Introduction

Abscisic acid (ABA), one of the most important hormones, regulates growth and development in plants1, such as plant height2,3, fruit ripening4, dormancy5,6, grain filling7,8, and multiple abiotic stress tolerance9,10,11. Decreasing ABA levels in plants increases the value of GA (gibberellin)/ABA, leading to increased plant height and weakened seed dormancy12,13. ABA also enhances the grain filling capacity by inhibiting excessive reactive oxygen species (ROS) accumulation and increasing the starch synthase activity under heat stress in rice14. Under drought stress condition, ABA triggers stomata closure to reduce water evaporation15. ABA can activate antioxidant enzyme activity, such as catalase (CAT), peroxidase (POD) and superoxide dismutase (SOD), which resulting in Na+ content reduction and K+, Mg2+, and Ca2+ content increase under salt stress16. Moreover, ABA induces melatonin and methyl jasmonate (MeJA) increase to alleviate oxidative stress induced by cold stress in plant17. The studies of enhancement of various abiotic stresses tolerance by ABA mostly focuses on the physiological mechanisms of the ABA signaling pathway18,19, while the regulation mechanisms of ABA biosynthesis pathway are less reported.

The endogenous ABA homeostasis is positively regulated by the ABA biosynthesis process in plants20,21,22. ABA biosynthesis includes two pathways: the direct pathway and the indirect pathway23. The direct pathway starts with mevalonic acid (MVA) and synthesizes directly in the cytoplasm via farnesyl pyrophosphate (FPP). This pathway exists in some pathogenic fungi24. In higher plants, the ABA biosynthesis is mainly through the indirect pathway, which starting from carotenoids, and catalyzing ABA biosynthesis through a series of enzymes, such as zeaxanthin epoxidase, xanthoxin dehydrogenase, and 9-cis-epoxycarotenoid dioxygenase (NCED)25. Especially, the NCED encoded by NCED gene, is the key rate-limiting enzyme in the biosynthesis process20,21.

The first NCED gene, VP14, was cloned from an ABA-deficient maize mutant26,27. Subsequently, NCED genes have been identified in various dicotyledonous and monocotyledonous plants, such as cotton (Gossypium hirsutum)28, peanuts (Arachis hypogaea)29, Arabidopsis thaliana30, rice (Oryza sativa)31, wheat (Triticum aestivum)32 and millet (Setaria italica)33. Five members of NCED gene family were identified in Arabidopsis thaliana30. The AtNCED genes exhibit diverse expression patterns and functional redundancy. AtNCED6 and AtNCED9 co-regulate seed germination and dormancy by controlling ABA levels in seeds34. Drought stress strongly induces the expression of AtNCED3 and AtNCED5, resulting in increased endogenous ABA levels and improved drought stress tolerance35. In Malus hupehensis Rehd, NCED plays a role in regulating Cl− stress tolerance36. MaNCED1 gene regulates plant height and multiple stress tolerance in mulberry3. Interestingly, overexpression of the NCED gene in soybeans can enhance tolerance to waterlogging37.

Functional research on the NCED gene in monocotyledonous plants mainly focuses on rice, with only a few studies in millet. Four NCED genes in millet have been cloned, and the expression of the SiNCED1 gene is significantly induced by osmotic and salt stress. Heterologous overexpression of SiNCED1 in Arabidopsis significantly enhances drought stress tolerance, possibly due to the stomatal closure induced by the increased endogenous ABA level33. In rice, the NCED gene family also consists of five members31. OsNCED1 confers heat stress tolerance in rice seedlings38,39. The allele OsNCED2T enhances drought tolerance by scavenging excessive ROS40. Both OsNCED3 and OsNCED5 confer drought, salt, and osmotic stress tolerance12,41. Interestingly, OsNCED3 also contributes to preharvest sprouting resistance in rice by controlling the balance of ABA/GA13. Moreover, OsNCED3 participates in regulating alkaline tolerance in rice42. Although overexpression of OsNCED4 in Arabidopsis enhances drought tolerance43, little is known about the function of OsNCED4 in the native rice plant.

In this study, we identified the function of OsNCED4 in conferring multi-abiotic stress tolerance in rice. OsNCED4 possesses conserved structures of NCED and is a chloroplast-localized ABA biosynthetic enzyme. The expression of OsNCED4 is strongly induced by NaCl and cold stress. OsNCED4 confers salt and cold stress tolerance by regulating the ABA level and ROS homeostasis. Our findings suggest that OsNCED4 is an important potential target gene for improving multiple stress tolerance in rice.

Materials and methods

Rice mutant generation

The CRISPR/Cas9 genome editing system (provided by Professor Yaoguang Liu) was used to generate osnced4 mutants as the previously described method44. The target site (GCAAGATCAAGCAGGGTGCG) was selected according to the website https://blast.ncbi.nlm.nih.gov/Blast.cgi and http://skl.scau.edu.cn/. The 20 bp spacer sequence was inserted into pOsU6-sgRNA vector to generate sgRNA expression cassette. Then the expression cassette was assembled into the binary CRISPR/Cas9 vectors by Golden Gate ligation. The completed constructs were transformed into rice Nipponbare (Nip) (Oryza sativa L. japonica) through Agrobacterium-mediated transformation system. Mature Nip (wild-type, WT) seeds were used to induce calli. The 10-day of calli were subcultured for 7 days. Then the subcultured calli were infected by Agrobacterium. The infected calli were selected by hygromycin for 15 days, for a total of 3 rounds of selection. The resistant calli were transferred to regeneration medium to generate green seedlings. The transgenic seedlings were grown in a greenhouse under natural sunlight and at 28–30 ℃ conditions.

For genome edited mutant detection, the genomic DNA was extracted from transgenic seedling by Rapid Plant Genomic DNA Isolation Kit (Sangon Biotech, Shanghai). The DNA fragment containing 200 bp upstream and downstream sequences from the target site was amplified by PCR using detection primers (OsNCED4-JCF/R) (Table S1). Then the PCR production was sequenced by Sanger method. The sequencing chromatograms were analyzed by rapid decoding tool (http://skl.scau.edu.cn/dsdecode/) to check the genotype of the mutants45. A mutant can be considered if the substitutions, insertions, or deletions were generated at the target sequence.

Analysis of phylogenetic relationship and multiple alignment

The NCED protein sequences of rice (OsNCED1: XP_015626662.1, OsNCED2: XP_015619611.1, OsNCED3: XP_015631538.1, OsNCED4: XP_015645858.1, OsNCED5: XP_015618707.1), Arabidopsis (AtNCED2: NP_193569.1, AtNCED3: NP_188062.1, AtNCED5: NP_174302.1, AtNCED6: NP_189064.1, AtNCED9: NP_177960.1) and maize (VP 14: NP_001105902.3) were searched from the NCBI website (https://www.ncbi.nlm.nih.gov/protein/). The phylogenetic tree was constructed using MEGA 7 software utilizing the maximum-likelihood method. Multiple protein sequence alignment was used to construct the phylogenetic tree and the parameters were set as follows: Jones–Taylor–Thornton, pairwise deletion, and 1000 bootstrap replications. The VP14, OsNCED and AtNCED protein alignments were conducted using DNAMAN software and analyzed as previously described46. The α-helices, conservative His residues (H), and RPE65 domain were shown with different labels.

Plant growth and treatment

The seeds of Nip were used in this study. The seeds were germinated at 30 ℃ for 4–5 days. The young seedlings were then grown in Hoagland’s culture solution and cultured at 28 ℃ under 14 h light/10 h dark conditions. For NaCl and cold stress, 14-day-old seedlings were treated by 150 mM NaCl and 4 ℃ for 4–5 days, respectively. Then the seedlings were recovered for 7 days. For drought stress, the young seedlings were grown in soil for 14 days, and then the seedlings were treated by water deficient treatment for 10 days and recovered for 7 days.

Quantitative real-time PCR (qRT-PCR) analysis

For time-dependent expression of OsNCED4 under salt and cold stress treatment, 14-day-old seedlings were exposed to 150 mM NaCl and 4 ℃ for different time (0, 1, 2, 6, 12, 24, and 48 h). Total RNA was extracted from stress-treated seedling leaves using Trizol reagent (Invitrogen, China) and was converted to cDNA using the Synthesis Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions. Then the qRT-PCR assay was performed using TaqMan™ OpenArray™ qRT-PCR premix (Thermo Fisher Scientific) on the CFX384 Touch system (BIO-RAD, USA). The melt curves of OsNCED4 and the housekeeping genes (Actin and OsUBQ-5) were shown in Fig. S1. Relative changes in expression levels were quantitated using the 2−ΔΔCT method47. PCR primers used for qRT-PCR were listed in Table S1.

Subcellular localization

The open reading frame (ORF) of OsNCED4 was amplified through PCR using OsNCED4-GFP primers (Table S1) with XbaI restriction site and then inserted into the pCambia2300-GFP binary vector by using T4 DNA ligase. The OsNCED4 protein was fused to the N-terminus of GFP. The recombinant construct was transferred into rice protoplasts as the previously described method13. The transient expression signal of green fluorescent protein (GFP) was observed under a laser confocal microscope LSM880 (Carl Zeiss).

β-Glucuronidase (GUS) staining assay

The promoter of OsNCED4 was amplified through PCR using OsNCED4-GUS primers (Table S1) and then inserted into the pCambia1301 binary vector with EcoRI and HindIII restriction sites. The recombinant vector was transformed into Nip through Agrobacterium-mediated transformation system. The T1 transgenic seedlings were treated by 150 mM NaCl and 4 ℃ for 6 h, respectively. Then the leaves were stained using GUS staining solution as previously described12.

ABA content measurement

The seedlings of wild type and mutants treated by 150 mM NaCl for 3 days were taken and stored in a −80 ℃ freezer after using liquid nitrogen for quick freezing. The ABA content was analyzed by LC/MS using an Agilent high-performance liquid chromatograph as previously described48.

H2O2 content and antioxidant enzyme activity analysis

The H2O2 content was analyzed as previously described method with slight modifications49. About 0.1 g of seedlings under 150 mM NaCl treatment for 3 days were collected and ground using pre-cooled acetone (M: V = 1: 2). Then 0.1 mL of 20% TiCl4-HCl solution was mixed with 0.2 mL of 17 M NH4OH in 1 mL of grinding solution. The mixture solution was centrifuged under 3000×g at 4 ℃ for 10 min. The precipitate was collected and washed with acetone for 4–5 times. The washed precipitate was dissolved in 3 mL 2 M H2SO4. The absorbance value of the solution was measured at 415 nm using a UV spectrophotometer (Thermo Fisher Scientific).

For the antioxidant enzyme (POD and CAT) activity determination, the seedlings under 150 mM NaCl treatment for 3 days were taken and stored at −80 ℃. The antioxidant enzyme activity was measured according to the previously described methods50.

3, 3′-diaminobenzidine (DAB) staining

The DAB staining was analyzed as the previously described method51. 20 mg DAB powder was dissolved in 20 mL ddH2O (pH 3.8). Then 0.05% Tween-20 and 10 mM disodium hydrogen phosphate were mixed. The leaves of wild type and mutant seedlings were taken and put into the 1 mg/mL DAB solution and incubated at 28 ℃ for 8–10 h under dark condition. Then the stained leaves were washed with 75% ethanol until the chlorophyll was completely removed. The leaves were photographed under a super depth of field microscope (Olympus).

Data analysis

All experiments were repeated at least three biological replicates. Data were analyzed using SPSS 13.0 software. The significant differences between different treatments were determined using Student’s t-test and labeled with lowercase letters or asterisk. The statistical diagrams were drawn using prism 8.0 software.

Results

OsNCED4 is a chloroplast-localized ABA biosynthetic enzyme

OsNCED3 and OsNCED5 regulate salt and drought stress tolerance in rice12,41. However, it is unclear whether OsNCED4 regulates multi-abiotic stress tolerance. To illustrate the phylogenetic relationship between NCED proteins in monocot and dicot plants, we first conducted an evolutionary tree of the NCED family in rice and Arabidopsis. The results showed that OsNCED4 is most similar to OsNCED3 and OsNCED5, suggesting a potential function similarity (Fig. 1A). Further analysis of the OsNCEDs, AtNCEDs and the VP14 (ZmNCED1) protein sequence revealed that OsNCED4 possessed all conservative structural domains of NCED, such as RPE65 domain46,52,53, conserved His residues (H), and α-helices (Fig. 1B). These results suggest that OsNCED4 is an ABA biosynthetic enzyme in rice.

Fig. 1
figure 1

Sequence alignment of VP14 and NCED proteins. (A) Multiple alignment of NCEDs (The sequence and number were from NCBI GenBank database) was performed with the ClustalW algorithm, and the Neighbor-Joining tree was constructed with MEGA 7 software. OsNCED4 was indicated with red letters and numbers. (B) OsNCED4 protein was aligned with AtNCEDs, other OsNCEDs and maize VP14. Black rectangular frame showed identity in the α1, α2, α3 and α4 helices. Yellow rectangular frame and orange asterisk showed identity for the conservative His residues (H). Green line showed RPE65 domain.

Full size image

To investigate the subcellular localization of OsNCED4, we constructed an OsNCED4-GFP vector and transformed it into rice protoplasts using PEG4000. The results showed that OsNCED4 is localized in the chloroplast under a confocal laser scanning microscope (Fig. 2). Therefore, we further confirm that OsNCED4 is a key chloroplast-localized ABA biosynthetic enzyme.

Fig. 2
figure 2

Subcellular location of OsNCED4 protein. OsNCED4-GFP was expressed in rice protoplasts. The pCambia2300-GFP and protoplasts (with no vector) were used as the positive and negative control, respectively. Each experiment was analyzed using a Zeiss LSM880 confocal laser-scanning microscope. Scale bars = 10 μm.

Full size image

The expression of OsNCED4 is induced by NaCl and cold stress

To explore the function of OsNCED4 in regulating abiotic stress, the expression of OsNCED4 under NaCl and cold stress was detected by qRT-PCR. The housekeeping gene Actin was used as a reference. The results showed that the expression of OsNCED4 was significantly induced by NaCl and cold stress and reached its peak at 6 h and 12 h, respectively (Fig. 3A,B). Moreover, the similar trend of expression of OsNCED4 was displayed using another housekeeping gene OsUBQ-5 (Fig. S2). To observe the expression of OsNCED4 in plants intuitively, the ProOsNCED4-GUS transgenic plants were generated. The intensity of GUS staining in the leaves of ProOsNCED4-GUS transgenic plants was significantly deeper after NaCl and cold stress compared to normal conditions (Fig. 3C). These results indicate that the expression of OsNCED4 is significantly induced by NaCl and cold stress.

Fig. 3
figure 3

The expression of OsNCED4 was significantly induced by NaCl and cold stress. (A,B) The time-dependent expression of OsNCED4 in rice shoots under NaCl (A) and cold (B) stress treatment. The Actin was used as a reference gene in quantitative analysis. (C) Histochemical staining of ProOsNCED4-GUS transgenic plant leaves under NaCl and cold stress treatment. Scale bars = 1 mm. The leaves of non-transgenic plants were used as the negative control. Data are means of at least three replicates of one experiment. Error bars represent ± SD. SD, standard deviation. *p < 0.05 and **p < 0.01 by two-tailed Student’s t-tests.

Full size image

Disruption of OsNCED4 significantly reduces NaCl stress tolerance

To further investigate the function and mechanism of OsNCED4 in regulating salt stress, the osnced4 mutants were generated by CRISPR/Cas9-mediated genome editing system. We sequenced and analyzed 24 regenerated seedlings, and multiple mutants were obtained by sequence decoding (Fig. S3A). About 91.70% of the regenerated seedlings were identified as true transformed plants. The homozygous mutant percentage of osnced4-1 and osnced4-2 were approximately 29.17% and 16.67%, respectively (Fig. S3B). The two homozygous mutants were used for further research. The osnced4-1 mutant had an insertion of “T” nucleotide at position 120 in the coding region, and the osnced4-2 mutant had a deletion of 4 nucleotides at position 117 (Fig. 4A). Both of two mutations resulted in amino acid sequence changes and early termination of protein translation (Fig. 4B). 14-day-old seedlings were treated by 150 mM NaCl for 5–6 days, followed by a 7-day recovery. The results showed that the osnced4 mutants exhibited wilting and significant growth inhibition (Fig. 5A). The survival rate, shoot and root length, and fresh weight (FW) of osnced4 mutants were significantly lower than that of wild type under NaCl stress (Fig. 5B-E). Furthermore, the ABA content in the osnced4 mutants was significantly lower than that of wild type under normal conditions and NaCl stress (Fig. 6). The salt-sensitive phenotype of the osnced4 mutants was due to the decreased ABA levels. These results indicate that disruption of OsNCED4 significantly reduces NaCl stress tolerance.

Fig. 4
figure 4

Acquisition of osnced4 mutants by CRISPR/Cas9-mediated genome editing. (A) Targeted mutagenesis of OsNCED4 gene by CRISPR/Cas9 system. The PAM (NGG structure) is indicated in underlined letters. The insertions and deletions of OsNCED4 mutation are indicated with red letters. (B) Amino acid sequence comparison of osnced4 mutants and WT by DNAMAN software. An asterisk indicates that protein translation is terminated.

Full size image
Fig. 5
figure 5

Disruption of OsNCED4 significantly decreased salt stress tolerance. (A) Phenotype of osnced4 mutants under NaCl stress. 14-day-old seedlings were treated with 150 mM NaCl for 5–6 days and recovered for 7 days. Scale bars = 5 cm. (B–E) The survival rate (B), shoot length (C), root length (D) and fresh weight (FW) (E) of osnced4 mutants and wild type under NaCl stress and normal conditions were calculated. Data are means of at least three replicates of one experiment. Error bars represent ± SD. *p < 0.05 and **p < 0.01 by two-tailed Student’s t-tests. ns, not significant (p < 0.05 by two-tailed Student’s t-tests). SD, standard deviation.

Full size image
Fig. 6
figure 6

The endogenous ABA content of osnced4 mutants and wild type under NaCl stress and normal conditions.

Data are means of at least three replicates of one experiment. Error bars represent ± SD. *p < 0.05 by two-tailed Student’s t-tests. SD, standard deviation.

Full size image

Loss of OsNCED4 influences ROS homeostasis under NaCl stress

Studies have reported that salt stress can lead to the excessive accumulation of ROS, causing damage to plants54,55. We investigated whether NaCl stress affects the ROS homeostasis in the osnced4 mutants. DAB staining results showed that there was no significant difference in staining intensity between osnced4 mutants and wild type seedling under normal conditions, while the osnced4 mutants showed significantly deeper than the wild type under NaCl stress, suggesting an excessive ROS accumulation in osnced4 mutants (Fig. 7A). We further detected the H2O2 content and antioxidant enzyme activity under normal and NaCl stress conditions. The results showed that the H2O2 content of osnced4 mutant was significantly higher than the wild type under NaCl stress, consistent with the DAB staining results (Fig. 7B). CAT and POD activities were significantly lower than the wild type (Fig. 7C, D). These results indicate that loss of OsNCED4 influences ROS homeostasis under NaCl stress.

Fig. 7
figure 7

The loss of OsNCED4 affected ROS homeostasis under salt stress. (A) The H2O2 accumulation of osnced4 mutant and wild type plants under normal and NaCl stress conditions was detected by DAB staining. Scale bars = 1 mm. (B–D) The H2O2 content (B), CAT activity (C) and POD activity (D) of osnced4 mutant and wild type plants under normal and NaCl stress conditions were measured. Data are means of at least three replicates of one experiment. Error bars represent ± SD. *p < 0.05 and **p < 0.01 by two-tailed Student’s t-tests. ns, not significant (p < 0.05 by two-tailed Student’s t-tests). SD, standard deviation.

Full size image

OsNCED4 also regulates cold and drought stress tolerance

Since the expression of the OsNCED4 gene is significantly induced by cold stress, we identified the function of OsNCED4 in regulating cold stress tolerance. 14-day-old osnced4 mutants and wild-type seedlings were treated at 4 °C for 5–6 days, followed by a 7-day recovery. The results showed a large number of seedling death and growth inhibition of osnced4 mutants under cold stress (Fig. 8A). The survival rate and fresh weight (FW) of osnced4 mutants were significantly lower than that of wild type (Fig. 8B,C). DAB staining results showed that the staining intensity of osnced4 mutant leaves was significantly deeper than the wild type under cold stress (Fig. S4). It indicated that excessive ROS was accumulated in osnced4 mutant plants, leading to reduced cold stress tolerance. These results demonstrate that OsNCED4 regulates cold stress tolerance in rice seedling.

Fig. 8
figure 8

Loss of OsNCED4 significantly impairs cold stress tolerance at seedling stage. (A) Phenotype of osnced4 mutants under cold stress. 14-day-old seedlings were treated under 4 ℃ for 5–6 days and recovered for 7 days. The normal condition (28 ℃) was used as a control. Scale bars = 5 cm. (B,C) The survival rate (B) and fresh weight (FW) (C) of osnced4 mutants and wild type plants under cold stress and normal conditions were calculated. Data are means of at least three replicates of one experiment. Error bars represent ± SD. **p < 0.01 by two-tailed Student’s t-tests. ns, not significant (p < 0.05 by two-tailed Student’s t-tests). SD, standard deviation.

Full size image

We also investigated whether OsNCED4 regulates drought stress tolerance. The young seedlings of osnced4 and wild type were grown in soil for 14 days. Then the seedlings were treated by water deficient treatment for 10 days and recovered for 7 days (Fig. S5A). The results showed that the survival rate of osnced4 mutants was significantly lower than the wild type under drought stress (Fig. S5B), indicating that OsNCED4 also regulates drought stress tolerance in rice.

Discussion

Plant hormone ABA plays a critical role in plant growth, development, and stress tolerance11,56,57. The ABA biosynthesis is regulated by several enzymes, while the NCED acts as a key rate-limiting enzyme, modulating endogenous ABA level through oxidatively cleaving 9-cis-violaxanthin or 9-cis-neoxanthin to produce xanthoxin58. The functions of most NCED genes in abiotic stress have been elucidated in rice. Heterologous overexpression of OsNCED4 in Arabidopsis enhances drought tolerance, but its native function in rice remains unclear. This study investigated the function of OsNCED4 in abiotic stress by generating CRISPR/Cas9-mediated gene editing mutants.

NCED genes exist as a gene family in plants58. OsNCED4 shows structural similarities with VP14 and other NCEDs, possessing conserved domains such as RPE65 domain, α-helices, and His residues, which are essential for the function of dioxygenase (Fig. 1). NCED enzymes perform the catalyze reactions in plastids23. Studies have shown that OsNCED3 localized in plastids when OsNCED3-GFP vector was transformed into both Arabidopsis and rice protoplasts12,13. Similarly, our research demonstrates that OsNCED4 is localized in the chloroplasts of rice protoplasts (Fig. 2), indicating that OsNCED4 is also a plastid-localized ABA biosynthesis enzyme, catalyzing the cleavage of 9-cis-violaxanthin or 9-cis-neoxanthin to xanthoxin.

NCED promotes abiotic stress tolerance in plants for its function of increasing ABA levels59. osnced1, osnced3, and osnced5 mutants exhibit reduced ABA content and significant sensitivity to multiple abiotic stress12,38,39,41. The ABA levels in osnced4 mutants are markedly lower than in the wild type, contributing to salt sensitivity (Fig. 6). Studies have shown that many abiotic stresses lead to ROS accumulation in plants, which causing damages54,60. Our results showed that ROS levels in osnced4 mutants were significantly higher than that of wild type under salt stress (Fig. 7), suggesting that the reduced salt tolerance of osnced4 mutants may be due to the excessive ROS accumulation in plants. Furthermore, we found that osnced4 mutants were extremely sensitive to cold stress, also likely due to the imbalance of ROS under cold stress (Fig. 8; Fig. S4). Researches have shown that excessive ROS accelerates the process of leaf senescence61. Interestingly, OsNCED3 and OsNCED5 regulate leaf senescence by regulating the ROS homeostasis in plant12,41. Therefore, the ROS homeostasis regulated by NCED plays an extremely important role in plant abiotic stress and leaf senescence.

In plants, one NCED gene confers different abiotic stress tolerance, which may be an effective adaptation strategy to diverse environmental changes during long-term evolution. The demand for staple crops like rice continues to rise with the increasing global population62,63. Therefore, there is a large need to generate crop varieties with multiple stress tolerance to address both population and environmental challenges, especially the continuously expanding saline alkali land and frequent extreme high and low temperatures64,65. The OsNCED4 gene can be used as a potential gene for multi-stress breeding efforts in the future. Studies on NCED only focused on various abiotic stresses previously. Nowadays, more and more researches on NCED have begun to focus on plant growth, development and biotic stress. OsNCED3 regulates seedling growth and seed dormancy by controlling ABA/GA homeostasis13. This is an important progress in the regulation of plant growth and dormancy by NCED. Exogenous ABA enhances the grain filling capacity in rice14, and we speculate that NCED may play a critical role in seed development and yield. Surprisingly, OsNCED3 plays an important role in enhancing the resistance of brown planthoppers through the interaction of jasmonates and ABA66,67. The results provide important references to determine whether OsNCED4 or other NCED gene enhances the pest or disease resistance in the future.

In summary, our study revealed that OsNCED4 regulates salt and cold stress tolerance by controlling ABA levels and ROS homeostasis in rice. Whether OsNCED4 is involved in other aspects of growth, development, and tolerance to biotic or abiotic stresses is needed to explore through generating multiplex genome editing mutants of OsNCED. Additionally, how OsNCED4 interacts with potential downstream genes or related interacting proteins is a worthwhile goal for future study.