Chemosensation drives divergent social behavior in Drosophila

Wu, Binbin; Keebaugh, Erin S.; Ja, William W.

doi:10.1038/s42003-025-08886-z

Download PDF

Article
Open access
Published: 04 November 2025

Chemosensation drives divergent social behavior in Drosophila

Communications Biology volume 8, Article number: 1521 (2025) Cite this article

1961 Accesses
2 Altmetric
Metrics details

Subjects

Abstract

Social interactions play a key role in animal survival and reproduction, shaping mating success, cooperation, competition, and the transmission of information and disease. Across species, the social environment not only influences behavior but also feeds back on physiology, stress responses, and evolutionary trajectories. Despite this central importance, the molecular signals that control how animals sense and respond to one another remain incompletely understood. Drosophila melanogaster provides a powerful model to probe these mechanisms, as it combines a rich repertoire of social behaviors with unparalleled genetic tools, highly accessible neural circuits, and evolutionary conservation of key molecular pathways underlying sensory processing. Using this system, we investigated behavioral responses to housing status. While group housing elicits interactions such as chasing and touching, Dahomey males uniquely exhibit a collective increase in social behaviors that is absent in other commonly studied lines and in females. Testing mixed-strain populations revealed that strain-specific differences in sensing other flies underlie the divergent group behaviors. Olfactory signaling through Or43a is necessary but not sufficient for Dahomey social sensitivity. Furthermore, specific single nucleotide polymorphisms (SNPs) in Or43a are associated with the social phenotype. These results demonstrate that social sensitivity is a sexually dimorphic, olfaction-dependent group behavior. Our studies reveal insights on the mechanisms that drive behavioral responses to social enrichment, and demonstrate how divergent strategies for regulating social behavior may evolve within a species.

Introduction

Social interactions—ranging from brief encounters to more sustained social behaviors—are observed across diverse species, from bacteria to humans. These interactions can substantially influence physiology and behavior. Negative social interactions are associated with poor health and shortened life^1,2, highlighting the importance of understanding the molecular mechanisms that regulate social behaviors. Fruit flies (Drosophila melanogaster) display diverse social interactions and, coupled with the available genetic tools, provide a powerful model system for identifying the social cues and signaling pathways that drive behavior³.

In addition to courtship, flies exhibit collective behaviors such as movement, aggregation, and aggression that are modulated by group size, density, and sex^4,5. Chronic isolation has been suggested to increase spontaneous locomotor activity, reduce sleep, and trigger hyperphagia^6,7,8, while chronic social grouping suppresses male-male aggression⁹. Previous studies have implicated the role of various sensory modalities in fly social interactions, including vision, touch, taste, and, in many cases, olfaction^{6,7,8,9,10,11,12,13,14}. Identifying the strategies that animals use to modulate social interactions, including the specific signals and sensory neurons that detect these cues to drive behavior, is crucial for understanding how social experience affects physiology and behavior.

Here, we identify a Drosophila strain- and sex-dependent group behavior. Dahomey males uniquely exhibit group hyperactivity that is acutely triggered by social environment and inhibited by light. Males of other commonly studied lines, including w¹¹¹⁸ and Canton-S, do not show group hyperactivity. Strain-specific differences in sensing other flies, rather than in the generation of signals such as pheromones, likely underlie the divergent group behaviors. Using locomotor activity as a readout for social interactions, we found that manipulations that decrease or ablate olfaction—through surgical removal of olfactory organs, silencing of olfactory neurons, or mutations in odorant receptor co-receptor (Orco)—decrease Dahomey social sensitivity. Screening of odorant receptor (OR) genes revealed that Or43a expression, as well as signaling through Or43a⁺ neurons, contribute to the Dahomey social phenotype. Additional evidence suggests that strain-specific SNPs in the Or43a gene modulate the response to social housing. These results highlight the importance of olfactory chemoreception in regulating social sensitivity and suggest that natural genetic variation in Or43a contributes to divergent social strategies within a species.

Results

Dahomey males show robust social behaviors and nighttime group hyperactivity

Canton-S, w¹¹¹⁸, and Dahomey are lines commonly used as background controls or parental strains in Drosophila studies. As a proxy for quantifying social interactions, solo- and group-housed flies were monitored in the Locomotor Activity Monitoring (LAM) system, which counts how often flies breach a planar array of infrared beams that bisect the chamber (Fig. 1A). At most time points, group housing suppressed the per fly activity of w¹¹¹⁸ and Canton-S males (Fig. 1B, C). This inhibition of activity is consistent with previous studies showing that flies in groups decrease their movement to prevent aggressive contacts¹⁵. In contrast, group-housed Dahomey males showed robust hyperactivity, particularly during the 12-hour dark period (Fig. 1D).

**Fig. 1: Group housing induces hyperactivity in Dahomey males.**

We next asked whether females share the same trait. To rule out an impact from male pheromones that are transferred to the female during mating, we quantified virgin female behavior. Dahomey virgin females behaved similarly to w¹¹¹⁸ and Canton-S virgins, showing no signs of group hyperactivity (Fig. 1E–G). These findings suggest that social sensitivity to group housing is a sexually dimorphic phenotype in Dahomey flies.

Group hyperactivity in Dahomey males was acutely inhibited by light, and flies in constant darkness maintained increased but rhythmic activity per fly (Fig. 1H, I). Introducing the white (w) mutation did not affect the parental phenotype (i.e., wDahomey shows group hyperactivity; wCanton-S does not), enabling the use of other transgenic lines in white-eyed Dahomey or Canton-S backgrounds (Supplementary Fig. 1).

To characterize the nature of the hyperactivity observed in Dahomey group-housed flies, males were monitored by infrared cameras in transparent vials at night. We confirmed that grouped Dahomey males are more active and observed movement around the food source (Supplementary Movie 1). To minimize the possibility that Dahomey males were fighting over the food source, we adjusted the housing conditions to include a pair of flies and two food sources at either end of a narrow chamber (Supplementary Fig. 2A). Under these conditions, pair-housed Dahomey males showed a synergistic increase in activity compared to solo-housed flies, while hyperactivity was not observed in pair-housed Canton-S males (Supplementary Fig. 2B).

Using infrared videography, we observed that the increased activity in paired Dahomey compared with paired Canton-S was closely associated with increased touching behaviors, which included mostly touch-and-run actions (Supplementary Fig. 2C, D). Increased chasing behavior was also observed in pair-housed Dahomey (Supplementary Fig. 2E). The distance between Dahomey males fluctuated frequently due to their increased overall movement (Supplementary Fig. 2F). These studies support the idea that hyperactivity measured through beam breaks serves as an increased throughput method for estimating social interactions and testing mechanisms that drive social sensitivity.

Differences in sensing or responding to other flies, rather than the release of signals, mediate nighttime group hyperactivity

Flies generate diverse signals—including visual, auditory, and molecular cues—that other flies detect to recognize their presence and engage in social interactions. To determine whether Dahomey sensitivity to group housing is due to differences in signal sensation or release, we recorded videos of flies in mixed-strain groups during the night. Nine Canton-S or Dahomey ‘helper’ flies were grouped with a single test fly, whose activity was scored by counting the number of times that the test fly crossed the midline of the chamber (Fig. 2A). As expected in the positive control, Dahomey test flies exhibited increased activity when housed with other Dahomey (Fig. 2B). Co-housing with Canton-S helpers also elicited hyperactivity in Dahomey test flies (Fig. 2C). In contrast, Canton-S test flies showed decreased activity when co-housed with Dahomey helpers (Fig. 2D), consistent with the prior result observed with group-housed Canton-S (Fig. 1C). Thus, nighttime group hyperactivity is due to differences in the response to the presence of other flies, rather than varying levels or types of signals released by a specific strain. These results suggest that differences in sensory reception or signaling, rather than altered signal generation or release, between Canton-S and Dahomey are the determining factor for their social sensitivity.

**Fig. 2: Strain differences in sensing other flies, rather than in the generation of signals, mediates group hyperactivity.**

Since Dahomey males can respond to the presence of either Dahomey or Canton-S males, we investigated whether Dahomey females might also respond to being grouped with males. We used Canton-S males as the ‘helper’ flies since Canton-S does not exhibit nighttime group hyperactivity that might indirectly impact female behavior. The results showed that neither Canton-S nor Dahomey female test flies exhibit significantly increased nighttime activity when co-housed with males (Mann Whitney U test: p = 0.4, r = 0.2, Canton-S; p = 0.3, r = 0.2, Dahomey), confirming the sexually dimorphic responses to group housing in Dahomey (Supplementary Fig. 3).

Olfaction is essential for nighttime group hyperactivity in Dahomey

In most insects, including Drosophila, antennae are the primary sensory organs for detecting olfactory chemosignals¹⁶. To test whether olfaction contributes to Dahomey group hyperactivity, we surgically removed these organs. Antennae-ablated Dahomey did not show nighttime group hyperactivity (Fig. 3A, B). In contrast, removal of the maxillary palps—a secondary olfactory appendage containing approximately 10-fold fewer olfactory sensory neurons (OSNs) than the antennae¹⁷—did not disrupt this behavior (Fig. 3C, D). These findings suggest that antennae-mediated olfaction plays a critical role in Dahomey group activity. However, it is important to note that Drosophila antennae are also involved in other sensory modalities, including mechanosensation¹⁸ and thermosensation¹⁹.

**Fig. 3: Olfaction is required for group hyperactivity in Dahomey.**

OSNs include neurons that express odorant receptors (ORs) and ionotropic receptors, both of which are used for specific odor detection²⁰. Among these, the broadly expressed ORCO (also known as OR83b) is highly conserved across insect species and is required for the function of other ORs²¹. To further test the necessity of olfaction in group hyperactivity, we introduced Orco mutations (i.e., Orco1 and Orco2) into the wDahomey background (Dahomey bearing a white gene mutation). Singly housed Orco mutants displayed increased locomotor activity compared to solo-housed controls (Fig. 3E–G). To account for intrinsic differences in baseline activity between genotypes and to isolate the effect of social environment, we quantified the impact of group housing as the ratio of daytime (or nighttime) activity per fly in groups to that of singly housed flies during the same period (Group/Solo). This analysis revealed that Orco mutations significantly diminished the synergistic increase in activity observed with group housing in Dahomey (ANOVA-Kruskal Wallis: p = 2.4 × 10⁻¹³; Post-hoc test-Dunn’s: p1 = 1.1 × 10⁻¹¹, p2 = 1.8 × 10⁻¹¹; Fig. 3H). Since the Orco1 mutant exhibited a lower baseline group activity (Fig. 3F), it was selected for subsequent genetic rescue experiments.

To test if nighttime group hyperactivity could be restored in mutant flies, we first re-expressed exogenous ORCO in Orco1 flies using the GAL4/UAS binary system²¹. Compared to Dahomey, controls harboring the Orco1 mutation in the Dahomey background, with only one of the GAL4/UAS transgenic elements, did not exhibit robust nighttime group hyperactivity (Fig. 4A–D, F). Orco-rescued flies, harboring both the GAL4 and UAS transgenes, displayed ~6-fold greater nighttime activity in the group-housed condition compared to being housed individually, demonstrating a partial rescue of the phenotype when comparing with Dahomey and the non-rescue controls (Fig. 4E, F). Importantly, the rescue line showed no increase in Group/Solo activity during the day, compared to the non-rescue controls (Fig. 4F).

**Fig. 4: Rescue of group hyperactivity in *Orco* mutants.**

We next tested whether rescue of the Orco1 mutant with an Orco transgene could also restore nighttime group hyperactivity. The Orco-sGFP construct contains an intact Orco gene sequence tagged with superfolder-GFP²². GFP fluorescence was detected in the antennae of Orco1 mutants carrying the Orco-sGFP transgene (Fig. 4G), confirming successful expression. ORCO-sGFP expression in Orco1 mutants partially rescued nighttime group hyperactivity, without affecting Group/Solo activity during the day (Fig. 4H–K). The extent of behavioral rescue was less pronounced than that observed using the GAL4/UAS system, likely because a single copy of Orco-sGFP does not fully restore olfactory function, whereas the GAL4/UAS system enables higher levels of transgene expression via GAL4-mediated transcriptional activation. Notably, flies homozygous for Orco-sGFP were non-viable and could not be assessed, consistent with previous findings that some sGFP-tagged proteins can cause lethality²².

Orco ⁺ and Or43a ⁺ neurons contribute to nighttime group hyperactivity in Dahomey

In addition to the broadly expressed Orco in antennae, ORs are expressed in specific Orco⁺ neurons²³. In Drosophila, the detection of odorants depends on heterodimers consisting of ubiquitously expressed Orco and an odorant receptor neuron (ORN)-specific OR²⁴. ORNs project to the central brain to form different glomeruli, establishing connections between odorant signals and the brain²³. To verify if Orco⁺ neurons are necessary for group hyperactivity, we silenced Orco⁺ neurons in a Dahomey background (Fig. 5A). Tetanus toxin (TNT) cleaves Synaptobrevin (Syb) in synaptic vesicles, leading to the blockade of neurotransmission²⁵. Expressing TNT in Orco⁺ neurons eliminated nighttime group hyperactivity in Dahomey without decreasing daytime changes in Group/Solo activity (Fig. 5B–D). Expression of Kir2.1 induces hyperpolarization of Orco neurons, leading to similar results (Fig. 5E–H), suggesting that Orco⁺ neurons gatekeep chemosignal-induced nighttime group hyperactivity. Expressing the proapoptotic gene Reaper also effectively inhibited nighttime group hyperactivity by promoting cell death of Orco⁺ neurons (Fig. 5I–L).

**Fig. 5: Silencing of *Orco*⁺ neurons inhibits group hyperactivity in Dahomey.**

To identify specific Or-X⁺ neurons that affect nighttime group hyperactivity, we screened 20 antennal ORN GAL4 drivers in a Dahomey background using Reaper, Kir2.1, and TNT. Inhibition of Or43a⁺ neurons consistently decreased nighttime group hyperactivity without affecting daytime Group/Solo activity ratios (Fig. 6 & Supplementary Table 1). To test if olfactory signaling through Or43a⁺ neurons is sufficient to mediate nighttime group hyperactivity, we expressed ORCO in Or43a⁺ neurons in the Orco1 mutant using the GAL4/UAS system. Restoring ORCO only in Or43a⁺ neurons did not rescue nighttime group hyperactivity in the Orco mutant (Supplementary Fig. 4), implying that additional, functional ORNs are required.

**Fig. 6: Silencing of *Or43a*⁺ neurons decreases group hyperactivity in Dahomey flies.**

Dahomey nighttime group hyperactivity may not be mediated by canonical pheromones

Given the prominent role of olfaction in Dahomey nighttime group hyperactivity, it is possible that volatile chemosignals drive social behavior. In Drosophila, cis-vaccenyl acetate (cVA) is a volatile pheromone synthesized exclusively in males and transferred to females during copulation, yet it modulates a range of behaviors in both sexes²⁶, as well as male-male aggresion²⁷ and social group interactions¹¹. This volatile pheromone can be perceived over long distances²⁸. However, the physical separation of a single fly from a stimulus source (10 flies) without blocking airflow (Supplementary Fig. 5A) did not induce robust nighttime hyperactivity (Supplementary Fig. 5B). This implies that the olfactory cues from group-housed Dahomey might function within a short range between flies, or that additional cues are necessary to drive activity.

In contrast to cVA, cuticular hydrocarbons (CHs) are deposited as a thin layer on the cuticle, and only a few are known to be slightly volatile²⁹. CHs are synthesized by specialized cells known as oenocytes³⁰ and are an important class of olfactory and gustatory chemosignals that mediate social interactions^31,32. CHs have complex effects on social communication due to characteristics such as composition, chain length, and abundance^33,34. To investigate whether CHs induce group hyperactivity, we genetically disrupted the synthesis of CHs in vivo. The Desalt1 driver expresses GAL4 in both oenocytes and the male ejaculatory bulb (Supplementary Fig. 6A), in which CHs and cVA are synthesized, respectively. Ablating larval- or pupal-stage oenocytes arrests development and causes lethality. However, expressing Reaper or Hid in adults can promote the apoptosis of oenocytes without affecting cVA synthesis^30,35. We used the temperature-sensitive GAL4 inhibitor, tub-GAL80^ts, in combination with Desalt1 > Reaper flies to bypass developmental lethality, as previously described³⁰ (Supplementary Fig. 6B). Dahomey flies in which oenocytes were ablated in adulthood still exhibited robust nighttime group hyperactivity (Supplementary Fig. 6C–E), implying that nighttime group hyperactivity is not mediated by CHs.

Genetic variation in Or43a contributes to nighttime group hyperactivity

The cumulative results support the idea that signaling through Or43a⁺ neurons is necessary but not sufficient for robust Dahomey nighttime group hyperactivity. We next tested whether the OR43a receptor mediates the phenotype by testing CRIMIC insertions of Or43a, where the SA-T2-GAL4-Poly(A) cassette is inserted in the first intron of Or43a³⁶. This cassette not only arrests Or43a transcription using SA-Poly(A) but also expresses a GAL4 driver under the Or43a promoter. Through 10 generations of outcrossing, the genetic background of Or43a^CR60034 was replaced with wDahomey. Or43a^CR60034 successfully drove RedStinger expression in antennal neurons (Fig. 7A), implying that the cassette functions as intended. Similar to the inhibition of Orco⁺ or Or43a⁺ neuronal signaling, the CR60034 insertion generally increased the baseline activity of solo-housed flies (Fig. 7B, C). Compared to wDahomey, Or43a loss-of-function significantly decreased the synergistic effect of group-housing on nighttime activity (Mann Whitney U test: p = 4.6 × 10⁻⁶, r = −0.9), suggesting that the receptor at least partially contributes to the phenotype (Fig. 7D).

**Fig. 7: Natural variation in *Or43a* is involved in the regulation of group activity in flies.**

Since the Orco and Or43a genes are important for regulating nighttime group hyperactivity, we sequenced these two gene regions in Canton-S and Dahomey (Supplementary Data 1). Orco was found to be highly conserved, with 1 silent mutation in the protein-coding region of the two strains. However, 11 SNPs were identified in Or43a between Canton-S and Dahomey. To ask whether genetic variation in the Or43a gene might contribute to group hyperactivity, we took advantage of the Drosophila Genetic Reference Panel (DGRP), a collection of ~200 inbred fly strains used for genome-wide association studies^37,38. Interestingly, 5 out of the 11 Or43a SNPs between Canton-S and Dahomey are well represented in the DGRP. We quantified nighttime activity in solo- and group-housed flies from 135 lines in the DGRP collection (Supplementary Table 2). By grouping the results based on whether the Dahomey Or43a allele is present, we found that 2 of the 5 Canton-S/Dahomey SNPs are significantly associated with greater nighttime group hyperactivity (Mann Whitney U test: p_A688G = 0.049, r = 0.21; p_C691T = 0.036, r = 0.22; Fig. 7E). In comparison, the single Orco SNP that differs between Canton-S and Dahomey is also represented in the DGRP, and does not show a significant difference in nighttime group hyperactivity between alleles (Mann Whitney U test: p_T2343G = 0.94, r = −0.010; Fig. 7E). We also categorized the DGRP results based on the number of Dahomey Or43a alleles present, from 0 (most Canton-S-like) to 5 (most Dahomey-like). These results showed a significant correlation between the number of Dahomey-specific Or43a alleles present and the level of nighttime group hyperactivity (Fig. 7F), supporting the idea that natural genetic variation within this gene contributes to behavioral responses to social environment.

OR43a is known to respond to cyclic molecules with a polar group, including benzaldehyde, benzyl alcohol, cyclohexanol, and cyclohexanone^39,40. Two previous studies have used the DGRP collection to assess olfactory behavioral responses to benzaldehyde^41,42. Using their behavioral results for each DGRP line, we found no significant correlation between benzaldehyde-mediated responses and our measurements of nighttime Group/Solo activity (Spearman r = −0.038, p = 0.68, N = 122 pairs; and Spearman r = 0.12, p = 0.18, N = 135 pairs). This lack of correlation is perhaps unsurprising, given that multiple receptors are known to detect benzaldehyde⁴³. Nonetheless, previous studies have also identified Or43a polymorphisms that are significantly associated with variation in olfactory behavioral responses⁴⁴. When we categorized our DGRP behavioral data according to the Or43a SNPs previously linked to olfactory behavioral variation, we found that these SNPs exhibit significantly greater differences in nighttime Group/Solo activity between alleles compared to SNPs without such associations (Mann Whitney U test: p = 7.7 × 10^-4, r = 0.03; Fig. 7G).

Discussion

Dahomey males exhibit a collective increase in social interactions when group housed, contrasting with other tested parental D. melanogaster strains. Spontaneous locomotor activity, at least in individually housed animals, is suggested to partially reflect an internal state that influences courtship, aggression, and sleep⁶. This is consistent with our quantification of group hyperactivity as a readout for social behavior. Increased activity in grouped Dahomey is primarily composed of touching and chasing. The interactions did not appear to be male-male courtship since canonical courtship behaviors such as wing vibrations were not observed. However, future work might better define the specific social interactions that are occurring among male Dahomey through higher resolution videography and machine learning methods for recognizing patterns of social behavior⁴⁵.

Social isolation or enrichment profoundly affects animal behavior. In flies, changes in sleep caused by social experience—either sleep loss after isolation or increased sleep after social enrichment—have been found to depend on different sensory modalities: some studies report a reliance on vision and olfaction⁷; while others suggest a dependence on gustation, but not vision or olfaction⁶. It is unclear whether experimental differences underlie these potentially conflicting results. While these studies examined the consequences after periods of social experience, our work identifies genes and sensory mechanisms that regulate behaviors during social enrichment that might be causal to subsequent phenotypes. The sensory systems that directly modulate social interactions might differ from the systems required for experienced-based effects on subsequent behaviors. Regardless, our results also suggest that increased activity during group housing—which presumably coincides with a loss of sleep—might contribute to the effects following social enrichment that others have observed^6,7.

Differences in olfactory chemosensation, rather than the generation of chemosignals, are likely responsible for the divergent responses to group housing in Dahomey males. Sexually dimorphic olfaction might also play a role in the sex dependence of social sensitivity in Dahomey. The fruitless gene is responsible for establishing many brain sex differences in Drosophila and a mosaic analysis of fru-expressing neurons has shown that sexually dimorphic clones are particularly enriched among olfactory neurons compared to other sensory neuron populations⁴⁶. Furthermore, male-specific growth of certain glomeruli within the Drosophila olfactory bulb can be suppressed by ectopic expression of the female-type transformer gene in males, providing direct evidence for glomerular sexual dimorphisms⁴⁷. It may be valuable to explore potential sex differences in Or43a expression or signaling, as this may further elucidate the molecular and cellular mechanisms underlying sexually dimorphic social behaviors in Drosophila.

Our behavioral analyses primarily evaluated the influence of the social environment by determining the ratio of per-fly activity between group- versus solo-housed conditions. We avoided direct comparisons of group-housed activity across genotypes, as such analyses could be confounded by intrinsic differences in individual baseline activity. Increased social sensitivity is expected to produce a synergistic, rather than merely additive, increase in group activity—regardless of inherent activity differences in individuals across genotypes.

Nonetheless, consistent behavioral differences between genotypes were also observed under solo-housed conditions. Inhibition of olfaction—by using Orco or Or43a mutants, silencing of Orco⁺ or Or43a⁺ neurons, or surgical removal of the antennae—resulted in increased activity in solo-housed flies. These olfactory-deficient manipulations also rendered the activity profiles of both solo- and group-housed flies to more closely resemble those of the Canton-S strain. This observation suggests that Canton-S may possess weaker olfactory sensitivity, and that the behavioral differences observed in Dahomey—including strain-specific differences in solo-housed activity—might be attributable to enhanced olfactory function or differences in basal olfactory neuron signaling. Future studies could test these hypotheses using Ca²⁺ imaging or electrophysiological recordings of olfactory neurons.

These observations also align with previous reports that chronic social isolation reduces individual sleep⁸. In ants, knockout of Orco impairs individual fitness within social groups⁴⁸, suggesting that inhibition of Orco signaling may mimic the behavioral effects of chronic isolation. In contrast, disruption of CH synthesis or antennal removal did not increase solo-housed activity, possibly because social experience was acquired prior to the induced genetic ablation of oenocytes or surgical removal of antennae.

Although Or43a contributes to social sensitivity, other ORs might also be needed since ORCO re-expression in Or43a⁺ neurons in an Orco mutant background was not sufficient to rescue Dahomey group hyperactivity. Our studies did not identify the specific olfactory chemosignals that are important for driving Dahomey male social interactions, but typically studied pheromones such as CHs and cVA did not appear to be responsible. Although our results do not conclusively rule out these compounds, they are consistent with what is known about the OR43a receptor, which recognizes cyclic molecules with a polar group³⁹ or possibly indoles⁴⁰, rather than CHs and cVA. Future studies might examine whether OR43a ligands applied exogenously affect fly locomotor or social behaviors.

Why might strain differences in social behavior only be evident during the dark period? In mammals and insects, sensitivity to olfactory cues can be directly under circadian regulation^49,50,51. The ethological relevance is unclear, but the observed variation between strains suggests that nighttime group behavior is a trait subject to genetic and environmental influences. Potential benefits for increased nighttime activity—including social synchronization to modulate sleep/activity cycles, avoidance of predation, or increased mating opportunities—may underlie natural selection for this behavior. Consistent with this idea, we find that Or43a SNPs that contribute to variation in olfactory behavioral responses also play a role in modulating nighttime group social behavior.

Although it is unclear whether specific Or43a alleles are directly functional or causal for the observed behavioral phenotypes, our analysis of the 26 Or43a SNPs present in the DGRP revealed that only 2 SNPs show a statistically significant effect between alleles—and they are both present in Dahomey and absent in Canton-S. While these two SNPs are in exons, they result in silent mutations. Nonetheless, synonymous mutations can influence phenotypes through mechanisms such as altered mRNA stability, splicing, or translation efficiency⁵². Furthermore, these two Or43a SNPs belong to a broader set of variants previously associated with variation in olfactory behavioral responses⁴⁴—and we find that this set of SNPs also modulates nighttime group activity (Fig. 7G). Our studies thus potentially reveal functional Or43a alleles that drive the Dahomey behavioral phenotype, as well as additional SNPs—beyond those specific to Dahomey—that also contribute to the regulation of social behavior. Future studies might employ CRISPR-mediated mutations to test whether specific alleles are sufficient to induce group hyperactivity in a Canton-S background or suppress this phenotype in Dahomey. Elucidating the genetic and neuronal mechanisms underlying Drosophila group behaviors will enhance our understanding of how perception and processing of environmental signals shape social interactions.

Materials & Methods

Drosophila strains and rearing

Orco1 (#23129), Orco2 (#23130), UAS-Orco (#23145), Orco-GAL4 (#26818), CRIMIC_Or43a_TG4.1 (#94381), UAS-RedStinger (#8547), Or43a-GAL4 (#9974), Desat1-GAL4 (#65405), and the DGRP lines were obtained from the Bloomington Drosophila Stock Center. Orco-sGFP (v318654) was from the Vienna Drosophila Resource Center. All lines have been backcrossed into the indicated line (wDahomey or wCanton-S) for at least 10 generations. Flies were reared at 25 °C in a 12-/12-hour light/dark (day/night) cycle. Flies with tub-GAL80^ts insertions were raised at 18 °C during larval and pupal development to inhibit GAL4 expression. Flies were typically collected up to 2 days post-eclosion, maintained in mixed sex groups for 24 h, and then sorted under light CO₂ anesthesia and maintained as single sex populations until used for behavioral studies. Virgin females were collected within 4–6 h of eclosion.

Activity measurement

The Locomotor Activity Monitor LAM25H (TriKinetics, Princeton, MA) was used to measure the activity of vial-housed flies. Flies (approximately 7-days post-eclosion) were randomly allocated into the indicated condition—typically 1 (Solo) or 10 (Group) flies per vial, unless otherwise stated. Vials were loaded into the LAM in alternating positions. Activity data were recorded as the number of beam breaks over time. Results from the group-housed condition were analyzed as the beam break counts per fly. Responses to group housing were expressed as a ratio of the 12 h daytime (or nighttime) activity per fly in groups divided by the average activity from singly housed flies over the same period. Raw data for each figure is provided as per fly beam breaks for the indicated time periods, parsed for solo and group-housed flies (Supplementary Data 2).

Videography

Flies were acclimated in transparent vials or arenas for several hours prior to lights off, and then recorded by infrared cameras, typically for 3 h starting at ZT 14 or 15. Supplementary Movie 1 shows 15 min of original video sped up by 32×. For results in Fig. 2, the wings of helper cohorts were clipped, to facilitate manual scoring of activity of the test fly. The activity shown in Fig. 2 was determined by the average number of times that the test fly crossed the midline of the chamber over 3 h. For results in Supplementary Fig. 2, the chasing action was counted when one male fly actively followed another male for more than 2 s; the touching or “touch-and-run” action was counted when one male contacted another male, or two males contacted each other without further chasing or fighting actions.

Fluorescent imaging

To detect the expression of GFP (or RedStinger) in antennae, flies were decapitated and their heads were secured onto glass slides. The GFP (or RedStinger) in antennal cells was imaged without fixation using a widefield EVOS fluorescence microscope under the GFP (or RFP) fluorescence channel. Images were taken with identical exposure times for comparison.

Genomic DNA extraction, plasmid construction and sequencing

Genomic DNA (gDNA) was extracted from a single adult fly (i.e., Dahomey or Canton-S). The fly was placed into a 1.5 mL microcentrifuge tube and was fully crushed using a sterile pipette tip in 50 µL squishing buffer (10 mM Tris-HCl pH 8.2, 1 mM EDTA, 25 mM NaCl, 200 µg/mL Proteinase K). The tube was incubated at 37 °C for 30 min and heat-inactivated at 95 °C for 2 min. The supernant containing gDNA was then collected after centrifugation.

PCR of the Orco and Or43a gene regions was performed using 2 µL of extracted gDNA as the template in 50 µL PCR reactions containing Orco primers or Or43a primers, and Phusion High-Fidelity PCR Master Mix (Thermo Fisher Scientific). Primer pairs used for both Canton-S and Dahomey: Orco-Forward: AGGACTAATCACAAATACGGAA; Orco-Reverse: AAGGGGCGGTAGGTGG; Or43a-Forward: TGCCACTTCCGTTTATAG; Or43a-Reverse: TTTTCGGTCTTTCAGCTC. PCR-amplified Orco and Or43a was confirmed by agarose gel electrophoresis. Cloning of Orco or Or43a gene regions into the pJET1.2/blunt vector was conducted using the CloneJET PCR Cloning Kit (Thermo Fisher Scientific).

Plasmid transformations were conducted using E. cloni 10 G competent cells (generated using the CaCl₂ method) under heat shock. Ampicillin served as the primary screen on the plate, followed by colony PCR to identify the Orco and Or43a insertions. Sequencing of plasmid inserts was performed using cloning and additional internal primers (Eurofins Scientific).

Statistical analysis

P values for multiple comparisons were determined by Dunn’s test with Bonferroni correction following one-way ANOVA (Kruskal-Wallis H-test), using the Scikit-posthocs package in Python. P values between two groups were determined by Mann-Whitney U test, and the effect size was measured by the rank-biserial correlation: r = 1 – (2 × U)/(N₁ × N₂), where U is the test statistic, N₁ and N₂ represent group sample sizes. |r | ≥ 0.5 corresponds to a large effect; the linear regression was conducted by using the SciPy.Stats package in Python. Spearman correlations were performed using GraphPad Prism from openly available DGRP phenotype data^41,42. For each Or43a SNP in the DGRP, we first averaged the Group/Solo activity results for each allele. To determine the impact of a given SNP on group sensitivity, we then calculated the ratio of these averages by dividing the larger allele mean by the smaller (max/min). When alleles had 2 or fewer representatives in the DGRP, the results from that SNP were not included in the analysis. SNPs were then categorized and compared based on a previous study that identified Or43a SNPs that contribute to variation in olfactory behavioral responses, including those at positions 597, 688, 691, 706, 1179, 1188, 1190, 1196, 1261, and 1942 (note that this numbering scheme differs from Rollmann et al. by 21 bp due to whether the first base is set at the start of transcription or the coding sequence)⁴⁴. To avoid pseudoreplication, when multiple SNPs were in complete linkage disequilibrium (i.e., had identical values), we retained only one representative SNP and censored the others. The 24 h activity curves and bar graphs were made with Python, and data shown are mean ± standard error of the mean (s.e.m.), typically with raw data overlaid.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

Data supporting the findings of this study are available within the paper and its Supplementary Information. Behavioral data from genetic screens are provided in Supplementary Tables 1 and 2. Orco and Or43a gene sequences, with alignments that illustrate sequence differences between the Canton-S and Dahomey strains, are provided in Supplementary Data 1. Sequences are also deposited at GenBank under accession numbers PX242175, PX242176, PX242177, and PX242178. Source data for figures are provided in Supplementary Data 2. Behavioral responses to benzaldehyde in the DGRP lines are documented in the original references and available at: https://doi.org/10.7554/eLife.88981.3⁵³.

References

Crowe, C. L. et al. Associations of Loneliness and Social Isolation With Health Span and Life Span in the U.S. Health and Retirement Study. J. Gerontology: Ser. A 76, 1997–2006 (2021).
Google Scholar
Razzoli, M. et al. Social stress shortens lifespan in mice. Aging Cell 17, e12778 (2018).
Article PubMed PubMed Central Google Scholar
Dankert, H., Wang, L., Hoopfer, E. D., Anderson, D. J. & Perona, P. Automated monitoring and analysis of social behavior in Drosophila. Nat. Methods 6, 297–303 (2009).
Article PubMed PubMed Central CAS Google Scholar
Rooke, R., Rasool, A., Schneider, J. & Levine, J. D. Drosophila melanogaster behaviour changes in different social environments based on group size and density. Commun. Biol. 3, 304 (2020).
Article PubMed PubMed Central Google Scholar
Chan, Y.-B. & Kravitz, E. A. Specific subgroups of Fru^M neurons control sexually dimorphic patterns of aggression in Drosophila melanogaster. Proc. Natl Acad. Sci. USA 104, 19577–19582 (2007).
Article PubMed PubMed Central CAS Google Scholar
Zhao, H. et al. A neural pathway for social modulation of spontaneous locomotor activity (SoMo-SLA) in Drosophila. Proc. Natl Acad. Sci. USA 121, e2314393121 (2024).
Article PubMed PubMed Central CAS Google Scholar
Ganguly-Fitzgerald, I., Donlea, J. & Shaw, P. J. Waking Experience Affects Sleep Need in Drosophila. Science 313, 1775–1781 (2006).
Article PubMed CAS Google Scholar
Li, W. et al. Chronic social isolation signals starvation and reduces sleep in Drosophila. Nature 597, 239–244 (2021).
Article PubMed PubMed Central CAS Google Scholar
Liu, W. et al. Social regulation of aggression by pheromonal activation of Or65a olfactory neurons in Drosophila. Nat. Neurosci. 14, 896–902 (2011).
Article PubMed CAS Google Scholar
Sethi, S. et al. Social Context Enhances Hormonal Modulation of Pheromone Detection in Drosophila. Curr. Biol. 29, 3887–3898.e4 (2019).
Article PubMed PubMed Central CAS Google Scholar
Bentzur, A. et al. Early Life Experience Shapes Male Behavior and Social Networks in Drosophila. Curr. Biol. 31, 486–501.e3 (2021).
Article PubMed CAS Google Scholar
Sokolowski, M. B. Social Interactions in “Simple” Model Systems. Neuron 65, 780–794 (2010).
Article PubMed CAS Google Scholar
Dahanukar, A. & Ray, A. Courtship, aggression and avoidance: Pheromones, receptors and neurons for social behaviors in Drosophila. Fly 5, 58–63 (2011).
Article PubMed CAS Google Scholar
Schneider, J., Dickinson, M. H. & Levine, J. D. Social structures depend on innate determinants and chemosensory processing in Drosophila. Proc. Natl Acad. Sci. USA 109, 17174–17179 (2012).
Article PubMed PubMed Central CAS Google Scholar
Panova, A. A. et al. Group rearing leads to long-term changes in locomotor activity of Drosophila males. OJAS 03, 31–35 (2013).
Article Google Scholar
Benton, R. Sensitivity and specificity in Drosophila pheromone perception. Trends Neurosci. 30, 512–519 (2007).
Article PubMed CAS Google Scholar
Hallem, E. A., Ho, M. G. & Carlson, J. R. The Molecular Basis of Odor Coding in the Drosophila Antenna. Cell 117, 965–979 (2004).
Article PubMed CAS Google Scholar
Patella, P. & Wilson, R. I. Functional Maps of Mechanosensory Features in the Drosophila Brain. Curr. Biol. 28, 1189–1203.e5 (2018).
Article PubMed PubMed Central CAS Google Scholar
Li, K. & Gong, Z. Feeling Hot and Cold: Thermal Sensation in Drosophila. Neurosci. Bull. 33, 317–322 (2017).
Article PubMed Google Scholar
Wicher, D. & Miazzi, F. Functional properties of insect olfactory receptors: ionotropic receptors and odorant receptors. Cell Tissue Res 383, 7–19 (2021).
Article PubMed PubMed Central CAS Google Scholar
Larsson, M. C. et al. Or83b Encodes a Broadly Expressed Odorant Receptor Essential for Drosophila Olfaction. Neuron 43, 703–714 (2004).
Article PubMed CAS Google Scholar
Sarov, M. et al. A genome-wide resource for the analysis of protein localisation in Drosophila. eLife 5, e12068 (2016).
Article PubMed PubMed Central Google Scholar
Fishilevich, E. & Vosshall, L. B. Genetic and Functional Subdivision of the Drosophila Antennal Lobe. Curr. Biol. 15, 1548–1553 (2005).
Article PubMed CAS Google Scholar
Kolesov, D. V. et al. Impacts of OrX and cAMP-insensitive Orco to the insect olfactory heteromer activity. Mol. Biol. Rep. 48, 4549–4561 (2021).
Article PubMed CAS Google Scholar
Sweeney, S. T., Broadie, K., Keane, J., Niemann, H. & O’Kane, C. J. Targeted expression of tetanus toxin light chain in Drosophila specifically eliminates synaptic transmission and causes behavioral defects. Neuron 14, 341–351 (1995).
Article PubMed CAS Google Scholar
Amrein, H. Pheromone perception and behavior in. Drosoph. Curr. Opin. Neurobiol. 14, 435–442 (2004).
Article CAS Google Scholar
Wang, L. & Anderson, D. J. Identification of an aggression-promoting pheromone and its receptor neurons in Drosophila. Nature 463, 227–231 (2010).
Article PubMed CAS Google Scholar
Everaerts, C., Farine, J.-P., Cobb, M. & Ferveur, J.-F. Drosophila Cuticular Hydrocarbons Revisited: Mating Status Alters Cuticular Profiles. PLoS ONE 5, e9607 (2010).
Article PubMed PubMed Central Google Scholar
Farine, J.-P., Ferveur, J.-F. & Everaerts, C. Volatile Drosophila Cuticular Pheromones Are Affected by Social but Not Sexual Experience. PLoS ONE 7, e40396 (2012).
Article PubMed PubMed Central CAS Google Scholar
Billeter, J.-C., Atallah, J., Krupp, J. J., Millar, J. G. & Levine, J. D. Specialized cells tag sexual and species identity in Drosophila melanogaster. Nature 461, 987–991 (2009).
Article PubMed CAS Google Scholar
Pask, G. M. et al. Specialized odorant receptors in social insects that detect cuticular hydrocarbon cues and candidate pheromones. Nat. Commun. 8, 297 (2017).
Article PubMed PubMed Central Google Scholar
Billeter, J.-C. & Wolfner, M. F. Chemical Cues that Guide Female Reproduction in Drosophila melanogaster. J. Chem. Ecol. 44, 750–769 (2018).
Article PubMed PubMed Central CAS Google Scholar
Wang, L. et al. Hierarchical chemosensory regulation of male-male social interactions in Drosophila. Nat. Neurosci. 14, 757–762 (2011).
Article PubMed PubMed Central CAS Google Scholar
Billeter, J.-C. & Levine, J. D. Who is he and what is he to you? Recognition in Drosophila melanogaster. Curr. Opin. Neurobiol. 23, 17–23 (2013).
Article PubMed CAS Google Scholar
Gutierrez, E., Wiggins, D., Fielding, B. & Gould, A. P. Specialized hepatocyte-like cells regulate Drosophila lipid metabolism. Nature 445, 275–280 (2007).
Article PubMed CAS Google Scholar
Lee, P.-T. et al. A gene-specific T2A-GAL4 library for Drosophila. eLife 7, e35574 (2018).
Article PubMed PubMed Central Google Scholar
Mackay, T. F. C. et al. The Drosophila melanogaster Genetic Reference Panel. Nature 482, 173–178 (2012).
Article PubMed PubMed Central CAS Google Scholar
Huang, W. et al. Natural variation in genome architecture among 205 Drosophila melanogaster Genetic Reference Panel lines. Genome Res 24, 1193–1208 (2014).
Article PubMed PubMed Central CAS Google Scholar
Störtkuhl, K. F. & Kettler, R. Functional analysis of an olfactory receptor in Drosophila melanogaster. Proc. Natl Acad. Sci. USA 98, 9381–9385 (2001).
Article PubMed PubMed Central Google Scholar
Wetzel, C. H. et al. Functional expression and characterization of a Drosophila odorant receptor in a heterologous cell system. Proc. Natl Acad. Sci. USA 98, 9377–9380 (2001).
Article PubMed PubMed Central CAS Google Scholar
Swarup, S., Huang, W., Mackay, T. F. C. & Anholt, R. R. H. Analysis of natural variation reveals neurogenetic networks for Drosophila olfactory behavior. Proc. Natl Acad. Sci. USA 110, 1017–1022 (2013).
Article PubMed CAS Google Scholar
Arya, G. H. et al. The Genetic Basis for Variation in Olfactory Behavior in Drosophila melanogaster. Chem. Senses 40, 233–243 (2015).
Article PubMed PubMed Central CAS Google Scholar
Hallem, E. A. & Carlson, J. R. Coding of Odors by a Receptor Repertoire. Cell 125, 143–160 (2006).
Article PubMed CAS Google Scholar
Rollmann, S. M. et al. Odorant Receptor Polymorphisms and Natural Variation in Olfactory Behavior in Drosophila melanogaster. Genetics 186, 687–697 (2010).
Article PubMed PubMed Central CAS Google Scholar
Robie, A. A., Seagraves, K. M., Egnor, S. E. R. & Branson, K. Machine vision methods for analyzing social interactions. J. Exp. Biol. 220, 25–34 (2017).
Article PubMed Google Scholar
Cachero, S., Ostrovsky, A. D., Yu, J. Y., Dickson, B. J. & Jefferis, G. S. X. E. Sexual Dimorphism in the Fly Brain. Curr. Biol. 20, 1589–1601 (2010).
Article PubMed PubMed Central CAS Google Scholar
Kondoh, Y., Kaneshiro, K. Y., Kimura, K. & Yamamoto, D. Evolution of sexual dimorphism in the olfactory brain of Hawaiian Drosophila. Proc. R. Soc. Lond. B 270, 1005–1013 (2003).
Article Google Scholar
Trible, W. et al. orco Mutagenesis Causes Loss of Antennal Lobe Glomeruli and Impaired Social Behavior in Ants. Cell 170, 727–735.e10 (2017).
Article PubMed PubMed Central CAS Google Scholar
Granados-Fuentes, D., Tseng, A. & Herzog, E. D. A Circadian Clock in the Olfactory Bulb Controls Olfactory Responsivity. J. Neurosci. 26, 12219–12225 (2006).
Article PubMed PubMed Central CAS Google Scholar
Merlin, C. et al. An Antennal Circadian Clock and Circadian Rhythms in Peripheral Pheromone Reception in the Moth Spodoptera littoralis. J. Biol. Rhythms 22, 502–514 (2007).
Article PubMed CAS Google Scholar
Krishnan, B., Dryer, S. E. & Hardin, P. E. Circadian rhythms in olfactory responses of Drosophila melanogaster. Nature 400, 375–378 (1999).
Article PubMed CAS Google Scholar
Sauna, Z. E. & Kimchi-Sarfaty, C. Understanding the contribution of synonymous mutations to human disease. Nat. Rev. Genet 12, 683–691 (2011).
Article PubMed CAS Google Scholar
Gardeux, V. et al. DGRPool, a web tool leveraging harmonized Drosophila Genetic Reference Panel phenotyping data for the study of complex traits. eLife 12, RP88981 (2024).
Article PubMed PubMed Central Google Scholar

Download references

Acknowledgements

We thank Dr. Scarlet Park for helpful comments on this manuscript. We also thank Diane Altidor, Paige Beckey, Jairus Riche, Ashley Stanisclasse, and Chenchen Su for technical assistance. This work was funded by the NIH (R01DC020031, W.W.J.).

Author information

Authors and Affiliations

Department of Neuroscience, The Herbert Wertheim UF Scripps Institute for Biomedical Innovation & Technology, Jupiter, FL, USA
Binbin Wu, Erin S. Keebaugh & William W. Ja

Authors

Binbin Wu
View author publications
Search author on:PubMed Google Scholar
Erin S. Keebaugh
View author publications
Search author on:PubMed Google Scholar
William W. Ja
View author publications
Search author on:PubMed Google Scholar

Contributions

Conceptualization, Methodology, Data collection, and Data Analysis: B.W., E.S.K., and W.W.J.; Supervision: W.W.J.; Writing—original draft: B.W.; Writing—review and editing: B.W., E.S.K., and W.W.J.

Corresponding author

Correspondence to William W. Ja.

Ethics declarations

Competing interests

The authors declare no competing interests.

Peer review

Peer review information

Communications Biology thanks Séverine Trannoy and the other, anonymous, reviewer for their contribution to the peer review of this work. Primary Handling Editors: Michele Repetto. A peer review file is available.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Transparent Peer Review file

Supplementary Information

Description of Additional Supplementary Files

Supplementary Data 1

Supplementary Data 2

Supplementary Movie 1

Reporting Summary

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

About this article

Cite this article

Wu, B., Keebaugh, E.S. & Ja, W.W. Chemosensation drives divergent social behavior in Drosophila. Commun Biol 8, 1521 (2025). https://doi.org/10.1038/s42003-025-08886-z

Download citation

Received: 13 December 2024
Accepted: 12 September 2025
Published: 04 November 2025
Version of record: 04 November 2025
DOI: https://doi.org/10.1038/s42003-025-08886-z