Introduction

Newcastle disease virus (NDV) is a widely distributed virus that affects poultry and other avian species. It causes high morbidity and mortality in commercial and domestic poultry. The susceptibility of a wide variety of avian species coupled with frequently mobile wild bird reservoirs has contributed to the vast genomic diversity of this virus as well as diagnostic failures1. The etiological agent of disease is the virulent forms of the avian Paramyxovirus 1 (APMV-1) also known as Newcastle disease virus (NDV). It belongs to genus Avulavirus of the family Paramyxoviridae2. NDV has a negative sense, single stranded RNA genome. Its entire genome consists of 15,186 nucleotides, with six structural genes in the order of 3′- NP-P-M-F-HN-L-5′ that encode six proteins The fusion (F) protein, which is the most immunogenic protein of the virus, plays important role in the pathogenicity of virus3. Based on the complete sequence of the F gene, NDV strains are classified into two classes I and II. Class I contains a single genotype, and strains have been isolated mainly from wild birds and are generally lentogenic. Class II contains at least 18 genotypes (I-XVIII), and they can be lentogenic, mesogenic or velogenic4. Based on classification rules, an evolutionary distance between 3 and 10% among clades within a genotype allows its subdivision into sub genotypes. Common vaccine strains (i.e. LaSota) belong to genotypes I and II and are used all over the world. On the other hand, genotype VII strains are highly virulent and have been isolated from Asia.

In Pakistan this disease is enzootic and cause huge economic losses due to high morbidity and mortality rate and rapid spread5,6. Despite widespread vaccination efforts, outbreaks of ND continue to pose a challenge, drawing considerable attention from researchers in recent years. The persistence of ND in vaccinated birds is attributed to factors such as inadequate vaccination protocols, coexisting immunosuppressive diseases, and viral mutations that alter the biological properties and pathogenicity of the Newcastle disease virus (NDV)7.

Hence, it is reasonable to think that vaccines could be improved by matching their antigenicity with those of field strains8. While various ND vaccines demonstrate protection against morbidity and mortality, evidence suggests that matched vaccines may exhibit a better protection rate) and lower viral shedding compared to mismatched ND vaccines9,10. Some studies, however, have reported the effectiveness of combined inactivated genotype II (La Sota) and genotype VII vaccines in reducing virus shedding11.

Currently inactivated and live vaccines are used against ND. Although vaccination may protect birds from the more serious consequences of NDV infection, virulent epizootic virus and/or the vaccine virus may infect, replicate, be excreted and be present in the tissues and organs of apparently healthy birds. Live vaccines have some limitations, including the need for bio containment during production, cold chain requirements, and safety concerns due to the possibility of reversion, especially for RNA viruses12 A major problem with the use of inactivated vaccines administered by the mucosal route is that they generally have poor immunogenicity and can cause disease if they are not completely inactivated13. Also In non-vaccinated chickens, virulent strains are capable to produce up to 100% morbidity and mortality. While classical vaccines are capable to prevent the disease under experimental conditions, they fail to prevent viral shedding 8. So, there is a need to improve and extend the impact of vaccination programs against NDV. Novel strategies, such as using deoxyribonucleic acid (DNA) vaccines, are being developed to produce a new formulation of vaccines, which can improve efficacy. DNA vaccines which mimic live attenuated vaccines in their ability to induce both humoral and cellular responses may prove to be a useful alternative14. It is suggested that antigenic matches of F proteins between vaccine and challenge strains are capable to improve vaccine protection by significantly reducing viral sheading. DNA vaccines represent a promising technology due to their safety, genetic stability, ease of production, non-requirement for cold chain, and activation of innate immunity pathways15,16. To assess whether genotype VII matched vaccine can improve protection against a homologous challenge, we isolated the virus from field outbreaks following by protocols, HA, HI and confirmed by RT-PCR and sequencing. We generated one recombinant DNA Genotype VII NDV vaccine strains containing F proteins from the genotype VII strain with accession number (Pak Arid 4 -OQ909177.1) in pcDNA3.1 expression vector. Efficacy of developed vaccine was checked for their capacity to induce protection, specific antibodies and reduce viral shedding17. It was suggested that novel DNA vaccines can confer more protection and decrease viral shedding, also decrease severity of clinical signs and reduce mortality. It’s a promising alternative to already used conventional vaccines.

Materials and methods

Sample collection

NDV suspected samples were collected on the basis of history and clinical signs, from 34 different broiler farms from District Rawalpindi. These flocks were vaccinated against Newcastle Disease (ND) according to the schedule.

Processing of samples

Tracheal and cloacal swabs were collected in 2 ml transport medium, mixed with 0.25 ml antibiotic stock (2000 IU/ml penicillin, 2 mg/ml streptomycin), centrifuged (2000 rpm, 10 min), and filtered (0.2 µm syringe filter) before inoculation. Brain, trachea, spleen, proventriculus, and lung tissues (2 g) were triturated, blended, and centrifuged (10 min). The supernatant was filtered (0.2 µm syringe filter) and treated with antibiotics before inoculation18.

Isolation and identification of virus

For the isolation of virus Nine-day-old embryonated chicken eggs (SPF) were inoculated with 0.2 µL virus via the allantoic route, and the fluid was harvested after 48 h19. The harvested fluids were tested by heamagglutination (HA) assay. Samples that showed agglutination were further confirmed by using a hemagglutination inhibition (HAI) assay with specific NDV antisera to determine the titer of virus20.

Pathogenicity studies

To identify the velogenic strain of NDV, a Mean Death Time (MDT) assay was conducted following standard procedures20.

Extraction of RNA

Virus isolates were processed for viral RNA extraction using the Favor Prep Viral Nucleic Acid Mini Kit, following the instructions of manufacturer (FAVORGEN). The RNA quantity was assessed using a NanoDrop spectrophotometer (Thermo Scientific, USA). The extracted genomic RNA stored at -20 °C for further analysis.

Reverse transcriptase PCR for fusion protein coding gene

To amplify a specific region of the fusion gene, reverse transcriptase PCR was performed using specific primers ND-Cl-2 Forward 5′-ATGGGCTCCAGACTCTTCTAC-3′ and ND-Cl-2 Reverse 5′-CTGCCACTGCTAGTTGTGATAATCC-3′ previously designed and published by Liu et al.16.

Phylogenetic analysis

Positive PCR products were sequenced at Macrogen Korea® using an ABI 3730xL DNA sequencer. Obtained sequence was submitted to NCBI GenBank for Accession Number. Sequences was aligned already submitted sequences and phylogenetic trees was constructed using CLUSTAL W and neighbor-joining method in MEGA 11software with 1,000 bootstrap replicates.

Construction of DNA vaccines by cloning of F gene into pcDNA3.1 vector

Virus

Virulent NDV genotype VII accession number (Pak Arid 4 (GenBank: > OQ909177.1) was used in the present study as source of the F gene to generate the DNA vaccine candidate and as challenge virus. It was isolated in 2021 from commercial poultry in Rawalpindi, Pakistan during a ND outbreak and has been classified into genotype VII.2 highly vellogenic strain.

Primer design

Fusion gene primers for Newcastle Disease Virus (NDV) were designed using SnapGene, incorporating XhoI (forward) and HindIII (reverse) restriction sites: Forward: 5′AAAAGCTTATGGGCTCCAGACTCTTCTAC3′ Reverse:5′AACTCGAGCTGCCACTGCTAGTTGTGATAATCC3′.

RT-PCR amplification

RT-PCR was performed using the Invitrogen Superscript™ RT-PCR kit in a 50 µL reaction with NDV primers, reaction mix, Platinum RT-Taq polymerase, and PCR water. Amplification was carried out in a 2720 thermocycler using following conditions Reverse transcription: 45 °C, 25 min Initial denaturation: 95 °C, 2 min, Denaturation: 95 °C, 30 s, Annealing: 58 °C, 1 min Extension: 72 °C, 1 min, Final extension: 72 °C, 10 min.

Gel purification

PCR products were purified using the Monarch® PCR DNA Cleanup Kit following the manufacturer’s protocol. DNA quantification was performed using a NanoDrop spectrophotometer.

Digestion and ligation

Restriction digestion was performed for vector and insert using HindIII and XhoI in a 20 µL reaction, incubated at 37 °C for 4 h. Ligation was done using T4 DNA ligase with a 2:1 insert-to-vector ratio and incubated overnight at 16 °C. Inactivation of reaction for ten minutes, by keeping it at 65 °C in water bath. After that, it was chilled on ice and then transformed 1–5 μL of the reaction into 50 μL competent cells.

Transformation and colony selection

DH5α cells were transformed with 2–3 µL of ligation mix using heat shock (42 °C, 30 s), followed by recovery in S.O.C. medium (37 °C, 1 h, 200 rpm shaking). Transformed cells were plated on LB agar with 50 µg/mL ampicillin and incubated at 37 °C for 16 h. White colonies were selected and cultured in LB broth for plasmid extraction.

Plasmid extraction and confirmation

Plasmid DNA was extracted from overnight cultures using the Solarbio Plasmid Extraction Mini Kit according to instructions of manufacturer. Positive clones were confirmed by reverse digestion with XhoI and HindIII followed by gel electrophoresis, yielding 535 bp (insert) and 5.4 kb (vector) bands.

DNA quantification and vaccine dose adjustment

Plasmid DNA was quantified, using Nano drop and vaccine dosage was set at 200 µg DNA per dose3.

Plasmid isolation and sequencing

For plasmid extraction a mini plasmid preparation kit was used by following the manufacturer’s protocol (Solarbio plasmid extraction mini kit) from overnight cultures and sequenced.

DNA immunization of SPF chickens

The experiment was conducted at the experimental sheds of PMAS Arid Agriculture University, Rawalpindi, Pakistan. All pens and equipment were fumigated with ammonium hydroxide to eliminate any existing virus. Fresh wood shavings were used as litter, and separate pens were maintained for each group to prevent cross-contamination. The facility was preheated to 85–90°F one day before chick arrival.

A total of 120 chickens were randomly divided into four groups at 14 days of age. Group I was vaccinated with rDNA-NDV-F vaccine (200 µg DNA), group II was the vector control group immunized with pcDNA3.1, group III was the negative control (non-vaccinated, challenged group) injected with PBS, and group IV was the unvaccinated, non-challenged control group. The first dose was administered at day 14, followed by a booster at day 28. At day 42, all groups (10 birds from each group due to ethical reason) except the non-challenged control were exposed to a velogenic NDV strain (OQ909177.1, subgenotype VII.2) propagated in 10-day-old embryonated eggs. The virus EID₅₀ was determined using the Reed and Muench21 method, and the challenge was given via the intramuscular route.

Blood samples were collected at days 0, 7, 14, 21, and 28 post vaccination. Post-challenge, birds were monitored twice daily for 10 days for mortality and clinical signs (respiratory, digestive and nervous signs). Swab samples for virus shedding were collected on days 3, 7, and 10 post-challenge. All the birds were kept for 10 days post challenge for disease signs and to check virus shedding.

Indirect ELISA

ELISA was performed using the ID Screen® Newcastle Disease Indirect ELISA Kit (IDvet, France) to detect antibodies against Newcastle Disease Virus (NDV) in poultry serum according to manufacturer’s protocol. Absorbance is measured at 450 nm using an ELISA plate reader. The results are interpreted based on the S/P ratio, calculated as (Sample OD—Negative Control OD) / (Positive Control OD—Negative Control OD). An S/P ratio of < 0.3 is considered negative (below 800),  > 0.5 is positive for NDV antibodies (800 titer).

Challenge study

In the challenge study, 10 birds were randomly selected form each group. The birds were challenged with a virulent strain of Newcastle Disease Virus (NDV) EID50 after 14 days post booster. The unvaccinated group served as the control to evaluate the baseline susceptibility to infection and to compare the protective effects of the vaccine. The NDV strain (OQ909177.1) used for the challenge study was identified as velogenic and classified as subgenotype VII.2 through phylogenetic analysis. The virus was propagated in embryonated chicken eggs that were 10 days old. To determine the virus EID50, titration was performed following the procedure described by Reed & Muench (1938b).

Clinical sign observation

Ten birds from each group were observed daily and clinical signs were recorded up to 10 days post-challenge for mortality, survival, and sick birds (respiratory, digestive and nervous signs).

Assessment of virus shedding

At 3, 7, and 10 days post-challenge, tracheal and cloacal swabs were collected from each group (n = 10). Swabs were processed in normal saline and centrifuged at 5000 rpm for 10 min. RT-PCR was performed after RNA extraction and after gel electrophoresis band size was compared with DNA ladder 535 bp band obtained, declared as positive for NDV.

Statistical analysis

The data were analyzed by Chi square, ANOVA and statistical significance was set at p ≤ 0.05. Comparison between groups were analyzed by Tukey’s test. All analyses were carried out using SPSS and Microsoft Excel 2010 (Microsoft, USA).

Results

Virus isolation and pathogenicity characterization

This study focused on isolation and molecular characterization of class II genotype VII NDV isolates from outbreaks around Rawalpindi. Necropsy examination revealed congestion of spleen and hemorrhages on proventriculus and onset of mortality ranged between 15 and 85%. The virus isolated from allontaic fluid of 10 days old embryonated SPF chicken eggs gives positive Heamaglutination (HA) and Heamaglutination Inhibiotion (HA) assay with specific positive NDV antisera. Out of 34 suspected farms pooled organ and swab samples representing each poultry farm, 22 isolates declared positive (65%). Mean death time assay declared 15 isolates as vellogenic NDVs as death of embryo occur before 60 h post inoculation of virus20. The prevalence of NDV genotype VII recorded as 44%.

Proteolytic cleavage site analysis of F0 protein

Partial fusion gene was amplified with the help of Class II primers and resulted in 535 bp product size. All the 22 samples declared positive by HA, HI and MDT also gave positive results by RT-PCR (Fig. 1). The amplified product of some selected isolates were sequenced. Pathotype prediction based on amino acid sequences of fusion gene on cleavage site shown the amino acid motif 112R-R-Q/R-K/R-R-F117 and declared vellogenic NDV (all samples of fusion gene fragment of 535 bp have been found to have identical sequence).

Fig. 1
Fig. 1The alternative text for this image may have been generated using AI.
Full size image

PCR results for NDV using f gene. Lane 1: 100 bp, Lane 3: negative control, Lanes 4–6: positive samples of NDV, Lane 7: positive control. Band size of positive PCR products: 535 bp size.

Phylogenetic analysis based on the partial F-gene sequences

The phylogenetic analysis based on partial fusion gene sequence of isolate with accession number Pak arid 4 (OQ909177.1) compared with already available sequences on NCBI data base. This analysis declared isolate as Class II NDV genotype VII.2, which is highly pathogenic strain of NDV. Sequence showed 99–100% similarity with the submitted sequence of same strain present on NCBI data base from neighboring countries, China, India and Iran Fig. 2. It is main cause of NDV outbreaks in commercial poultry farms of Rawalpindi.

Fig. 2
Fig. 2The alternative text for this image may have been generated using AI.
Full size image

Phylogenetic relationships of fusion gene sequences of NDV Pak Arid 4, collected from Rawalpindi division. Neighbor Joining (NJ) methods were used for concluding phylogenies. References sequence was highlighted with colour. For each sequence country of origin and GenBank accession numbers were given.

Cloning of fusion gene to expression vector (pcDNA3.1)

The F gene fragment was successfully cloned into the pcDNA3.1 vector, and the appearance of white colonies on LB agar confirmed successful transformation of insert into E. coli. RT-PCR analysis confirmed the successful insertion and stability of the F gene in the vaccine construct (rDNA-NDV-F). The results showed an expected band size of 535 bp (Fig. 3).

Fig. 3
Fig. 3The alternative text for this image may have been generated using AI.
Full size image

Positive PCR results after cloning. Lane 1; Negative control; Lane 2; positive control Lane; 3–4 Amplified fusion gene; Lane L ladder, (100 bp). Product size ~ 535-bp.

Restriction digestion and PCR

Further validation of the cloned construct was performed through restriction enzyme digestion using XhoI and HindIII. This digestion produced two distinct fragments: a 535-bp fragment corresponding to the inserted F gene and a 5.4-kb fragment representing the pcDNA3.1 vector. These results confirmed the successful construction of the rDNA-NDV-F vaccine. (Fig. 4).

Fig. 4
Fig. 4The alternative text for this image may have been generated using AI.
Full size image

Results of restriction digestion after digesting with XhoI and HindIII. Lane 1: DNA ladder (1 kb); Lanes 2 and 3: The first band (535 bp) confirms the presence of the F gene, while the second band (5,400 bp) represented the vector.

Assessment of antibody response by ELISA

To evaluate the geometric mean titer (GMT) in the ELISA assay, a 1:500 dilution was used. The positive control group exhibited a GMT of 800, while the negative control group had a mean value of 400. Vaccinated birds (G1) demonstrated a significant increase in titers compared to non-vaccinated birds (G2 and G3) (p < 0.05). The antibody titer progressively increased from day 0 to day 28 post vaccination. In the negative control group, no detectable titers were observed, and the ELISA remained negative. In the G1 vaccinated group, the GMT was 653 on day 0, increased to 1473 on day 7, and peaked at 2575 on day 14, following the first dose. A booster dose was administered on day 14, and by day 21, the titer rose to 4873. On day 28, the calculated mean titer reached 6180 (Fig. 5). All values were shown graphically in Fig. 5.

Fig. 5
Fig. 5The alternative text for this image may have been generated using AI.
Full size image

Geometric Mean antibody titers assessed by ELISA at 0, 7, 14, 21 & 28 day post immunization. G1 was recombinant rDNA-NDV- F vaccine, G2 is non-vaccinated control group and G3 represents vector control group. Figure showed rise in titer from 7th day to 28th day in G1 group while in vector group G2 and non- vaccinated group G3 no significant rise of antibodies was observed.

An analysis of variance (ANOVA) was performed to compare ELISA values across Groups 1, 2, and 3. The model explained a significant amount of the variance, with an F value of 177.04 and a p value of less than 0.001. The results indicate that there were significant differences in Elisa values between these groups. The model accounted for a partial sum of squares (SS) of 5.87E + 08, with 2 degrees of freedom (df) and a mean square (MS) of 2.93E + 08.

Virus shedding post challenge

In the rDNA-NDV-F vaccine group, virus shedding was significantly lower, with only 4/10 animals shedding the virus on day 3 from tracheal swabs, decreasing to 2/10 on day 7, and none shedding by day 10. A similar trend was observed in cloacal swabs, with 3/10 shedding on day 3, 1/10 on day 7, and none on day 10. In contrast, the vector control group exhibited much higher shedding rates, with 10/10 animals shedding the virus at day 3, and 6/6 shedding at day 7, although 4 animals died by day 7, leaving only 2 shedding at that point. By day 10, only 1/1 animal was shedding. Cloacal shedding followed a similar pattern, with all animals shedding at day 3, a decrease to 6/6 on day 7, and 1/1 by day 10, with fatalities observed in the same timeframe. The negative control group showed the highest mortality, with all animals shedding virus at day 3. By day 7, only 4/5 animals were shedding, but all had died by day 10. The results highlight the protective efficacy of the rDNA-NDV-F vaccine, as it led to lower virus shedding and deaths compared to both the vector control and negative control groups. Values of virus shedding of each group were mentioned in Table 1 as.

Table 1 Comparison of virus shedding post challenge.

Clinical signs and mortality rate, after NDV genotype VII challenge

Data on clinical signs and mortality rates in birds (n = 10 per group) challenged with Newcastle Disease Virus (NDV) after receiving different treatments showed that the parameters observed include respiratory signs (RS), digestive signs (DS), neurological signs (NS), and mortality percentage (%). Three groups were evaluated rDNA-NDV-F vaccine group, vector control group, and negative control group.

In the rDNA-NDV-F vaccine group, mild clinical signs were observed, with 3 out of 10 birds exhibiting respiratory and digestive signs (3/10 RS, 3/10 DS). However, no birds showed neurological signs (0/10 NS), and there were no mortalities (0%), indicating that this vaccine provided significant protection against NDV infection. The vector control group, which did not receive a protective vaccine, showed severe clinical signs, with all birds (10/10) developing respiratory and digestive signs and 7 out of 10 exhibiting neurological signs (7/10 NS). The mortality rate was 90%, suggesting that the NDV challenge was highly pathogenic in unprotected birds.

Similarly, the negative control group (completely unvaccinated) exhibited the most severe disease outcome, with all birds (10/10) showing respiratory, digestive, and neurological signs and a 100% mortality rate, confirming the virulence of NDV in unprotected birds. Observed clinical signs were presented separately for each group in Table 2.

Table 2 Observation of clinical signs and mortality % (1–10 days) after challenge with genotype VII NDV.

These results indicate that the rDNA-NDV-F vaccine significantly reduced clinical disease and completely prevented mortality, whereas unvaccinated groups suffered severe disease and high mortality. This emphasizes the importance of vaccination in protecting against NDV infections.

Discussion

Newcastle disease virus (NDV) significantly impacts global poultry, leading to high morbidity and mortality. Monitoring and pathotyping NDV are crucial for understanding its spread and assessing vaccine efficacy10. In Pakistan, NDV presents a major challenge to the poultry industry. This study isolated and characterized NDV from 34 large commercial flocks to develop a genotype-matched vaccine. Despite widespread vaccination, frequent outbreaks persist annually, suggesting that current vaccines or vaccination strategies may be inadequate.

In this study, the NDV strain circulating in the field and causing severe outbreaks was genotypically characterized as genotype VII, sub-genotype VII.2 (f subtype). Phylogenetic analysis revealed 100% sequence similarity to previously reported strains from neighboring countries, including China, India, and Iran. The viral sequence identified in this study contained the 112RRQKRF117 motif, a hallmark of velogenic NDV, with phenylalanine (F) at position 117 a feature associated with neurological manifestations. These findings are consistent with previous studies10,22.

Genotype VII has emerged as the predominant strain responsible for disease outbreaks, even in vaccinated poultry. This highlights the genetic diversity of NDV and the emergence of highly virulent genotypes23. Consequently, the urgent development of effective anti-NDV strategies is required.

Among recent advancements in vaccine development, DNA vaccines have gained significant attention due to their advantages over conventional antigen-based vaccines. These vaccines can elicit both humoral and cellular immune responses while also promoting T-cell polarization. Compared to protein-based vaccines, DNA vaccines offer improved stability, extended shelf life, and reduced costs associated with production, storage, and transportation. However, limitations such as the requirement for high doses, weak immunogenicity, and low expression levels of target genes remain major obstacles to their widespread application (Zhao et al., 2017).

This study addresses the need for improved ND control by evaluating a new vaccine candidate designed to enhance immunogenicity and stability, providing a potential solution for better ND management. Specifically, the study assessed the immunogenicity of ND DNA-genotype matched vaccines constructed using the F genes of a virulent NDV genotype VII strain isolated from Rawalpindi, Pakistan. DNA vaccines offer significant advantages over conventional vaccines, particularly in addressing the challenges of eradicating NDV in Pakistan, including virulent strains like genotype VII. These vaccines provide enhanced security, the ability to be multivalent, and the capacity to induce both humoral and cellular immunity, which are crucial for effectively combating viral infections that rely on cellular immune clearance, offering broader protection against diverse NDV strains3,24.

In this study, F gene of NDV was isolated from field outbreaks and characterized by RT-PCR and NDV genotype VII was used for DNA vaccine development for better efficacy, less viral shedding and reduced mortality after challenged with field NDV. The similar approach was used by Amoia et al.25 and Firouzamandi et al.3. The 0.5 kb fragment selected for this study corresponds to the region encoding the highly conserved and immunodominant domain of the F protein, including portions of the fusion peptide and heptad repeat regions. These domains are known to play a critical role in viral fusion and host-cell entry, and are frequently targeted by neutralizing antibodies. Previous studies (e.g., Huang et al., Virology, 2004) have indicated that even subunits or peptides from the F protein can induce protective immunity if they contain essential functional epitopes.

In the present study, the eukaryotic expression vector pcDNA3.1 constructed vaccine was used for direct DNA vaccination. Such vaccines might be safe and have an advantage over using recombinant proteins that there is no need to purify the recombinant protein away from contaminating bacterial or yeast proteins prior to vaccination. In addition, DNA vaccine, with eukaryotically expressed plasmids encoding proteins has been well-documented to elicit both humoral and cell-mediated immunity26.

Birds immunized with rDNA-NDV- F vaccine (G1), G2 with empty vector and G3 used as negative control group. ELISA titers was calculated at 0, 7, 14, 21 and 28 days post immunization. The current study showed that the rDNA-NDV-F vaccine induced a significantly higher antibody response (p < 0.05). Vaccinated birds exhibited increasing ELISA titers from day 7 (1470) to day 14 (3480), with a booster dose further elevating titers to 4790 (day 21) and 6180 (day 28). In contrast, the non-vaccinated group had no detectable titers. These results align with the study of27) confirming the highest efficacy of recombinant vaccines as compare to non- vaccinated birds.

In the group G1vaccinated with rDNA- NDV-F vaccine mortality rate was 0% as compare to negative control group and vector control group in which all birds died at end of experiment with severe clinical signs. At the end of experiment 100% birds survived vaccinated with rDNA- NDV-F. High survival rate 80% was also reported by Amoia et al.25.

The traditional inactivated or subunit vaccines could not completely inhibit virus shedding and induce poor cellular responses Thus, the use of the F gene from a velogenic strain fits the criteria for generating an improved immune response against F protein containing a polybasic cleavage motif28.

In present study shedding of virus post challenge in rDNA-NDV-F vaccinated group was observed on 3 day post challenge and found that 3 tracheal and cloacal swabs were positive for virus shedding, on 7th day 2 samples were positive on 10th day no shedding observed. In non-vaccinated negative control group (G3) and vector control group (G2) virus shedding was positive on 3rd, 7th and 10th day in all tracheal and cloacal swabs. The study is in agreement with Khulape et al.29 who reported 2% virus shedding in swabs in vaccinated group on 3rd and 3% shedding on 7 day and 0% virus shedding post challenge on 10th day.

Respiratory and digestive signs were observed in only 3 birds in G1 group after challenging with vellogenic strain of NDV (Genotype VII strain) 105 EID50 isolated from field outbreaks. In the negative and vector control group, severe digestive respiratory and nervous signs were observed, such as edema, hemorrhages, and respiratory tissue necrosis were observed in deceased chickens, while no significant gross lesions were detected in the vaccinated group. These finding are similar to study of Khulape et al.3,25,27,29.

The efficacy of the DNA vaccines may be improved if they are applied together with plasmids expressing cytokines and/or costimulatory molecules30. Other approaches such as microencapsulation or association of the DNA plasmids nanoparticles can also be used to improve gene delivery and gene transfection in vivo, resulting in higher immune response11.

In conclusion, the results of the present study also indicate that expressing F gene of NDV can induce immune response to the virus and improve efficiency of vaccine. The findings presented herein will provide further information regarding the potential value of DNA vaccines to NDV infection. This study reported that the DNA vaccine using F gene of genotype matched NDV vaccine protect chicken against homologous challenge. Although it require many new trial and improvement in development of vaccine candidate to completely control or eradicate the NDV in Pakistan. One promising approach is the study of immunological response of gene and also can change the delivery method of vaccine e.g. electroporation. Approval of vaccine, licensing and performance data of vaccine by different trials also required to confirm the efficacy of vaccine and protection during NDV challenge in field conditions.