Introduction

Apple replant disease (ARD) occurs as a result of the activity of pathogenic microorganisms and nematodes that have accumulated in orchard soils and subsequently infect newly planted trees into these soils during orchard renovation. ARD is common in nearly all apple and other pome fruit growing regions of the world. Young apple trees affected by ARD have symptoms such as uneven growth, stunting, root necrosis, shortened internodes above ground, deformed leaves, reduced root biomass, and reduced yield compared with trees free of the disease1. In the past, pre-plant application of broad spectrum soil fumigants was employed effectively to control ARD around the world2. Traditional soil fumigants, such as methyl bromide, 1,3-dichloropropene and chloropicrin have a biologically broad spectrum of activity and thus eradicate pathogenic and non-pathogenic microorganisms indiscriminately. Safety and environmental concerns over methyl bromide led to international legislation and a ban on methyl bromide in 2005. The 1,3-dichloropropene and chloropicrin had been one of the main pre-plant soil fumigants used in Canada following the phase-out of methyl bromide. With the recent ban on the use of 1,3-dichloropropene and chloropicrin in Canada, ARD has re-emerged as a major threat to the successful re-establishment of apple orchards in Canada. Thus, there is an urgent need to develop alternative, more specific and sustainable approaches with reduced chemical inputs for control of this biologically complex disease. Potential alternative disease control methods include biofumigation, anaerobic soil disinfestation (ASD), incorporation of organic amendments, semi-selective agrochemicals, and immunization with antagonistic and beneficial microorganisms3,4,5. Understanding the of the specific etiology of ARD at a particular site is required to develop alternative, commercially viable soil management strategies to combat specific/individual components of the disease complex.

Various biotic factors such as an increased pathogen populations, a decline in beneficial microbes, dysbiosis of the soil microbial community and disrupted microbial network that reduces soil disease suppressiveness along with abiotic factors such as nutrient imbalance in the soil, toxic root exudates or microbial metabolites, poor drainage and soil compaction have all been associated with the decline in apple yield and quality in ARD-affected sites6,7,8. However most recent research suggests ARD is primarily caused by biotic factors as soil disinfection through pasteurization and fumigation with broad-spectrum chemical have significantly reduced the disease compared to untreated soils9,10,11,12,13. A number of studies have demonstrated that ARD is incited by an interacting complex of various fungal and oomycete pathogens, and plant parasitic nematodes14,15,16. The relative abundance of these entities and differences at the species level within any specific group often differ between sites within a geographic region17,18. Braun19,20 identified Pythium irregulare (Globisporangium irregulare) and Cylindrocarpon lucidum in combination as causal pathogens of ARD in five old apple orchard soils of the Annapolis Valley, Nova Scotia, Canada. In Europe, Cylindrocarpon like fungi (Ilyonectria spp. and Thelonectria sp.) were reported as major fungal pathogens contributing to ARD in Germany, Austria and Italy, while Pythium spp. were found as major ARD causal pathogens only in Germany21. In addition, several studies based on inoculation and isolation of fungi and oomycetes from symptomatic plants established the hypothesis that ARD is a complex of fungal (Cylindrocarpon/Nectria, Rhizoctonia) and oomycete (Pythium, Phytophthora) species3,22. In another study in South Africa, Van Schoor et al.17 isolated Cylindrocarpon, Pythium and Fusarium spp. from lesions in apple roots grown in six orchard soils, but the pathogenicity of these isolates was not confirmed in plant inoculations. These authors also assigned secondary roles to Rhizoctonia and plant parasitic nematodes Pratylenchus and Xiphinema spp. as causal agents of ARD. In Washington State, oomycetes such as Pythium spp. and Phytophthora cactorum along with fungal pathogens such as Rhizoctonia solani and Cylindrocarpon destructanans have consistently been isolated and identified as major causal agent of ARD13.

Several biotic factors—including fungal and oomycetes pathogens as well as lesion nematodes have been shown to be implicated in ARD17. However, the relative abundance, diversity, dominance and even the presence of these organisms can vary significantly across different geographical regions10,13,23. Reports on the involvement of these microbes causing ARD on their own, or in combination are inconsistent especially regarding the role of plant parasitic nematodes Pratylenchus penetrans3,6,24. The involvement of bacterial pathogens in ARD is debatable and is not well investigated when compared with fungi and oomycetes. However, bacteria belonging to Actinomycetes, Bacillus and Pseudomonas might also be a part of the disease complex25. Composition of the Pseudomonas spp. community was shown to vary significantly between soils that were suppressive or conducive to ARD26. Also, some species of Streptomyces have been reported to reduce the incidence of Rhizoctonia root rot infections in apple27.

Although fungal and oomycete pathogens have traditionally been associated with ARD, the conventional approach of isolating, identifying, and reinoculating these pathogens may have inadvertently downplayed the potential role of the broader soil microbial communities in development or suppression of ARD. It is now well established that the structure, diversity, and composition of soil microbial communities are critical to ecosystem functioning, soil health, and plant growth28,29. Advances in next-generation sequencing technologies have enabled comprehensive analysis of the entire microbiome present in soil samples, allowing us to better understand the full suite of microbial taxa involved in soil and plant health dynamics. However the composition and response of fungal, bacterial, oomycete and nematode communities involved in ARD have not yet been fully elucidated at ARD sites in Nova Scotia apple growing regions. Therefore the aims of the present study were to (i) compare the abundance and composition of the broader soil fungal, bacterial and oomycete communities across six ARD orchard sites in the Annapolis Valley of Nova Scotia; (ii) identify the relative abundance of potential fungal and/or oomycete pathogens associated with ARD in these soils, and (iii) further assess the contribution of plant parasitic nematodes at ARD sites in orchard soils. To achieve these objectives, we used Illumina Miseq deep sequencing approach by targeting ITS2 for fungi, V6-V8 region of 16 S rRNA for bacteria and ITS region for oomycetes on soil samples collected from six ARD sites. For nematode isolation and quantification in soil samples, we used wet sieving-sucrose centrifugation procedure followed by counting and identification to the genus level based on morphological characteristics.

Results

Orchard site characteristics

The physio-chemical properties of six orchard soils used in this study were characterized (Tables 1 and 2). In Nova Scotia apples are produced on soils with a relatively narrow range of soil textures that are generally sandy to coarse loamy (Table 2). In these soils, water retention and internal drainage (Table 2) can often be better correlated with silt plus clay content rather than clay alone. This is in contrast to some orchard soils that occur in other apple growing regions of the world. Based on plant bioassays conducted in the respective orchard soils (Table 2), five of the six soils were ranked as having the potential for severe ARD development with only one orchard soil (CAN), as likely experiencing a moderate level of disease severity (Table 2). The CAN site has been an orchard for the fewest number of years (Table 2), while the site with the highest potential for ARD severity (BER) has the longest history of apple production.

Table 1 Soil fertility parameters of six apple orchards in the Annapolis Valley of Nova scotia.
Full size table

Fungal and bacterial microbiome composition

ITS2 and 16 S rRNA (V6-V8 region) amplicon sequencing was performed to evaluate orchard soil fungal and bacterial communities, respectively. Taxonomic analysis revealed that Ascomycota had the highest relative abundance among fungal phyla in the orchard soils comprising 48% of all ITS2 reads identified in the study, followed by Zygomycota, (37%) and Basidiomycota (10%) (Fig. 1 right panel). Mortierellomycetes, Sordariomycetes, Leotiomycetes, Tremellomycetes, Dothideomycetes, Eurotiomycetes, and Agaricomycetes were the most abundant fungal classes found in the ITS2 derived soil microbiome and were represented by 37%, 29%, 11%, 6%, 6%, 4%, and 3% of total ITS2 rRNA reads, respectively (Fig. 1 right panel). Proteobacteria was the most prevalent phylum identified in orchard soils (38% of total 16 S rRNA reads) with two classes Alphaproteobacteria (19%) and Gammaproteobacteria (15%) having the highest relative abundance among bacterial taxa (Fig. 1 left panel). Bacteroidetes (Bacteroidia) was the third most relatively abundant class represented by 14% of total 16 S rRNA reads. Actinobacteria and Acidobacteria were also highly represented at 16% of total 16 S rRNA reads, each. Actinobacteria classes exhibiting the highest relative abundance included Thermoleophilia (8% of total 16 S rRNA reads) and Actinobacteria (6%), while Subgroup6 (6% ) and Acidobacteriia (5%) were present at the greatest relative abundance among Acidobacteria classes (Fig. 1 left panel).

Fig. 1
figure 1

Relative abundance of soil bacterial and fungal community structure across six Nova Scotia apple orchards. Bacterial (left panel) and fungal (right panel) annotated at class level and represented by at least 1% of total 16 S RNA and 0.1% of total ITS2 reads are shown. Orchard locations in the Annapolis Valley of Nova Scotia in Canada: ROE, Rockland East area; ROW, Rockland West area; CAN, Canard area; AYL, Aylesford area; KEN, Kentville area; BER, Berwick area.

Full size image

Variation of fungal and bacterial microbiome composition across apple replant orchard soils

The analysis of strength and statistical significance of sample groupings (Permutational Multivariate Analysis of Variance Using Distance Matrices (PERMANOVA) based on weighted unifrac beta-diversity distances with 999 permutations) indicated a significant variation in community composition across different ARD orchard soils (p value < 0.001). Approximately 55% of fungal variation and 54% of bacterial community variation were explained by the sampling site (orchard location) (data not shown). However, we did not detect a significant difference in fungal or bacterial community alpha-diversity among sites (p value > 0.05; data not shown). Redundancy Analysis (RDA) indicated that that soil paraments such as P205, K20, organic matter (OM) and pH, as well as disease severity had significant effects on both bacterial and fungal microbiome, although these effects were relatively minor. For the bacterial community OM and disease severity were the most influential factors, explaining 6% and 5% of community variation, respectively (Fig. S1). Similarly, approximately 6% of fungal community variation was explained by these factors.

Three fungal and three bacterial classes differed significantly in relative abundance between the six ARD orchard soils (Fig. S2). Eurotiomycetes and Saccharomycetes were overrepresented in KEN, while Spizellomycetes were overrepresented in ROE, compared with other locations (Fig. S2). Acidobacteriia were over-represented in BER and CAN orchards, while unidentified Latescibacteria were detected at the lowest relative abundance in ROE soil compared with other locations, and Bacilli were over represented in CAN compared with all other sites (Fig. S2).

At the genus level, we identified 12 fungal and eight bacterial taxa differentially represented between orchards. Fungal taxa Lasiosphaeris, two unidentified Eurotiomycetes (Chaetothyriales 1, Chaetothyriales 2 ), Cyberlindnera, and Paraconiothyrium were overrepresented in KEN soil (Fig. 2), while Peziza, Mariannaera and Matsushimamyces were more abundant in AYL (Fig. 2). For bacterial taxa, Acidothermus, Acidobacteria Subgroup 2, Chujaibacter and Bacillus were most abundant in CAN soil (Fig. 3).

Fig. 2
figure 2

Boxplots showing the differentially relative abundance of fungal taxa at class level across six Nova apple Scotia orchards. Based on ANCOM test with 1% FDR. Orchard locations in the Annapolis Valley of Nova Scotia, Canada: ROE; Rockland East area; ROW, Rockland West area; CAN, Canard area; AYL, Aylesford area; KEN, Kentville area; BER, Berwick area.

Full size image
Fig. 3
figure 3

Boxplots showing the differentially relative abundance of soil bacterial taxa at class level across six Nova Scotia apple orchards. Based on ANCOM test with 1% FDR. Orchard locations in the Annapolis Valley of Nova Scotia, Canada: ROE, Rockland East area; ROW, Rockland West area; CAN, Canard area; AYL, Aylesford area; KEN, Kentville area; BER, Berwick area.

Full size image

Core fungal and bacterial ASVs

We extended our analysis to identify core bacterial and fungal ASVs that were consistently found across communities from all six apple orchards and detected in at least 80% of all soil samples analyzed in this study. We identified 29 fungal and 15 bacterial ASVs, represented by 7% and 50% of total ITS2 and 16 S rRNA reads, respectively (Tables S1, S2). Mortierella exigua was the most abundant fungal ASV in the core microbiome, 9% of total ITS2 reads. A number of potential phytopathogenic/endophytic ASVs were a part of the core microbiome including Fusarium oxysporum (4%), Fusarium solani (1%), Nectria ramulariae (synonym Cylindrocarpon ehrenbergii) (0.5%) and Ilyonectria robusta (Cylindrocarpon-like asexual morphs) (1%), as well as Nectriaceae (0.4%). Bacterial ASVs within this group were affiliated with Acidobacteria (4 ASVs), Bacteroidetes (4 ASVs) and Proteobacteria (5 ASVs). The Xanthobacteraceae family and Pseudolabrys were the most abundant ASVs represented by 14% of total 16 S rRNA reads.

A total of 44 bacterial and 15 fungal families were found in at least 80% of the samples from each orchard (Tables 3 and 4). These families were represented by 74% and 73% of total ITS2 and 16 S rRNA reads, respectively. Core fungal families detected at high relative abundance included Mortierellaceae, Nectriaceae, Helotiaceae, Chaetomiaceae and Piskurozymaceae, represented by 36%, 12%, 5%, 5%, and 4% of total ITS2 reads, respectively (Table 4). Similarly, core bacterial families Chitinophagaceae, Xanthobacteraceae, Nitrosomonadaceae, Xanthomonadaceae, and Sphingomonadaceae had high relative abundances in the total bacterial microbiome and were represented by 10%, 8%, 5%, 4%, and 3% of total 16 S rRNA reads, respectively (Table 3).

Table 2 Soil physical properties and characteristics of six experimental apple orchards in the Annapolis Valley of Nova Scotia.
Full size table
Table 3 Core bacterial ASVs (family level) found in at least 80% in all soil samples collected in six Apple orchards located in the Annapolis Valley of Nova scotia.
Full size table
Table 4 Core fungal ASVs (family level) found in at least 80% of all soil samples collected in six Apple orchards located in the Annapolis Valley of Nova scotia.
Full size table

Composition of oomycetal microbiome

Pythium attrantheridium (Globisporangium attrantheridium), P. monospermum (Nematosporangium monospermum), and P. ultimum (Globisporangium ultimum) were the most abundant oomycetal taxa identified in the analysis. They were represented by 50%, 12% and 12% of total oomITS reads, respectively (Fig. 4). While the communities did not differ in Shannon diversity between the orchards (p value > 0.05; data not shown), location was a strong factor affecting oomycetal community structure. More than 60% (p value < 0.001) of the community variation was explained by sampling site (data not shown). This variation in community structure was reflected in the visual differences in the community profiles across the orchards (Fig. 4). P. attrantheridium, P. monospermum and P. ultimum exhibited the most pronounced apparent variation across location. P. attrantheridium is present across all six sites while P. monospermum and P. ultimum are over represented at only one site. This variation was attributed to significant difference in relative abundances of three ASVs, which uniquely represented these species (Fig. 5). ASV, annotated as P. ultimum, was predominantly found in ROE soils and was represented by around 75% of total ROE oomITS reads. ASVs, annotated as P. attrantheridium, was overrepresented in CAN, KEN and AYL soil and P. monospermum ASV was predominantly found in ROW soil, comprising more than 20% of total ROW oomITS reads (Fig. 5).

Fig. 4
figure 4

Relative abundance of soil oomycetes community structure across six Nova Scotia apple orchards. Oomycete annotated at lass level and represented by at least 1% of total ITS reads are shown. Orchard locations in the Annapolis Valley of Nova Scotia, Canada: ROE, Rockland East area; ROW, Rockland West area; CAN, Canard area; AYL, Aylesford area; KEN, Kentville area; BER, Berwick area. P. attrantheridium (Globisporangium attrantheridium), P. monospermum (Nematosporangium monospermum), P. ultimum (Globisporangium ultimum) and P. irregulare (Globisporangium irregulare).

Full size image
Fig. 5
figure 5

Boxplots showing the differentially relative abundance of soil oomycetes taxa at specie level across six Nova Scotia apple orchards.Based on ANCOM test with 1% FDR. Orchard locations in the Annapolis Valley of Nova Scotia, Canada: ROE, Rockland East area; ROW, Rockland West area; CAN, Canard area; AYL, Aylesford area; KEN, Kentville area; BER, Berwick area. P. ultimum (Globisporangium ultimum), P. attrantheridium (Globisporangium attrantheridium) and P. monospermum (Nematosporangium monospermum).

Full size image

Nematode analysis

Among the nematode communities extracted from orchard soils, six potential groups of plant parasitic nematodes were identified. from the orchard soils: Root-lesion (Pratylenchus spp.), dagger (Xiphinema spp.), ring (criconematidae), pin (paratylenchidae), spiral (hoplolaimidae) and root-knot (Meloidogyne spp.) (Table 5). Root-lesion nematodes were found at all six sites, at population densities ranging from 12 to 33 Pratylenchus/100 cm3 soil (Table 5). Dagger nematodes were found in five of the six sites and were recovered at relatively high population densities, e.g.>100 Xiphinema/100 cm3 soil, in two of the sites (Table 5). All dagger nematodes observed had morphological characteristics conforming to the X. americanum-complex of species.

Table 5 Population densities (nematodes/ 100 cm3 soil) of genera of plant-parasitic nematodes extracted from six Apple orchards in the Annapolis Valley of Nova scotia.
Full size table

Discussion

The etiology of ARD is challenging to elucidate as, unlike many other soilborne diseases, numerous causal agents have been isolated from affected sites in different parts of the world. ARD has been reported by many as a complex of different types of microbial pathogens and plant parasitic nematodes which can differ in their relative abundances between sites within a geographic region3,6,13,22,30. Some of the previous replant disease studies consider soil fertility and nutrient availability as major contributors to the disease31. But other studies have negated this hypothesis as fertilization, and an increase in soil nutrients was not able to eliminate ARD18,32. In this study, we measured several soil fertility parameters, such as OM, available P, K, and several other essential nutrients for plant growth at the six ARD sites. None of them were significantly correlated with the severity of ARD. However, there were no “Low” disease severity sites identified in this study, only sites with “Moderate” or “Severe” disease potential was identified. These results are in agreement with a study carried out in Bohai Gulf China by Gongshuai et al.32 as they also did not find any direct correlation between ARD severity and soil nutrient composition. Ad hoc field observations in the Nova Scotia apple industry suggest that summer drought stress can aggravate the severity of the disease. Similar observations have been made in New York State (Rosenberger, 2023 personal communication). However, no correlation was observed between probable ARD severity and soil chemical properties, as well as the physical soil parameters linked with potential moisture stress, such as soil texture, drainage class, and plant available moisture (Table 2). Although the soil properties didn’t influence the severity of the ARD, the longevity of the apple production likely affected it as demonstrated by the RDA analysis.This study provides evidence that ARD in Annapolis Valley is of biological origin as all apple growth parameters measured in pasteurized soil from all sites were markedly improved when compared with non-pasteurized soil in a greenhouse bioassay, a finding that is consistent with previous studies reporting ARD as being of a biological nature6,32,33.

Soil microbial communities and soil biodiversity play a crucial role in soil ecosystem functions and plant health by decomposition of dead organic materials, nutrient recycling, nutrient availability to plants, suppression of soilborne diseases and inducing plant disease resistance29,34,35. Having a soil with a wide variety of microorganisms help to create a more competitive environment that can inhibit the growth and invasion of harmful pathogens36. We detected considerable variation in soil bacterial and fungal community composition and structure across ARD orchard sites. More than 50% variation was observed in bacterial and fungal community composition across the orchard study sites. Also, although three bacterial and three fungal classes were differentially represented among the orchard soils, we did not observe any correlation between severity of ARD and fungal or bacterial alpha-diversity across the six orchard sites. This again could have resulted from the lack of a “Low” ARD potential orchard soil included in this study.

The soils of these six orchards exhibited a consistent core microbiome. The results showed that, Ascomycota, Zygomycota and Basidiomycota were the fungal phyla that were most identified at the ARD sites that accounted for 95% of the total ITS2 reads. Ascomycota was revealed as the most dominant phylum present in ARD sites tested in this study. This finding is similar to previous studies that also reported Ascomycota as the most dominant phylum in ARD sites24,32. The class Mortierellomycetes exhibited the greatest relative abundance in the ITS2 microbiome. Species of Mortierella have been reported as saprophytes and some of them belong to the plant growh-promoting fungi. I another study abundance of Mortierella spp. has been reported in healthy banana soil38. In apple orchards, some studies have indicated that Mortierella spp. have a mutualistic relationship with apple tree and have been associated negatively with the severity of ARD32 and are positively related with plant growth24. In another study by Soman et al. 1999 39reported three metabolites from Mortetierella vinacea with antifungal and antibacterial activity suggesting an important role for this fungus in suppressing soil-borne pathogens associated with ARD.

Fusarium oxysporum and Fusarium solani were the most relatively abundant core ASV in this study. Fusarium is a large genus that contains saprophytes, endophytes, and plant and animal pathogens. In soil, Fusarium is often associated with plant debris and most species are saprophytic and relatively abundant in the soil microbial community. Kelderer et al.22 reported that F. solani and F. oxysporum were the most frequently isolated species followed by Cylindrocarpon spp. binucleate Rhizoctonia spp. and Fusarium spp. from apple replant orchards soil in Italy. No pathogenicity assays were performed for Fusarium spp. in their study as Fusarium spp. were considered to be non-pathogenic on apple22. Several species of the genus Fusarium also produce bioactive secondary metabolites that mediate positive interaction with host plants40,41. Both F. solani and F. oxysporum are considered endophytes as they are usually isolated from asymptomatic root tissue with high abundance, not only from apple tree but several other crops3,13,18,23,42,43. In an orchard field study, Fusarium spp. were recovered at a greater frequency from the roots of apple trees grown in methyl bromide fumigated soils than the roots of apple trees cultivated in non-treated ARD soil at the same site13. However, more than 20 species of the genus Fusarium are pathogens of higher plants causing root rot, vascular wilt, and storage rot44. Fusarium is often isolated from both diseased and healthy apple tree roots, but most isolates representing several species did not prove to be pathogenic on apples13,45. Tewoldemedhin et al. (2011)3 frequently isolated Fusarium from all orchards in the study, but most proved to be non-pathogenic towards apple seedlings and only two of the isolates (F. avenaceum and F. solani) were only weakly virulent on apple seedlings. Other studies have shown that F. solani was either non-pathogenic, or had low virulence towards apple seedlings13,18. We also detected several other fungal genera in this study, such as Ilyonectria, Nectria and Nectriaceae, which fall into the group that is traditionally called Cylindrocarpon-like fungi46. These genera are reportedly negatively involved in apple growth20,24,47. Our findings are in agreement with these previous studies in identifying Cylindrocarpon as a causal agent of ARD Braun20.

Pythium spp. have long been reported on a global basis as contributing pathogen to ARD. However, numerous of studies have demonstrated that the species of Pythium that is contributing to the disease varies across orchards with a single dominant species commonly encountered at any specific orchard site48. In this study, P. attrantheridium (Globisporangium attrantheridium), P. monospermum (Nematosporangium monospermum) and P. ultimum Globisporangium ultimum) were the most relatively abundant oomycetal taxa, and P. attrantheridium, and P. irregulare (Globisporangium irregulare) are present at all ARD sites analyzed in this study. A previous study reported Pythium irregulare as one the main causal pathogens of ARD in the soil of five old orchards of the Annapolis Valley of Nova Scotia19,20.

Many bacterial families containing potential plant growth promotion taxa were part of the core microbiome. Some members of the family Chitinophagaceae, which demonstrated high relative abundance in orchard soils, have an ability to produce indole-3-acetic acid, solubilize phosphate, and possess ACC deaminase activity. Each of these attributes may help to promote plant growth49. The Sphingomonadaceae include genera with plant growth-promoting activities. Some of these genera produce phytohormones salicylic acid, gibberellins, indole-3-acetic acid, and abscisic acid50 and induce host-plant systemic resistance51,52. The presence of Solibacteraceae in the plant rhizosphere was linked to plant resistance to Fusarium pathogens53. Moreover, Actinobacteria and Pseudonocardiaceae were reported to exhibit antimicrobial ability against some bacteria and fungi54.

Microorganisms, which play significant role in the turnover of organic plant material, and soil fertility were also a part of the core microbiome. The Xanthobacteraceae family, contains potential nitrogen fixers, and degraders of alkenes, halogenated aliphatic and aromatic compounds, terpenes, thiophenes, or polyaromatic compounds55. Members the Nitrosomonadaceae family, contain species involved in nitrification, sulfur cycling, and plant growth promotion56. Many strains belonging to the Micromonosporaceae family can degrade chitin, cellulose, lignin, and pectin57. In addition to plant beneficial microorganisms, potential phytopathogens were found in the core microbiome.

Of the six genera of plant-parasitic nematodes found in the orchard soils, only root-lesion and dagger nematodes are known to be apple pests. Our analyses did not identify the species of root-lesion nematodes in each sample, but prior research has confirmed the widespread occurrence of P. penetrans in Nova Scotia orchards, including one of the orchards (KEN) sampled in this study58. Root-lesion nematodes are known to cause economically significant damage to apples on their own59,60,61and population densities of 30 to 100 P. penetrans/100 cm3 soil have been proposed as approximate damage thresholds for apple trees59,62. However, a recent field microplot study demonstrated apple growth reduction with an at-planting soil population density of 5.4 P. penetrans/100 cm3 soil59indicating that the Pratylenchus populations observed in these orchard soils would likely have measurable effects on apple growth. As migratory endoparasites of root cortical cells, P. penetrans cause cortical necrosis of fine feeder roots, making them vulnerable to infection by opportunistic fungal pathogens. Previous studies have demonstrated increased levels of infection or severity of disease caused by fungal pathogens including Fusarium sp., Verticillium dahliae, and Rhizoctonia sp. suggesting a synergistic relationship with fungal pathogens and increasing the severity of the broader replant disease complex30,63. Such interactions have not been demonstrated experimentally for apple, but it is worth noting that for strawberry, another perennial crop in the rosaceae, P. penetrans was demonstrated to increase infection of roots by Rhizoctonia fragariae, causing black root rot64.

The threshold for measurable dagger nematode damage to apples has been proposed to be 50 to 100 Xiphinema/100 cm3 soil (e.g. Nematode | Intermountain Fruit | USU; Nematodes - Ontario AppleIPM (gov.on.ca), and we speculate that they would have affected tree growth in the three soils with population densities of 40, 149 and 172 Xiphinema/100 cm3. Xiphinema americanum is also a vector of tomato ringspot virus which can be a problem in apple orchards. Pin nematodes are known to parasitize apple trees but only cause damage at much greater population densities than those found in these orchard soils (e.g. >500 Paratylenchus/100 cm3 soil). Ring nematodes, particularly the species Mesocriconema xenoplax, are known to be economically important parasites of Prunus fruit trees species65but they are not often reported from apple orchards at high population densities, and there are no recorded controlled-inoculation studies of their host-parasite relationship with apple. No species of spiral nematodes have been demonstrated to be apple pests and, similarly, no species of root-knot nematode known to exist in Canada that parasitize apples.

Conclusions

Restrictions on the use of pre-plant, broad-spectrum soil fumigants, have resulted in the re-emergence of apple replant disease in Nova Scotia and across Canada. To effectively implement targeted and sustainable technologies and semi-selective agrochemicals for ARD management, a deeper understanding of disease etiology is essential. In this study, we investigated the soil microbial communities of six orchards with a long history of apple production by using next generation sequencing to gain insight into the nature of ARD complex. The results of this study show that ARD at these sites is primarily driven by biological factors rather than soil chemical or physical properties. We identified Nectria ramulariae (synonym Cylindrocarpon ehrenbergii) and Ilyonectria robusta (Cylindrocarpon-like asexual morphs) as putative causal pathogen of ARD, and as dominant fungal taxon in the soil microbiome at these sites. Among the Oomycota: we identified a high relative abundance of P. attrantheridium (Globisporangium attrantheridium), and P. irregulare (Globisporangium irregulare) at the ARD sites analyzed in this study. Additionally, the plant parasitic nematodes Pratylenchus penetrans and Xiphinema americanum were recovered at population levels consistent with potential economic damage to apple trees. A limitation of our study is that we did not find any direct correlation between microbial community variation and ARD severity. However, we would like to point out that one possible reason for this could be the limited range of disease severity across the sampled sites—five out of six sites exhibited severe ARD, while only one site showed a moderate level of severity. We did not have any sites with low ARD severity, which may have limited our ability to detect such correlations. A further limitation of this study is the absence of pathogen isolation and reinoculation experiments. Future research should focus on isolating, and identifying pathogens within the roots of young apple trees planted at these sites to confirm the potential pathogens identified in this study as causal agents. An additional complementary approach would be to apply functional metagenomics to identify the microbial activities and functional genes associated within the rhizosphere/roots or apple at ARD-affected sites. This could provide insights into the metabolic potential and ecological roles of soil microbes, including those involved in plant pathogenicity, nutrient cycling, and organic matter decomposition, thereby deepening our understanding of the functional dynamics underlying ARD. This approach will also enable resolution of the root microbiome at the species level and support the development of targeted disease management strategies.

Materials and methods

Site selection and collection of soils

Six orchard sites in the Annapolis Valley were chosen in fall 2020, representing the main locations of apple growing in the regions: (1) ROE (Rockland East area); (2) ROW (Rockland West area, ); (3) CAN (Canard area); (4) AYL (Aylesford area); (5) KEN (Kentville); (6) BER (Berwick area). In the Annapolis Valley of Nova Scotia, apples are produced under rain-fed (non-irrigated) conditions in a maritime climate with long cold winters, short summers and generally wet falls and springs. Droughty conditions can exist for short periods in the summer. In addition, soils are generally coarse, ranging from sandy to sandy loam in texture, with clay contents rarely exceeding 18% clay66 and, where they do, they are generally found in poorly drained depressions that collect run-off and seepage and are not suited to apple production. Soil classifications were based on the Agriculture Canada Expert Committee on Soil Survey67. At each site, five samples per site were collected from the 0–30 cm depth by sub-sampling 10 locations under the tree canopy on the herbicide strip along tree rows. The resulting samples (~ 2 L each) were combined, thoroughly blended, and passed through an 8 mm screen on-site to eliminate coarse organic material, stones and other debris from the sample. A composite soil sample was drawn from each sample for the following analyses: (i) a 300 mL sub-sample was stored at 4 °C and shipped to the Agriculture and Agri-Food Canada Summerland Research and Development Centre for nematode analysis; (ii) a 250 g sub-sample was stored at − 80 °C for DNA extraction; (iii) the remaining sample was dried, ground and sieved through a 2 mm screen, and analyzed for soil physio-chemical properties using standard methods. Information on soil fertility, orchard characteristics, and land and physical soil characteristics is provided in Tables 1 and 2. All tools and equipment were sterilized with 75% ethanol prior to sample collection at each site. The remaining bulk orchard samples were stored moist in totes lined with plastic at 5 °C and used for ARD bio-assays in greenhouse.

Bioassays for ARD in the greenhouse

Apple seedlings were used in bio-assays to confirm the presence of ARD and establish the relative degree of severity between the experimental orchard soils. Apple seeds (Malus domestica Borkh. Var. Golden Delicious) were germinated in seedling trays using a pasteurized, soilless growing medium (Promix®), and grown for 3 weeks until the plants were ~ 8 cm high with a good root-ball. Seedlings were subsequently selected for uniformity and transplanted into 6” nursery pots (one per pot) containing pasteurized (p) or non-pasteurized (np) orchard soil, and grown in the greenhouse for 9 weeks (April 8–June 11, 2020). Pasteurization of the six orchard soils was accomplished by exposing the moist soil to a temperature of 70 °C for 2 h across 2 cycles, each 24 h apart. Greenhouse settings for the plant growth period were 22 °C and 18 °C for day and night temperatures, respectively. Day length during the spring growth period varied from 13 h on April 9 to 15.5 h on June 11. The trial was arranged in a randomized complete block design with 6 orchard soils, 2 levels of soil pasteurization (p, np) and 4 replications. All pots were watered frequently with de-chlorinated tap water and intermittently with complete, soluble nutrient solution at label rate. Aerial dry biomass accumulation after 8 weeks was used as the response variate to calculate seedling growth response to the pasteurization of soil as follows32:

$$\% {\text{ }}R{\text{ }} = {\text{ }}100_{*} \left( {x_{p} {-}{\text{ }}x_{{np}} } \right){\text{ }}/{\text{ }}x_{{np}} ,$$

where xp and xnp are the aerial dry biomass accumulations for the p and np soil treatments respectively. We ranked the severity of ARD in the experimental orchards as Severe (% R > 100%), Moderate (% R = 50 to 100%), and Low (% R < 50%).

DNA extraction and sequencing

DNA extraction from five samples per orchard from 250 mg of well homogenized soils was carried out using DNeasy PowerSoil Kit (cat #12888-100, Qiagen, Valencia, CA) according to the manufacturer’s protocol with slight modifications to increase the yield and obtain high-quality DNA68. In brief, the modification includes the use of buffer from the Power Bead tubes for washing the soil slurries into the Power Bead tubes. After adding 60 µl of solution C1 (step 2) the samples were incubated at 65 °C for 20 min to inactivate the DNases. Samples were then vortexed for 20 min (step 4) and incubated at 4 °C (step 7). In step 9 of the protocol, only 600 µl of supernatant was used, with 200 µl of C3 in step 10. DNA quality and concentration were measured using a NanoDrop 1000 spectrophotometer (Thermo Scientific, Waltham, USA). Isolate DNA was visualized on a 1% agarose gel (Invitrogen Ultrapure catalog number 16500-500) in 1X Tris-borate-EDTA buffer. To make sure the quality of DNA is good, PCR amplification was carried out with all the primer pairs that were used for subsequent meta amplicon sequencing. At least 50 ng (10µL) of DNA from each sample were sent to the Dalhousie University CGEB-IMR (http://cgeb-imr.ca/) for library preparation and sequencing. The bacterial V6-V8, 16 S rRNA gene was amplified using the primer set B969F (ACGCGHNRAACCTTACC) and BA1406R: (ACGGGCRGTGWGTRCAA)69and the fungal internal transcribed spacer ITS2 region was amplified using the primer pair ITS86(F): (GTGAATCATCGAATCTTTGAA): ITS4(R) (TCCTCCGCTTATTGATATGC)70. Samples were multiplexed using a dual-indexing approach and sequenced using an Illumina MiSeq with paired-end 2 × 300 bp reads. All PCR procedures and Illumina sequencing details were as previously described71. For oomycete sequencing, a sub sample of DNA was sent to Molecular Technologies Laboratory at AAFC Ottawa Research and Development Centre. For oomycetes, the ITS region (oomITS) was sequenced using primer Oom_SSU-ITS: CGGAAGGATCATTACCACAC and Oom_lo5.8S47C: ATTACGTATCGCAGTTCGCA72. Library preparation and sequencing was conducted as described above. All sequences generated in this study are available in the NCBI sequence read archive under the accession numbers PRJNA968027, PRJNA968028, and PRJNA968029.

Sequencing data processing

Overlapping paired-end reads were stitched together using perl run_pear.pl script73. Paired sequences were then imported as a QIIME2 artifact74. The sequences were trimmed of their primers with Cutadapt75. Low-quality sequences were removed using QIIME2’s q-score-joined function. Sequences were organized into Amplicon Sequence Variants (ASV) with QIIME2’s Deblur plug-in76 using a trim length of 293 and 401 base. ASVs with a frequency < 0.1% of the total reads for the 16 S and ITS datasets were filtered out in order to compensate for MiSeq run-to-run bleed-through71. 16 S RNA ASVs were aligned with MAFFT v7.31077 to create de novo multiple sequence alignments, which were used to create a tree using FastTree v2.1.1078. 16 S rRNA and ITS ASVs were classified taxonomically using a Naïve-Bayes RDP classifier and accessing the SILVA rRNA79 and UNITE ITS database v7.280, respectively. Reads annotated as mitochondria and chloroplast were filtered. For oomycetes reads processing, a standalone Nucleotide-Nucleotide BLAST+ (version 2.9.0+) search (mega blast) was performed to obtain the best high-scoring segment pair presenting at least 99% similarity and minimum 100-bp alignment length with the query sequence. Manually curated ITS sequences from Phytophthora-ID (http://phytophthora-id.org)75,81 were used as nucleotide reference database for BLAST. The annotation of all oomycetes ASVs was manually verified and updated using Nucleotide-Nucleotide BLAST against the NCBI nucleotide collection.

In brief, 166,769, 164,626 and 58,725 high-quality non-chimeric reads were obtained from 30 samples of 16 S rRNA, fungal ITS2 and oomycetes ITS (oomITS), respectively. These sequences were clustered into 5,174 (16 S rRNA), 1,026 (ITS2) and 282 (oomITS) ASVs. The datasets were rarefied to the depth of 1,215, 1,628 and 1,192 reads resulting in the datasets comprising 4,547 (16 S rRNA), 1,006 (ITS2) and 258 (oomITS) ASVs, respectively.

Sequencing data analysis

Alpha-diversity (Chao1 richness, Simpson evenness and Shannon diversity) and beta-diversity metrics were generated using QIIME2. Variations in sample groupings explained by weighted unifrac beta-diversity distances (Adonis tests, 999 permutations) were run in QIIME2 to calculate how sample groupings are related to microbial community structure. Visualization was done using the ggplot2 package in R82. Differential relative abundance testing of classes and genera between orchard sites was performed using an analysis of composition of microbiomes (ANCOM) R package on non-rarefied ASV tables run in QIIME2 82. Significant results were based on a q-value of 0.05. ASVs, which were found in ≥ 80% of all samples, were assigned as core ASVs using core function in QIIME2. Families present in ≥ 80% of samples across each orchard were assigned as core microbial families. Community-level patterns were analyzed using Redundancy Analysis (RDA) with the vegan R package in R (v2,6,-4)83.

Nematode analysis

The wet sieving-sucrose centrifugation procedure84 was used to extract nematodes from triplicate 100 cm3 subsamples from each sample. The entire of extract was poured into a gridded counting dish and observed with a Meiji Techno TC5100 inverted microscope (Meiji Techno America, Campbell, CA, USA). Plant-parasitic nematodes in each extract were identified according to genus on the basis of morphological features observed at 400X magnification85and the number of nematodes of each genus was counted. Data were expressed as the number of nematodes of each genus per 100 cm3 soil, and averages of the triplicate extracts from each sample are reported in Table 5.

27.The multiple personalities of Streptomyces spp. from the rhizosphere of apple cultivated in brassica seed meal ameded soils.