50), and they are terminal, intercalary, globose or ellipsoidal, and smooth (Fig. 4l). Conidiation is noted after 3–4 days and yellow or greenish after 7 days. Conidiophores are short and simple with asymmetric branches; conidia are greenish, ellipsoidal, and smooth.

On SNA, after 72 h, growth is 13–15 mm at 20 °C and, 16–21 mm at 25 °C; and mycelium covers the plate after 12–13 days at 25 °C. Colony is similar to that on CMD, with a little wave margin, although mycelia are looser and slower on the agar surface. Aerial hyphae are relatively inconspicuous and long along the colony margin. Autolytic activity and coiling are absent or inconspicuous. No diffusing pigment or distinct odor are produced (Fig. 4d). Conidiation was noted after 3–4 days at 25 °C, and many amorphous, loose white or aqua cottony tufts occur, mostly median from the plug outwards, and they are confluent to masses up and white but then turn green. After 4–5 days, conidiation becomes dense within the tufts, which are loose at their white margins with long, straight, or slightly sinuous sterile ends in the periphery. Tufts consisting of a loose reticulum with branches often at right angles, give rise to several main axes. Main axes are regular and tree-like, with few or many paired or unpaired side branches. Branches are flexuous, and phialides are solitary along the main axes and side branches, and they are sometimes paired in the terminal position of the main axes, sometimes in whorls of 2–3 that are often cruciform or in pseudo-whorls up to 4. Phialides and conidia are similar to that on CMD.

New records for China

Trichoderma atrobrunneum F. B. Rocha et al., Mycologia 107: 571, 2015 (Fig. 5).

Figure 5
Figure 5The alternative text for this image may have been generated using AI.
Full size image

Cultures and asexual morph of Trichoderma atrobrunneum. (a–d) Cultures at 25 °C [(a) on CMD, 7 days; (b) on MEA, 4 days; (c) on PDA, 15 days; and (d) on SNA, 7 days]. (e) Conidiation tuft (SNA, 7 days). (f–i,k,l) Conidiophores and phialides (CMD, 5–7 days). (j) Conidia (CMD, 6 days). (m) Chlamydospores (PDA, 7 days). Scale bars: (e) = 2 mm; (f–m) = 10 μm.

Specimen examined: CHINA. SICHUAN PROVINCE: Zoige Alpine Wetland, on soil, 29 June 2013, G.S. Gong T42 (holotype CGMCC.20167). GenBank: ITS = KX632514; TEF = KX632571; RPB2 = KX632628; ACL1 = KX632685; GPD = KX632742.

Description: Cultures and anamorph: optimal growth at 25 °C on all media. On CMD, after 72 h, growth is 35–37 mm at 20 °C and 46–53 mm at 25 °C; mycelium covers the plate after 5–6 days at 25 °C. Colonies show distinct zonation. Mycelia are loose and thin; hyphae are narrow, sinuous and often form strands on the margin (Fig. 5a). Aerial hyphae are slight, forming a thin white to green downy fluffy or floccose mat. The light brown or brown pigment is observed, with no distinct odor noted. Conidiophores are pyramidal, often with opposing and somewhat widely spaced branches, with the main axis and each branch terminating in a cruciate, sometimes verticillate, whorl of up to four phialides. Phialides are ampulliform to lageniform and 4.9–7.6 × 2.2–3.0 μm (\(\overline{x }\) = 6 ± 0.7 × 2.5 ± 0.2, n = 50) and 1.5–2.5 μm (\(\overline{x }\) = 1.5 ± 0.3) wide at the base (Fig. 5f–i,k,l). Conidia are 2.5–4 × 2.5–3.5 μm (\(\overline{x }\) = 3 ± 0.3 × 3 ± 0.2, n = 50), yellow to green, smooth, and circular to ellipsoidal (Fig. 5j).

On PDA, after 72 h, growth is 41–43 mm at 20 °C and 50–55 mm at 25 °C; and mycelium covers the plate after 5–6 days at 25 °C. Colonies show indistinct zonation. Mycelia are dense, opaque, and thick; hyphae are wide, sinuous and often form strands on the margin (Fig. 5c). Margin is thick and defined. Aerial hyphae are abundant and form a thick green downy mat. Conidiation forms abundantly within 4 days in broad concentric rings. Chlamydospores examined after 7 days are 5–9 × 5.5–8.5 μm (\(\overline{x }\) = 6.5 ± 0.9 × 6.5 ± 0.9, n = 30), globose when terminal, smooth, and intercalary (Fig. 5m).

On SNA, after 72 h, growth is 33–35 mm at 20 °C and 38–40 mm at 25 °C; and mycelium covers the plate after 7–8 days at 25 °C. Colonies show distinct zonation. Mycelia are thin and yellow to green; hyphae are wide and sinuous, with indistinct strands on the margin (Fig. 5d). Margin is thin and ill-defined. Aerial hyphae are slight, forming a thin green downy fluff appearing in the colony (Fig. 5e). Diffusing pigment was observed in a ring, and no distinct odor was noted. Conidiation is similar to CMD.

Accepted species previously reported in China

Trichoderma alni Jaklitsch, Mycologia 100: 799. 2008 (Fig. 6).

Figure 6
Figure 6The alternative text for this image may have been generated using AI.
Full size image

Cultures and asexual morph of Trichoderma alni. (ad). Cultures after 7 days at 25 °C [(a) on CMD; (b) on MEA; (c) on PDA; and (d) on SNA]. € Coilings of aerial hyphae (PDA, 6 days). (fj,l). Conidiophores and phialides (CMD, 5–7 days). (k) Conidiation tuft (PDA, 7 days). (m) Conidia (CMD, 6 days). (n,o) Chlamydospores (PDA, 7 days). Scale bars: (ej,lo) = 10 μm; (k) = 2 mm.

Description: Cultures and anamorph: Optimum growth at 25 °C on all media; no growth at 35 °C. On CMD, after 72 h, growth of 34–36 mm at 20 °C and 50–51 mm at 25 °C; and mycelium covers the plate after 5–6 days at 25 °C. Colonies show distinct zonation. Mycelia are loose and thin; hyphae are narrow and sinuous and often form strands on the margin (Fig. 6a). Aerial hyphae are slight and form a thin white to green downy, fluffy or floccose mat. No diffusing pigment or distinct odor is noted. Conidiophores are hyaline and thick, with side branches on several levels at the base of the elongations that are mostly paired and in right angles with phialides in whorls of 3–5. Phialides are 5.5–11.5 × 2–3.5 μm (\(\overline{x }\) = 8 ± 1.4 × 2.5 ± 0.4, n = 50) and 1.5–2.5 μm (\(\overline{x }\) = 2 ± 0.4) wide at the base, often short and wide, and ampulliform (Fig. 6f–j,l). Conidia are 3–4 × 2.5–3.5 μm (\(\overline{x }\) = 3.5 ± 0.2 × 3 ± 0.2, n = 50), dark green, smooth, and ellipsoidal (Fig. 6m).

On PDA, after 72 h, growth is 33–35 mm at 20 °C and 41–43 mm at 25 °C; and mycelium covers the plate after 6–7 days at 25 °C. Colonies show indistinct zonation. Mycelia are dense, opaque, and thick; hyphae are wide, sinuous and often form strands on the margin (Fig. 6c). Margin is thin and ill defined. Aerial hyphae are slight, coiled (Fig. 6e), forming a thin white to green downy, fluffy or floccose mat (Fig. 6k). Chlamydospores examined after 7 days are 6–9.5 × 5–8 μm (\(\overline{x }\) = 7.5 ± 0.9 × 7 ± 0.9, n = 30), globose to oval when terminal, and smooth, and few are intercalary (Fig. 6n,o).

On SNA, after 72 h, growth is 18–19 mm at 20 °C and 28–32 mm at 25 °C; and mycelium covers the plate after 6–7 days at 25 °C. Colonies show distinct zonation. Mycelia are thin and yellow to green; hyphae are wide and sinuous and show indistinct strands on the margin (Fig. 6d). Margin is thin and ill-defined. Aerial hyphae are slight and form a thin white downy, fluffy, or floccose mat appearing in distal parts of the colony. No diffusing pigment or distinct odor was noted. Conidiation is similar to CMD.

Trichoderma harzianum Rifai, Mycol. Pap. 116: 38, 1969 (Fig. 7).

Figure 7
Figure 7The alternative text for this image may have been generated using AI.
Full size image

Cultures and asexual morph of Trichoderma harzianum. (a–d) Cultures after 7 days at 20 °C [(a) on CMD; (b) on MEA; (c) on PDA; and (d) on SNA]. (e) Conidiation tuft (CMD, 7 days). (f–j) Conidiophores and phialides (CMD, 5–7 days). (k) Conidia (CMD, 5 days). (l,m) Chlamydospores (PDA, 7 days). Scale bars: (e) = 2 mm; (f–m) = 10 μm.

Description: Cultures and anamorph: optimal growth at 25 °C on all media. On CMD, after 72 h, growth is 34–38 mm at 20 °C and 46–53 mm at 25 °C; mycelium covers the plate after 5–6 days at 25 °C. Colonies show distinct zonation. Mycelia are loose and thin; hyphae are narrow, sinuous, and often form strands on the margin (Fig. 7a). Aerial hyphae are abundant and radiating and form thick green downy, fluffy, or floccose mats (Fig. 7e). No diffusing pigment, but fragrant odor noted. Conidiophores are pyramidal with opposing branches, with each branch terminating in a cruciate whorl of up to four or five phialides. Phialides are frequently solitary or in a whorl of three or four. Phialides are ampulliform to lageniform and often constricted below the tip to form a narrow neck of 4.5–8 × 2–3.5 μm (\(\overline{x }\) = 6 ± 0.8 × 2.5 ± 0.3, n = 50) and 1–2.5 μm (\(\overline{x }\) = 2 ± 0.3) wide at the base (Fig. 7f–j). Conidia are subglobose to ovoid, 3–4.5 × 2.5–3.3 μm (\(\overline{x }\) = 3.5 ± 0.3 × 3 ± 0.2, n = 50), laurel-green to bright green, smooth, and ellipsoidal (Fig. 7k).

On PDA, after 72 h, growth is 41–43 mm at 20 °C and 50–55 mm at 25 °C; and mycelium covers the plate after 5–6 days at 25 °C. Colonies show distinct zonation. Mycelia are dense, opaque, and thick; hyphae are wide and sinuous and often form strands on the margin (Fig. 7c). Margin is thick and ill defined. Aerial hyphae are abundant and radiating and form thick green downy, fluffy or floccose mats. Chlamydospores examined after 7 days are 5.5–9 × 5.5–9.0 μm (\(\overline{\mathrm{x} }\) = 7 ± 0.8 × 7 ± 0.8, n = 30), globose to oval when terminal and smooth, showing an almost unobserved intercalary (Fig. 7l,m).

On SNA, after 72 h, growth is 33–35 mm at 20 °C and 38–40 mm at 25 °C; and mycelium covers the plate after 7–8 days at 25 °C. Colonies show distinct zonation. Mycelia are thin and green; hyphae are narrow and sinuous and show indistinct strands on the margin (Fig. 7d). Margin is thin and ill defined. Aerial hyphae are slight and form a thick downy, fluffy, or floccose mat appearing in the colony. No diffusing pigment or distinct fragrant odor was noted. Conidiation was similar to CMD.

Trichoderma polysporum Rifai, Mycol. Pap. 116: 18, 1969 (Fig. 8).

Figure 8
Figure 8The alternative text for this image may have been generated using AI.
Full size image

Cultures and asexual morph of Trichoderma polysporum. (a–d) Cultures at 20 °C [(a) on CMD, 7 days; (b) on MEA, 15 days; (c) on PDA, 15 days; and (d) on SNA, 15 days]. (i) Conidiation tuft (PDA, 15 days). (eh,j) Conidiophores and phialides (CMD, 5–7 days). (k) Chlamydospores (CMD, 7 days). (l) Conidia (PDA, 6 days). Scale bars: (i) = 2 mm; (e–h,j) = 10 μm.

Description: Cultures and anamorph: optimal growth at 20 °C on all media, no growth at 35 °C. On CMD, after 72 h, growth is 14–16 mm at 20 °C and 9–12 mm at 25 °C; and mycelium covers the plate after 9–10 days at 20 °C. A colony is hyaline, thin and loose, with little mycelium on the agar surface, and it is indistinctly zonate but becomes zonate by conidiation in white tufts after 4–5 d and grass green to green after 6 days (Fig. 8a). Aerial hyphae are long and dense and forming little greenish aggregates that are granular to pulvinate. No pigment or odor. Conidiation noted after 4–5 days, and it is white to greenish, with sterile smooth to rough helical elongations in the distal zones from pustules. Conidiophores are hyaline and thick with side branches on several levels at the base of the elongations that are mostly paired and at right angles with phialides in whorls of 2–5. Phialides are 5–10.5 × 2.5–4 μm (\(\overline{x }\) = 7 ± 1.9 × 3.5 ± 0.4, n = 50) and 2–4 μm (\(\overline{x }\) = 3 ± 0.5) wide at the base, often short and wide and ampulliform (Fig. 8e–h,j). Conidia are 2.5–4 × 2–3 μm (\(\overline{x }\) = 3.5 ± 0.4 × 2.5 ± 0.2, n = 50), hyaline, smooth, and ellipsoidal (Fig. 10l).

On PDA, after 72 h, growth is 24–26 mm at 20 °C and 13–16 mm at 25 °C; and mycelium covers the plate after 8–9 days at 20 °C. A colony is densest, distinctly zonate, and grass green to spearmint green; mycelia are conspicuously dense; and surface hyphae form radial strands (Fig. 8c). Aerial hyphae are long and dense and form greenish aggregates that are granular to pulvinate (Fig. 8i). No diffusing pigment and odor. Chlamydospores examined after 7 days are 5.5–9 × 5–7.5 μm (\(\overline{x }\) = 7 ± 0.9 × 6 ± 0.6, n = 30), globose to oval when terminal, and smooth, with an almost unobserved intercalary (Fig. 8k).

On SNA, growth is approximately 7 mm/day at 20 °C and 5 mm/day at 25 °C; and mycelium covers the plate after 10 days at 20 °C. A colony is hyaline, thin, and loose, with little mycelium on the agar surface, not or indistinctly zonate, but becomes zonate by conidiation in white tufts after 4–5 days; and the margin is downy by long aerial hyphae, which degenerating/dissolving soon (Fig. 8d).

Trichoderma pyramidale W. Jaklitsch & P. Chaverri, Mycologia 107: 581, 2015 (Fig. 9).

Figure 9
Figure 9The alternative text for this image may have been generated using AI.
Full size image

Cultures and asexual morph of Trichoderma pyramidale. (a–d) Cultures at 25 °C [(a) on CMD, 7 days; (b) on MEA, 4 days; (c) on PDA, 4 days; and (d) on SNA, 4 days]. (e) Conidiation tuft (PDA, 7 days). (fj) Conidiophores and phialides (CMD, 5–7 days). (k) Conidia (CMD, 6 days). (l) Chlamydospores (PDA, 7 days). Scale bars: (e) = 2 mm; (f–l) = 10 μm.

Description: Cultures and anamorph: optimal growth at 25 °C on all media, with little growth at 35 °C. On CMD, after 72 h, growth is 29–32 mm at 20 °C and 48–53 mm at 25 °C; and mycelium covers the plate after 5–6 days at 25 °C. Colonies show distinct zonation. Mycelium is loose and thin; hyphae are narrow, sinuous, and often form strands on the margin (Fig. 9a). Aerial hyphae are slight, forming a thin white to green downy, fluffy or floccose mat. Brown pigment is shown, but no distinct odor noted. Conidiophores are hyaline and thick with side branches on several levels at the base of the elongations that are mostly paired and at right angles with phialides in whorls of 3–5. Phialides are 5–9.5 × 2.5–3 μm (\(\overline{x }\) = 7 ± 1.1 × 3 ± 0.3, n = 50) and 1–2.5 μm (\(\overline{x }\) = 1.5 ± 0.3) wide at the base and often short, wide, and ampulliform (Fig. 9f–j). Conidia are 2.5–4 × 2.5–3.5 μm (\(\overline{x }\) = 3.5 ± 0.3 × 3 ± 0.2, n = 50), green, smooth, and ellipsoidal (Fig. 9k).

On PDA, after 72 h, growth is 41–43 mm at 20 °C and 50–55 mm at 25 °C; and mycelium covers the plate after 5–6 days at 25 °C. Colonies show indistinct zonation. Mycelia are dense, opaque, and thick; hyphae are wide, sinuous and often form strands on the margin (Fig. 9c). Margin is thin and ill defined. Aerial hyphae are slight and form a thin white to green downy, fluffy or floccose mat (Fig. 9e). Chlamydospores examined after 7 days are 5.5–10 × 5.5–10 μm (\(\overline{x }\) = 7 ± 0.9 × 7 ± 0.9, n = 30), globose to oval when terminal or intercalary, and smooth (Fig. 9l).

On SNA, after 72 h, growth is 33–35 mm at 20 °C and 38–40 mm at 25 °C; and mycelium covers the plate after 7–8 days at 25 °C. Colonies show distinct zonation. Mycelium is thin, yellow to green; hyphae are wide, sinuous, with indistinct strands on the margin (Fig. 9d). Margin is thin and ill defined. Aerial hyphae are slight and form a thin white downy, fluffy or floccose mat in distal parts of the colony. No diffusing pigment or distinct odor noted. Conidiation similar to CMD.

Trichoderma rossicum Bissett et al., Canad. J. Bot. 81: 578, 2003 (Fig. 10).

Figure 10
Figure 10The alternative text for this image may have been generated using AI.
Full size image

Cultures and asexual morph of Trichoderma rossicum. (a–d) Cultures after 7 days at 25 °C [(a) on CMD; (b) on MEA; (c) on PDA; and (d) on SNA]. € Conidiation tuft (PDA, 7 days). (f–h,j,k) Conidiophores and phialides (CMD, 5–7 days). (i) Elongations (CMD, 6 days). (l,n) Conidia (CMD, 6 days). (m) Chlamydospores (PDA, 7 days). Scale bars: (e) = 2 mm; (f–n) = 10 μm.

Description: Cultures and anamorph: optimal growth at 25 °C on all media. On CMD, growth of 10–11 mm/day at 20 °C and 15–17 mm/day at 25 °C; and mycelium covers the plate after 6–7 days at 20 °C. Colony is dense with a wavy margin, and the surface becomes distinctly zonate (Fig. 10a). Aerial hyphae are numerous, long, elongate, and villiform in the plate (Fig. 10i). No diffusing pigment or odor. Autolytic activity is variable, and coilings are scarce or inconspicuous. Conidiation noted after 3–4 days at 20 °C. Conidiation is effuse and in intense tufts that are hemispherical or irregular, and they show wide wheel grain banding that is gray green to deep green. Conidiophores radiate from the reticulum and are broad, straight, sinuous or helically twisted, show distally slightly pointed elongations, taper from the main axes to top branches, and present primary branches arranged in pairs or in whorls of 2–3, with secondary branches to solitary. Phialides are 4.5–14 × 2.5–4 μm (\(\overline{x }\) = 7 ± 1.5 × 3.5 ± 0.3, n = 50) and 2–3.5 μm (\(\overline{x }\) = 3 ± 0.4) wide at the base, ampulliform, and in whorls of 3–6 (Fig. 10f–h,j,k). Conidia are 3.5–5.5 × 2.5–4 μm (\(\overline{x }\) = 4.5 ± 0.5 × 3 ± 0.2, n = 50), short cylindrical, and a gray color when single and pea green to yellow green in a group (Fig. 10l,n).

On PDA, growth is 12–15 mm/day at 20 °C, 12–16 mm/day at 25 °C; and mycelium covers the plate after 4–5 days at 25 °C. Colony is denser with a wavy margin than that on CMD, and the surface is distinctly zonate (Fig. 10c). Aerial hyphae are numerous, long, and villiform to pulvinate in the plate. No diffusing pigment and odor (Fig. 10e). Autolytic activity is variable, coilings are scarce or inconspicuous. Chlamydospores examined after 7 days are 6.5–9.5 × 6–9 μm (\(\overline{x }\) = 7 ± 1.0 × 7 ± 0.9, n = 30), terminal and intercalary, globose or ellipsoidal, and smooth (Fig. 10m).

On SNA, growth is 8–13 mm/day at 20 °C and 8–12 mm/day at 25 °C; and mycelium covers the plate after 6–7 day at 25 °C. Colony is hyaline, thin and dense; and mycelium degenerate rapidly (Fig. 10d). Aerial hyphae are inconspicuous, autolytic activity is scant, and coilings are distinct. Conidiation noted after approximately 4 days and starts in white fluffy tufts spreading from the center to form concentric zones, and they compact to pustules with a white to greenish color.

Discussion

To characterize the biodiversity and establish the species composition of Trichoderma associated with soil in the Zoige alpine wetland ecological region of Southwest China, morphological characteristics and multilocus phylogenetic analyses were performed to identify 80 strains as T. harzianum (48 strains, 60%), T. alni (15 strains, 18.75%), T. zoigense (a new species, 8 strains, 10%), T. rossicum (4 strains, 5%), T. atrobrunneum (3 strains, 3.75%), T. polysporum (1 strain, 1.25%) and T. pyramidale (1 strain, 1.25%). This is the first comprehensive report on the population structure of Trichoderma in the Zoige alpine wetland. A specialized analysis of Trichoderma from 100 soil samples shows a high richness of the Trichoderma species in this region and indicates the presence of latent resources, due to their complex natural environment and unique climatic conditions. Zoige alpline wetland is generally considered the most important carbon sink ecosystem, in which soil microflora and fungi play vital roles in biogeochemical cycles. So, we should focus on Trichoderma species that contributes to carbon (nutrient) cycles and other functions in Zoige alpine wetlands in subsequent studies.

In this study, the high throughput amplicon sequencing (HTAS) approach based on ITS have used to evaluate species diversity of Trichoderma spp., but showed ineffectively. 13 OTUs of Trichoderma spp. were obtained from 11 soil samples. However, because the single ITS region is not accurate for determining species of Trichoderma, the diversity of the genus remains unclear based on the high-throughput sequencing results. Therefore, the data have not been shown in the study.

Although many studies have focused on identifying Trichoderma, identifying Trichoderma species based on only morphological characteristics remains difficult. Amplifying four universal fungal genes, gpd, acl1, rpb2 and tef1, showed that the gpd gene could divide approximately the 57 representative strains into 4 clades, which were precisely aligned with the previous 4 morphological groups. The gpd gene was suitable for categorizing large groups but was not helpful for the accurate identification of speciation within the Trichoderma complex71. In fact, any single gene among acl1, rpb2 and tef1 can play an essential role in identifying Trichoderma species but cannot accurately distinguish Trichoderma at the species level. Notably, although the primer pair EF1-728F and TEF1LLErev for tef1 was helpful, it did not always successfully amplify all tested DNA materials. Admittedly, many factors affect PCR amplification, not all of which can be attributed to primers, among which the quality of DNA may also be one of the factors. Phylogenetic studies of many species have proven that the most accurate method of species identification is to combine phylogenetic analysis with morphological phenotypic characteristics. In this study, when the genes acl1, rpb2 and tef1 were used in multilocus phylogenetic analysis, the phylogenetic relationships among taxa were consistent with those identified in previous studies in which the phylogenetic tree was built based on the genes rpb2 and tef1 either singly or in combination46,47,49,56.

We found that the Longibrachiatum clade contained a new species, T. zoigense, which was phylogenetically distinct from any other species of Trichoderma (Fig. 2) and provided a low level of support for relationships with T. citrinoviride (C.P.K. 2005) and T. saturnisporum (ATCC 18,903) (Fig. 2, MPBP = 62%). Compared to their morphological characteristics of the above two species, T. zoigense was challenging to distinguish from T. citrinoviride and T. saturnisporum by colony and spores. However, T. zoigense produced yellow pigment dispersion and a fragrance in all tested media and easily produced chlamydospores42,46,47,52,71.

The results of our studies demonstrated significant differences in the abundance and distribution of Trichoderma species isolated in the Zoige alpine wetland natural region. T. harzianum showed the highest abundance among the species isolated from five soil layers and four soil types, implying that this species had good adaptability and could survive under most environmental conditions. Only T. polysporum was isolated at a soil depth of 50–100 cm, indicating that it prefers to live in a low-temperature environment72. In general, it is assumed that some Trichoderma species have stricter requirements for the growth environment and, thus, a narrower range for survival73.

Conclusion

In conclusion, seven Trichoderma species were identified from 100 soil samples collected from Zoige alpine wetland ecological regions, and T. harzianum was the preponderant species. The recognition of Trichoderma zoigense was described for the first time as a new species, and T. atrobrunneum as a new record for China was found. The results of our research will provide a reference for a greater understanding of soil microorganisms, ecological rehabilitation and reconstruction, and as microbial resources in the Zoige alpine wetland.

Materials and methods

Study region

The Zoige alpine wetland (32° 10′ ~ 34° 10′ N, 101° 45′ ~ 103° 55′ E) is located in the northwest part of Sichuan Province in China and on the eastern edge of the Qinghai-Tibet Plateau and has an average altitude of 3400 m above sea level and an area of 19,600 km2. It is a relatively pristine natural area with an annual temperature of 0.6–1.0 °C and an annual precipitation level of 580–860 mm. The cold, humid weather slows the decomposition of the soil organic matter and facilitates its accumulation in the soil74,75,76. Peat soil, meadow soil, subalpine meadow soil and aeolian sandy soil are extensively developed and the most common soil types in this area, because of its unique ecological conditions.

Isolates and specimens

A total of 100 soil samples were collected across a range of soil types (peat soil, meadow soil, subalpine meadow soil and aeolian sandy soil) and soil layers (depth 0–10, 10–20, 20–30, 30–50, and 50–100 cm) in the Zoige alpine wetland ecological regions. Global positioning system technology (GPS Map 76; Garmin Ltd, USA) was used to determine the sampling locations. After removal of vegetation debris, approximately 300 g of each soil sample was immediately placed in a sterile plastic bag in a cooler, transported to the laboratory within 48 h and then stored at 4 °C.

Soil fungi were isolated using the suspension plating method77. Briefly, suspensions (1 mL) of various dilutions (10–1, 10–2 and 10–3) were placed on 90 mm diameter petri plates and Martin medium was then added and mixed evenly with the suspension. The plates were kept in the dark at 25 °C for 5 days, and the colonies of fungi were observed and counted. Three replicates were performed for each concentration. According to the colony characteristics, the purified fungal colonies were transferred onto potato dextrose agar (PDA) and kept in tube slants and glycerol for further taxonomic identification. The specimens were deposited in the Fungal Herbarium of Sichuan Agricultural University, with accession numbers of T1–T80. Moreover, the holotype of new species and new record species were deposited in China General Microbiological Culture Collection Center (CGMCC), with accession numbers CGMCC3.20145 and CGMCC3.20167.

Morphology and growth rate

Cultures were prepared and maintained as described previously46,78. Cultures used for the study of asexual morph micromorphology were grown on PDA, on CMD (cornmeal agar supplemented with 2% (w/v) D (+)-glucose-monohydrate) containing 0.02% (w/v) streptomycin sulfate (Solarbio, China) and 0.02% (w/v) neomycin sulfate (Solarbio), on SNA (low-nutrient agar)68,79 or occasionally on MEA (2% malt extract, 2% agar–agar) at 20 °C or 25 °C under a 12 h/12 h light/dark cycle with cool white fluorescent light during the light period.

Fungal colony characteristics were observed on the CMD, PDA, MEA and SNA media and grown under 12 h of white light and 12 h of darkness at 20 °C and 25 °C. Colony textures and the presence or absence of exudates were recorded using a stereomicroscope (OLYMPUS SZX16, Japan). Colony morphologies were observed weekly with a digital camera (Nikon D3100, Japan). Micromorphological characteristics were observed after 3–7 days or 14 days of cultivation, and microscopic observations were performed in 3% KOH. Chlamydospores were measured from 7 to 30-day-old cultures on CMD or SNA plates under a compound microscope using a 100 × objective. The following characteristics of each isolate were measured: length and width of conidia (n = 50), length of phialides (n = 50), width of phialides at the base (n = 50), and width of phialides at the widest point (n = 50). Nomarski differential interference contrast (DIC) was used for observations and measurements, and data were gathered using a Carl Zeiss microscope (Axio Imager Z2, Germany). Colors were determined with Methuen’s Handbook of Colour.

To identify the optimal growth temperature and differentiate growth rates of the species, 3 representative strains or all strains (≤ 3 in total) for each species were selected to determine the growth rate on CMD at five temperature levels (15 °C, 20 °C, 25 °C, 30 °C and 35 °C) as described previously with minor modifications46. The strains were pre-grown on PDA for 48 h or 72 h at 25 °C. For new cultures, 5-mm agar blocks were cut from the margin of the colonies and transferred to fresh medium from the edge of the 9-cm petri dish. The maximum colony radius was measured every day until the plates were entirely covered with mycelium. The growth rate was calculated by linear regression of t versus r (t = time of incubation and r = radius measured from the edge of the agar plug).

Molecular characterization

DNA samples of representative isolates of 57 morphotypes, which were chosen according to the morphological and cultural characteristics, were extracted from pure cultures (72 h at 25 °C) for phylogenetic analysis as described by Barnes et al.80. Part of the nuclear rDNA ITS region was amplified by PCR using the primer pair ITS1 5′ TCCGTAGGTGAACCTGCGG3 and ITS4 5′ TCCTCCGCTTATTGATATGC81. A 1-kb fragment of RNA polymerase II subunit B (rpb2) was amplified using the primer pair fRPB2-5f 5′ GAYGAYMGWGATCAYTTYGG and fRPB2-7cr 5′ CCCATRGCTTGYTTRCCCAT82. A 1.2-kb fragment of translation elongation factor 1 alpha (tef1) was amplified using the primer pair EF1-728F 5′ CATCGAGAAGTTCGAGAAGG83 and TEF1LLErev 5′ AACTTGCAGGCAATGTGG78. A 0.9-kb fragment of the larger subunit of ATP citrate lyase (acl1) was amplified using the primers acl1-230up 5′ AGCCCGATCAGCTCATCAAG and acl1-1220low 5′ CCTGGCAGCAAGATCVAGGAAGT84. A 0.4-kb fragment of a partial sequence of the glyceraldehyde-3-phosphate dehydrogenase (gpd) gene region was amplified using the primers GDF1 5′ GCCGTCAACGACCCCTTCATTGA and GDR1 5′ GGGTGGAGTCGTACTTGAGCATGT85,86. The PCR mixtures (30 μL) contained 1 μL of genomic DNA (approximately 100 ng), 1 μL of each primer (10 mM), 12 μL of sterile deionized water, and 15 μL of 2 × PCR MasterMix (TIANGEN Co., China). Amplifications were performed in an Eppendorf PCR amplifier (Mastercycler nexus X2, Germany). PCR products were sequenced with an ABI 3730xl DNA Analyzer by Sangon Biotech (Shanghai, China).

Phylogenetic analyses

For approximate identification, all sequences of the 57 strains listed in Table 2 were compared with the NCBI sequence database using the BLAST algorithm. The two markers (ITS and gpd) sequenced in the present study were analyzed separately.ClustalX87 aligned their closest matches, and a distance tree was built with the neighbor-joining (NJ) algorithm in MEGA v. 6.0 with 1000 bootstrap replicates81,88. Combined rpb2, tef1 and acl1 gene sequences were analyzed based on a multilocus dataset. Finally, a phylogenetic analysis was performed for the sequences of a total of 101 strains obtained from the present study or other references in previous studies and complemented with GenBank sequences46,47.

Maximum parsimony (MP) analyses of the combined DNA matrix was performed with PAUP* v. 4.0 b1089 using 1000 replicates of a heuristic search with the random addition of sequences. All molecular characteristics were unordered and given equal weight, and all gaps were treated as missing data. The stability of clades was evaluated by bootstrap analysis with 1000 replicates. Descriptive tree statistics for parsimony (tree length [TL], consistency index [CI], retention index [RI], related consistency [RC] and homoplasy index [HI]) were calculated.

Relationship with ecological factors

The isolation frequency was calculated at the species level using the following formula:

$$\mathrm{F }= \frac{\mathrm{n}}{\mathrm{N}}\times 100\mathrm{\%},$$

where F is the isolation frequency (%), n is the number of species isolated from soil samples, and N is the number of total soil samples. The relationships between the isolation frequency, soil types, and soil layers were subsequently analyzed.