Introduction

Strigolactones (SLs) are carotenoid-derived phytohormones with diverse roles in plant development and physiology1,2, including determining shoot and root architecture2,3. SLs are released by roots to allow the plant to communicate with symbiotic arbuscular mycorrhizal fungi4,5. These SLs also induce seed germination in root parasitic plants, such as Striga hermonthica (Striga), which precedes infestation by these weeds2.

SLs consist of a butenolide (D-ring) connected by an enol-ether bridge in R-configuration to a second, structurally variable moiety6 represented by a tricyclic lactone ring (ABC-ring) in canonical SLs and different structures in non-canonical SLs. The structural diversity of SLs is linked to their specific biological roles7,8,9. SLs are perceived by the α/β-fold hydrolase DWARF14 (D14), which binds to and cleaves them into the D-ring, which covalently attaches to the histidine residue of the D14 catalytic Ser-His-Asp triad, and the second moiety10,11. This attachment triggers the structural rearrangement of D14, allowing it to form a complex with the F-box protein MORE AXILLARY BRANCHING2/DWARF3 (MAX2/D3) and transcriptional repressors, such as SUPPRESOR OF MAX2-LIKE6 (SMXL6) in Arabidopsis (Arabidopsis thaliana) or D53 in rice (Oryza sativa). This process initiates the ubiquitination and degradation of the targeted transcriptional repressors by linking them to the MAX2-containing E3 ligase complex12. D14 also perceives and hydrolyzes synthetic SL analogs and mimics, such as GR24, MP3, and Nijmegen-113,14. SL biosynthesis is governed by a negative feedback mechanism, which is triggered by SLs and mediated by D14-MAX2-SMXL complex that downregulates the transcription of SL biosynthetic genes15,16,17.

A racemic mixture of the synthetic SL analog GR24, (±)-GR24, and (-)-GR24 binds to the D14 homolog KARRIKIN INSENSITIVE2 (KAI2)16, which perceives karrikins (KARs). These small, non-hydrolysable butenolide smoke-derived compounds mimic an unidentified plant growth regulator termed KAI2-ligand (KL), which regulates seed germination, plant growth, biotic and abiotic stress responses, and mycorrhization18. Interestingly, KAR signaling, which requires MAX2/D3 in Arabidopsis and rice18, involves a perception mechanism similar to and overlapping with that of SLs19. SUPRESSOR OF MAX2 1 (SMAX1) regulates seed germination and hypocotyl elongation via KAR signaling in Arabidopsis20,21, whereas SMAX1 regulates mesocotyl elongation in rice in the dark via its interaction with KAI2/D14L-D322. These observations reflect the commonalities and specificities of the SL and KAR pathways in regulating different aspects of plant physiology.

The cleavage of carotenoids by reactive oxygen species or CAROTENOID CLEAVAGE DIOXYGENASES (CCDs)1,23 gives rise to apocarotenoid signaling molecules, e.g., β-cyclocitral, β-cyclocitric acid, β-ionone, anchorene, and zaxinone, which regulate plant growth, phytohormone homeostasis, metabolism, and stress responses24,25,26,27,28. Several lines of evidence point to the importance of zaxinone in plant growth and development27,29,30,31. Manipulation of zaxinone content in rice by knocking-out or overexpressing ZAXINONE SYNTHASE led to global changes in plant architecture, hormone homeostasis, and metabolism, and affected mycorrhization29,30. Moreover, exogenous zaxinone treatment in rice resulted in reduced SL content, enhanced sugar metabolism, and improved root growth27,32. In contrast, this treatment led in Arabidopsis – which lacks a ZAXINONE SYNTHASE – to increased expression of the SL biosynthetic genes CCD7 and CCD8, enhanced SL and abscisic acid (ABA) levels, and reduced root growth31. Despite our understanding of the physiological effects of zaxinone and other apocarotenoids, their perception mechanisms remain elusive.

In this study, we demonstrate that zaxinone regulates the transcription of a wide range of genes in Arabidopsis, partially through the receptors AtD14 and AtKAI2, and the AtMAX2-mediated signal transduction. Furthermore, the effect of zaxinone on SL biosynthesis requires AtD14 and AtMAX2. Zaxinone binds to both AtD14 and AtKAI2and acts as an SL antagonist by competing for the binding cavity of AtD14 and interrupting its interaction with AtMAX2. Therefore, our findings identify a receptor for the apocarotenoid zaxinone and unveil the ability of the phytohormone receptor AtD14 to bind structurally and functionally different regulatory metabolites and transduce its signal.

Results and Discussion

AtD14 is required for the responses of Arabidopsis to zaxinone

We previously showed that zaxinone treatment reduced SL contents by decreasing CCD7 and CCD8 transcription and enhanced root growth in rice cv. Nipponbare27, which required functional SL biosynthesis and perception33. To determine whether the effect of zaxinone on SL biosynthesis in Arabidopsis also relies on SL perception, we treated several mutants impaired in SL perception (Atd14) and signaling (Atmax2), and compared them with the wild-type (WT) Arabidopsis Col-0. Additionally, we included the Atkai2 mutant, which is deficient in the karrikin receptor AtKAI2. Zaxinone was applied at a concentration of 20 µM, as previously described in our earlier study on Arabidopsis31. Following treatment, we quantified the SL methyl carlactonoate (MeCLA) levels in root tissues using LC-MS and assessed the Striga-seed germinating activity of root exudates, which correlates with their SL content31 (Fig. 1a–c).

Fig. 1: AtD14 is required for zaxinone response in Arabidopsis.
Fig. 1: AtD14 is required for zaxinone response in Arabidopsis.The alternative text for this image may have been generated using AI.
Full size image

a Strigolactone (MeCLA) quantification in Arabidopsis roots subjected to Mock (acetone) or 20 µM zaxinone treatment. Data is represented as box and whiskers (Col-0 Mock: min. (0.343), max. (0.528), center (0.438); Col-0 Zax: min. (0.604), max. (0.637), center (0.630); Atd14 Mock: min. (11.19), max. (13.80), center (12.293); Atd14 Zax: min (11.273), max (12.124), center (11.283); n = 3 independent plants). An unpaired two tails Student’s t-test was performed to assess significance (*: p = 0.0259). b, c Striga germination bioassay using the root exudates from 5-weeks old WT Col-0 and mutant Atd14 Arabidopsis plants treated with mock (gray) or zaxinone (blue; 20 µM) for 6 hours. In (b) data is represented as box and whiskers (Col-0 Mock: min. (68.9), max. (72.9), center (70.85); Col-0 Zax: min. (74.5), max. (85.6), center (77.55); Atd14 Mock: min. (63.7), max. (83.2), center (74.425); Atd14 Zax: min (75.4), max (83.7), center (78.975); n = 4 exudates collected from 4 independent plants). An unpaired one tail Student’s t-test with Welch’s correction was performed to assess significance (*: p = 0.042). In (c) photos are a zoom in of the disks where Striga seeds were germinated upon exudate application (scale bar=3 mm) and the asterisks are showing seeds that did not germinated after the treatment. The complete disks can be found in Supplementary Fig. 1a. d Zoom in of 4 days-old Arabidopsis seedlings (DAS) germinated on mock, zaxinone and ABA-supplemented MS media. Scale bar: 3 cm. e Quantification of seed germination for all genotypes and treatments two days after sowing (the experiment was repeated twice). Single data points represent measurements from three or six (for WT) independent plates with 30-35 seeds per genotype. f ABA quantification in the roots of 5-weeks old Arabidopsis Col-0, Atd14, Atkai2, and Atmax2 plants treated with mock (1% DMSO) and zaxinone for six hours (n = 3). In (e) and (f) the data represents the mean ± SD; letters denote significance assessed by one way ANOVA (n = 3). Source data is provided as a source data file.

Compared to wild-type plants, untreated Atd14 plants contained higher SL content in both root tissues and exudates, as confirmed by the LC-MS analysis and the Striga bioassay. Zaxinone treatment did not further increase the SL content in Atd14 root tissues or exudates, in contrast to the response observed in wild-type plants. These results support the hypothesis that AtD14 is required for zaxinone’s effect (Fig. 1a–c; and Supplementary Fig. 1a). However, the lack of SL induction in the Atd14 mutant upon zaxinone treatment might be due to its already elevated SL content, which is caused by the lack of the negative feedback-regulatory mechanism that is needed by the downstream signal transduction components SMXL6, 7 and 8. Therefore, we used a quadruple mutant, Atd14smxl6,7,834, which lacks functional D14 and SMXL6, 7 and 8 repressors, and therefore exhibits SL content and axillary branching similar to those of the WT Col-0. Similar to the Atd14 mutant, treatment of the quadruple mutant Atd14smxl6,7,8 did not cause an increase in SL content, as shown in the Striga germination assay (Supplementary Fig. 1b). These findings demonstrate that AtD14 is required for the effect of zaxinone on SL biosynthesis. We also tested root exudates of Atkai2 and Atmax2 plants following zaxinone treatment. Striga seed germinating activity increased in response to treatment in Atkai2 and wild-type Col-0 plants, but not in Atmax2 plants (Supplementary Fig. 1c), which indicates that the effect of zaxinone on SL content requires a functional SL transduction pathway, but not the Karrikin pathway.

The dependency on AtD14 may be explained by a direct interaction between this receptor and zaxinone, which could interfere with the SL signaling pathway that regulates SL levels and mediates SL-related biological functions, such as the inhibition of shoot branching. To test this hypothesis and confirm the dependency on AtD14 in planta, we assessed the effect of zaxinone on shoot branching of 18-day-old Col-0 and Atd14 mutant plants. We sprayed the plants daily for two weeks with zaxinone (20 µM), using the SL analog MP3 (5 µM) as a control. Zaxinone treatment significantly increased axillary shoot branching in Col-0 plants compared to mock-treated controls (Supplementary Fig. 2a, b). In contrast, plants treated with MP3 showed a slight but significant reduction in shoot branching (Supplementary Fig. 2a, b). Notably, Atd14 mutant plants did not respond to either treatment (Supplementary Fig. 2a, b). To further confirm the role of AtD14, we analyzed shoot branching in the Atd14smxl6,7,8 mutant following zaxinone and MP3 application. Neither treatment affected axillary shoot branching in this background (Supplementary Fig. 2c).

We also evaluated the effect of zaxinone on other SL-regulated traits, i.e. root and hypocotyl length19,20,35. Based on our previous results, zaxinone application increases ABA content in the roots of Arabidopsis plants grown on hydroponic media. We tested whether the zaxinone-induced increase in ABA content also depends on AtD14 and AtMAX2 by assessing the effect of zaxinone treatment on seed germination and hypocotyl length, two ABA-dependent traits1,31. For this purpose, we performed seed germination assays with the Atd14 and Atmax2 mutants in medium supplemented with zaxinone, or ABA as a positive control (Fig. 1d; Supplementary Fig. 3). Additionally, we included the Atkai2 mutant in our analysis. Similar to ABA, zaxinone treatment delayed germination in all mutants, suggesting that neither AtD14, AtKAI2, nor AtMAX2 is required for the zaxinone-induced increase in ABA content (Fig. 1d–e). To confirm that the effect of zaxinone on germination is mediated by increased ABA content, seeds of the Arabidopsis sextuple ABA receptor mutant (Atpyr1/pyl1,2,4,5,8)36 were treated with 50 µM zaxinone. Unlike wild-type seeds, zaxinone did not cause any delay in their germination (Supplementary Fig. 4a). We also investigated whether zaxinone’s inhibition of primary root length31 depends on AtD14 or AtKAI2. Our findings demonstrate an independence of zaxinone’s effect from AtD14 and AtKAI2, as the application of 20 µM zaxinone reduced the primary root length in the single Atd14 and Atkai2 mutants, as well as in the Atd14kai2 double mutant (Supplementary Fig. 4b–d). In contrast, the impact of zaxinone on primary root length was abolished when 20 µM zaxinone (or 2 µM ABA) was applied to the Atpyr1/pyl1,2,4,5,8 mutant (Supplementary Fig. 4e). Furthermore, we confirmed that zaxinone reduces hypocotyl length in Arabidopsis seedlings31 and showed that this effect is also independent of AtD14 and AtKAI2. The application of 20 µM zaxinone, but not MP3, reduced hypocotyl length in single Atd14, and Atkai2 mutants, as well as in the Atd14kai2 double mutant (Supplementary Fig. 4f, g). As expected, the reduction in hypocotyl length induced by zaxinone was abolished in the Atpyr1/pyl1,2,4,5,8 mutant (Supplementary Fig. 4h). ABA quantification in plants grown in hydroponic medium supplemented with zaxinone confirmed the finding that ABA accumulation in Arabidopsis is not dependent on AtD14, AtKAI2, or AtMAX2 (Fig. 1f). Taken together, our results show that the effect of zaxinone on seed germination, root length, and hypocotyl length is independent of SL and KAR perception systems, but is mediated by increased ABA levels and requires a functional ABA receptor.

D14 and MAX2 are required for the zaxinone-dependent induction of SL biosynthetic genes in Arabidopsis

Previously, we showed that zaxinone treatment increased transcript levels of the SL biosynthetic genes CCD7 and CCD8 in Arabidopsis roots31. To determine whether the transcript-level effects depend on AtD14 and the SL signaling pathway, we treated Atd14, Atmax2, Atkai2 and WT Col-0 plants with 20 µM zaxinone and analyzed their transcriptomes using RNA sequencing (Fig. 2a). We identified 1835 differentially expressed genes (DEGs) in Col-0 (Log2 Fold Change (F.C.) > 1 (upregulated) or Log2 F.C.< -1 (downregulated), padj< 0.05; Supplementary Data 1–2), which were enriched in a wide range of biological processes in different cellular compartments (Supplementary Fig. 5; and Supplementary Data 3–10; Fisher test and Bonferroni post-test, p > 0.05). In general, we identified 1835 genes whose transcription was affected by zaxinone in WT (1835 genes; Supplementary Fig. 5c; and Supplementary Data 2) but not in Atd14, Atkai2, or Atmax2 plants (Supplementary Data 11–16). By comparing Col-0 zaxinone (Z) vs. mock (M) with Atd14 Z vs. M, we identified 340 DEGs (among the 1835 zaxinone-responsive DEGs in Col-0) that did not respond to zaxinone treatment in Atd14 (-1> Log2F.C./1< Log2 F.C. and padj> 0.05; Fig. 2b; and Supplementary Data 17–19), suggesting the need for a functional AtD14 receptor for the zaxinone-dependent regulation. Similarly, 458 and 486 genes required functional AtKAI2 (-1> Log2F.C./1< Log2 F.C. and padj> 0.05; Fig. 2b; and Supplementary Data 20–22) and AtMAX2 (-1> Log2F.C./1< Log2 F.C. and padj> 0.05; Fig. 2b; and Supplementary Data 23–25) for their zaxinone-dependent regulation, respectively. Moreover, 205 genes were dependent on AtD14, AtKAI2, and AtMAX2 for their zaxinone-dependent regulation (Supplementary Fig. 6), whereas 56, 103, and 40 genes required the pairs D14-MAX2 (Supplementary Data 26–27), KAI2-MAX2, and D14-KAI2, respectively, for their zaxinone-dependent regulation (Supplementary Fig. 6). Additionally, 39, 110, and 122 genes were solely dependent on AtD14, AtKAI2, or AtMAX2, respectively, for their zaxinone-dependent regulation (Supplementary Fig. 6), suggesting that these proteins also function independently in different signaling networks. We validated the responses of four of the 39 genes that were regulated by zaxinone in an AtD14-dependent manner (Supplementary Data 28–29) using reverse transcription quantitative PCR (RT-qPCR) (Supplementary Fig. 7). We selected these four genes because their expression levels had been previously assessed and their primer sequences were available33,37,38,39. Among these genes, ABA RESPONSIVE (ABR) expression was induced by zaxinone treatment in Col-0, Atkai2, and Atmax2, but not in Atd14, confirming the possibility that the transcription of this gene set only requires AtD14, but not AtMAX2, and may involve an unidentified ubiquitin E3 ligase. The proposed involvement of an E3-ligase distinct from AtMAX2, is in line with a recent report showing that the rice OsD14 interacts with a RING-finger ubiquitin E3 ligase (SDEL1) to degrade SPX DOMAIN-CONTAINING PROTEIN 4 under phosphate deficiency, thereby releasing PHOSPHATE STARVATION RESPONSE PROTEIN 240.

Fig. 2: RNAseq analysis of Arabidopsis Col-0, d14, kai2 and max2 roots upon zaxinone treatment.
Fig. 2: RNAseq analysis of Arabidopsis Col-0, d14, kai2 and max2 roots upon zaxinone treatment.The alternative text for this image may have been generated using AI.
Full size image

a Plant phenotypes of 5-weeks old Arabidopsis Col-0 and mutants grown in hydroponic media. b Venn diagrams showing zaxinone (Zax) responsive genes (DEGs) measured by RNAseq in Atd14, Atkai2, and Atmax2 mutant backgrounds in response to zaxinone (20 µM). The expression of 545, 697 and 786 DEGs (up and down) was modulated by zaxinone in the wild type, however the expression of these DEGs remained unchanged in the Atd14, Atkai2 and Atmax2 mutant backgrounds, respectively. c Heatmap representation showing the expression patterns of genes involved in ABA and SL biosynthesis in Col-0, Atd14, Atkai2 and Atmax2 mutant backgrounds obtained from the RNAseq data (DESeq2 R package was used to calculate p-values which were adjusted with Benjamini and Hochberg’s tests; specific padj-values for the expression of NCED2, NCED3, CCD7 and CCD8 are provided in the Supplementary Data 1, 11, 13, 15 for Col-0, Atd14, Atkai2 and Atmax2, respectively). All selected DEGs fulfill the threshold Log2 F.C. > 1 (up) or Log2 F.C.< −1 (down) and padj< 0.05 (represented with an * in 2c). The RNAseq experiment was performed by applying 20 µM zaxinone to the hydroponic media of 5-weeks old Arabidopsis plants for 6 hours (n = 4 independent plants).

Consistent with the results of the in vivo tests, LC-MS analysis, and Striga bioassay (Fig. 1), zaxinone upregulated the ABA biosynthetic genes 9-CIS-EPOXYCAROTENOID DIOXYGENASE (NCED) AtNCED2 and AtNCED3 (padj< 0.05) in all lines examined, i.e., Col-0, Atd14, Atkai2, and Atmax2 (Fig. 2c). Moreover, we observed significant increase in the transcript levels of CCD7 (Log2 F.C. > 2) and CCD8 (Log2 F.C. > 1.5) in WT and Atkai2, but not in Atd14 and Atmax2 (Fig. 2c and Supplementary Fig. 5c; Supplementary Data 1-2). RT-qPCR further confirmed the expression responses of AtCCD7, AtCCD8, and AtNCED3 in Col-0, Atd14, Atkai2, and Atmax2 (Supplementary Fig. 8). These results confirm that the effect of zaxinone on ABA biosynthesis is independent of SL and KAR perception, whereas its effect on SL biosynthesis requires a functional AtD14 and AtMAX2 but not AtKAI2.

In vitro zaxinone-AtD14 interaction and co-crystallization reveal zaxinone as an SL-antagonist

Beyond the dependency of the zaxinone SL-response on AtD14 and AtMAX2, our RNA-seq results indicate a partial dependency of the zaxinone transcriptional response on both receptors AtD14 and AtKAI2, as well as the signaling component AtMAX2, suggesting the possibility of direct interaction with both receptors. We examined this possibility by performing nano differential scanning fluorescence (nanoDSF) experiments with purified AtD14 and AtKAI2 (Fig. 3a). Zaxinone treatment increased the melting temperature (Tm) of AtD14 by 3 ± 0.23 to 5.2 ± 0.11 °C, whereas (±)-GR24 treatment decreased the Tm of AtD14 by 7 ± 0.11 to 7.9 ± 0.10 °C, both at concentrations of 10 µM and above (Fig. 3a and Supplementary Fig. 9a; Supplementary Table 1-3). Zaxinone also stabilized AtKAI2 but only at concentrations of 50 and 100 µM (Supplementary Fig. 9b; and Supplementary Table 4-5). We also tested the AtD14 and AtKAI2 homolog AtD14-LIKE2 but failed to detect any effect of zaxinone (Supplementary Fig. 9c and Supplementary Table 6-7). Next, we investigated the specificity of this binding by testing other apocarotenoids with structural similarity to zaxinone (C18, all-trans-3-OH-β-Apo-13-carotenone). For this purpose, we tested D’Orenone (all-trans-β-Apo-13-carotenone), which lacks the OH group present in zaxinone, and the recently reported C15-apocarotenoids that have a shorter chain length than zaxinone and act as ABA precursors, i.e. all-trans-β-Apo-11-carotenal (11Apo, C15) and all-trans-3-OH-β-Apo-11-carotenal (OH11Apo, C15)26. Interestingly, our nanoDSF data revealed a stabilizing effect of D’Orenone, causing a shift in AtD14 Tm, which was, however, smaller than the one triggered by zaxinone (Supplementary Fig. 10a; Supplementary Table 1). In contrast, 11Apo and OH11Apo destabilized AtD14, lowering the Tm by 4–10 °C at 50 and 100 µM concentration, respectively (Supplementary Fig. 10b, c; and Supplementary Table 8–9). This prompted us to test the effect of these compounds on Arabidopsis plants and to determine their impact on the expression of the SL biosynthetic genes. Exogenous treatment with 20 µM D'Orenone did not trigger any change in CCD7 and CCD8 expression in Col-0, d14, kai2 or max2 mutant backgrounds (Supplementary Fig. 10d–g). However, exogenous treatment with 20 µM of either 11Apo or OH11Apo triggered a reduction in CCD7 and CCD8 expression in Col-0, d14, kai2 or max2 mutant backgrounds (Supplementary Fig. 10h–k). These data indicate a biological activity of these apocarotenoids, which is different from that of zaxinone, despite the common in vitro binding to AtD14. Further experiments are required to gain deeper insights into the functions of D'Orenone, 11Apo and OH11Apo in planta and the biological relevance of their in vitro binding to AtD14.

Fig. 3: In vitro and co-crystallization experiments identify zaxinone as an AtD14 ligand.
Fig. 3: In vitro and co-crystallization experiments identify zaxinone as an AtD14 ligand.The alternative text for this image may have been generated using AI.
Full size image

a Nano differential scanning fluorimetry (nanoDSF) assays for AtD14 (6 µM) in the absence and presence of rac-GR24, KAR2, and zaxinone. b YLG cleavage by AtD14 (3 µM) in the presence of increasing (±)-GR24 and zaxinone concentrations. Data are the mean ± SE (n = 3). c Binding properties of AtD14 (10 µM) in the presence of (±)-GR24 and zaxinone. Apparent dissociation constant (Kd) were derived from intrinsic protein fluorescence measurements at increasing substrate concentrations. Data are the mean and error ± SD (n = 3). d X-ray crystallographic structure of the AtD14-zaxinone complex. Top: ribbon presentation of AtD14 (cyan) with zaxinone (stick representation, carbons in yellow and oxygen in red) bound in its active site. The gray mesh shows the 2.4 Å electron density 2Fo-Fc omit map, contoured at 1 σ. Six key amino acid residues for zaxinone binding are shown as sticks (F28, S97, F126, F136, F159 and F195). The zoomed view above AtD14 shows the fit of zaxinone (stick model) in its 2Fo-Fc electron density omit map electron density. Bottom: zoomed view into the zaxinone binding site. The 2.2 Å hydrogen bond from the active site S97 to the OH group of zaxinone is shown by a dotted line. e NanoDSF specificity assay for AtD14, AtD14 S97A and AtD14 S97C (all proteins ~6 µM) in the absence and presence of the SL analog MP3 and zaxinone (50 µM). f Pull-down of the FITC labeled CTH peptide of AtMAX2 with GST-AtD14 in the absence and presence of (±)-GR24and/or zaxinone (the experiment was performed once and the full blots are provided in the source data file). g Competition assay, measuring normalized fluorescence polarization (ΔmP), between AtD14 and CTH peptide of AtMAX2 in the absence and presence of (±)-GR24 and/or increasing concentrations of zaxinone (n = 3; data represent the mean and error ± SD). h Evaluation of AtD14 substrate stability. Melting temperature curves of AtD14 (6 µM) with or without pre-incubation with (±)-GR24 (50 µM) and zaxinone (20 µM) for the indicated time period. Tm values (a, e, h) were calculated using default settings in PrometheusNT.48 software (means ± SE, n = 4 capillaries). *** p < 0.0005 (unpaired two tails Student t-test). P value (< 0.05) and a shift in the melting profile of at least 1 °C were used to define significant binding (red asterisks). Black asterisks denote statistical significance associated to a low shift in Tm (< 1 °C) and thus it is not considered as interaction. Source data is provided as a source data file.

Next, we investigated whether zaxinone is a competitor of SL in binding to AtD14 using Yoshimulactone (YLG) hydrolysis assay and (±)-GR24 as a positive control. The half-maximal inhibitory concentration (IC50) of (±)-GR24 was 2.0 µM, while that of zaxinone was 8.7 µM, indicating that zaxinone is a competitor of SLs, although with a lower efficiency than the SL analog (±)-GR24 (Fig. 3b). We also determined the dissociation constants (Kd) for both compounds using an intrinsic tryptophan fluorescence assay (Fig. 3c). AtD14 bound to (±)-GR24 and zaxinone with a Kd: 0.99 and 1.8 µM, respectively (Fig. 3c).

Next, we crystalized AtD14 in the presence of zaxinone. These crystals diffracted X-rays to 2.4 Å resolution. The crystal structure was determined by molecular replacement using the AtD14 structure as a template (PDB accession code 4IH4; Fig. 3d, Supplementary Table 10). Clear electron density was visible in the SL binding pocket of AtD14, consistent with a bound zaxinone molecule, contoured at 1.0 and 1.5 σ (Fig. 3d and Supplementary Fig. 11a, b). The zaxinone molecule was stabilized through hydrophobic interactions with five phenylalanine residues (F136, F195, F126, S97, F28, and F159), along with additional contacts from V144, W155, and S191. The OH group of zaxinone was positioned at a distance of 2.2 Å from the catalytic triad residue S97. This distance and the non-connected electron density between zaxinone OH and AtD14 S97 indicate that the interaction is stabilized via the formation of a hydrogen bond (Fig. 3d) and not a covalent bond. To assess the importance of this hydrogen bond, we tested the effect of zaxinone on S97A and S97C mutants of AtD14 using a nanoDSF assay. In this case, the SL analog methyl phenlactonoate 3 (MP3), a previously reported SL analog35, served as a positive control (Fig. 3e). Similar to (±)-GR24, MP3 destabilized wild-type AtD14 by 8.6 ± 0.1 °C, whereas zaxinone stabilized it by 4.6 ± 0.3 °C (Fig. 3e). The AtD14 S97A mutation impeded the interaction between MP3 and AtD14 (Fig. 3e), in agreement with previous findings for GR2411, and affected the interaction with zaxinone at a concentration of 50 µM only with 0.5 °C (Tm: 4.1 ± 0.1 °C; Supplementary Table 11). Since 50 µM is considered to be in the middle-high micromolar range and zaxinone (10 µM) triggered a 3 °C shift in the Tm of AtD14 (Supplementary Table 2), we decided to asses this interaction with the AtD14S97A variant (Supplementary Fig. 12a). Interestingly, our NanoDSF results showed that zaxinone at a 10 µM concentration does not interact with AtD14S97A variant (Tm: 0.65 ± 0.1 °C v/s Tm: 3 ± 0.1 °C for AtD14 wt; Supplementary Tables 2 and 10), suggesting that the hydrogen bond formed between zaxinone and the serine 97 is important especially at lower zaxinone concentrations. These results are consistent with the predicted crystallographic model for the interaction between zaxinone and AtD14S97A (Supplementary Fig. 12b). In addition, binding assays using zaxinone (all-trans-3-OH-β-apo-13-carotenone/OH-Apo13) or D'Orenone (all-trans-β-apo-13-carotenone/Apo13) showed a higher shift in Tm for the interaction with zaxinone (~4.8 °C) than the interaction with D'Orenone (~1.5 °C; Supplementary Fig. 10a), which is likely the result of the presence of the hydroxyl group in zaxinone and the formation of the hydrogen bond with the OH of the S97. In contrast to AtD14S97A, the S97C mutation of AtD14 impaired the interaction with both MP3 (0.18 ± 0.06 °C shift in Tm) and zaxinone (0.9 ± 0.06 °C shift in Tm; Fig. 3e). Even at a high zaxinone concentration of 100 µM, we could not observe any shift in the Tm of AtD14S97C (Supplementary Fig. 12a; and Supplementary Table 11). According to the structural model, the S97C mutation would result in an unfavorable proximity of the zaxinone OH moiety with the hydrophobic sulfur of the cysteine, in addition to shortening the distance between the side chain of position 97 and the hydroxyl group of zaxinone (Supplementary Fig. 12c). To confirm the negative impact of the S97C on zaxinone binding, we modeled the possibility that the cysteine in the S97C mutant could adopt two different rotamers and found that both still clash with other residues (Supplementary Fig. 13a, b). Thus, the S97 mutant analysis further corroborated the crystallographic model for the association of zaxinone with the AtD14 active site.

Considering that the hydrolysis of GR24 is associated with a conformational change that triggers MAX2 binding12, we asked whether zaxinone antagonizes SL signaling by preventing AtD14 from binding to AtMAX2. To investigate this possibility, we performed a pull-down assay to examine the ability of AtD14 to associate with a C-terminal helix (CTH) of AtMAX2 upon SL binding12. We used the CTH because it was previously shown to bind and inhibit D14 in vitro, and to form a complex with D14 and (±)-GR2412. We found that Glutathione S-transferase (GST) tagged AtD14 (GST-AtD14) bound to the fluorescein isothiocyanate (FITC)-labeled AtMAX2 CTH peptide in the presence of (±)-GR24. However, this interaction did not take place when AtD14 was incubated with zaxinone prior to adding (±)-GR24 (Fig. 3f). To support these findings, we performed a competition assay, with increasing concentrations of zaxinone, in which we measured the fluorescence polarization of FITC-CTH in the presence of increasing AtD14 concentrations as an indicator of CTH-AtD14 complex formation (Fig. 3g). AtD14 did not interact with CTH in the absence of (±)-GR24 (gray line; Fig. 3g). Adding (±)-GR24 resulted in a strong increase in FITC-CTH fluorescence polarization, which is indicative of binding (red line; Fig. 3g). However, incubation of AtD14 with 10, 50, and 100 µM zaxinone before adding (±)-GR24 blocked the CTH-AtD14 association in a concentration-dependent manner. Incubation with 100 µM zaxinone almost completely blocked the CTH-AtD14 association, as revealed by the lack of increase in fluorescence polarization (blue line; Fig. 3g). Collectively, these results demonstrate that zaxinone interferes with the downstream signaling of AtD14 by competitively occupying its SL binding site without introducing SL-associated conformational changes. Thus, the binding of zaxinone to AtD14 resembles that of Triton X-100 to the Striga SL-receptor ShHTL741. In both cases, the compound stabilized the receptor, precluding the structural changes required for the stable interaction with MAX242,43.

Interestingly, zaxinone has opposite effects on SL biosynthesis in Arabidopsis and rice27,31, although functional SL perception is required for its effects in both species27. Similar to AtD14, zaxinone treatment increased the Tm of OsD14 at different µM concentrations, whereas MP3 treatment led to a decrease in Tm (Supplementary Fig. 14a; Supplementary Table 12–13). Furthermore, tryptophan fluorescence assays confirmed the direct interaction between OsD14 and zaxinone (Supplementary Fig. 14b). Additionally, the binding between OsD14 and zaxinone remained stable for up to two hours, whereas the degradation of MP3 was detected after just one hour (Supplementary Fig. 14c). However, our YLG hydrolysis assay did not indicate any competition between zaxinone and (±)-GR24 for binding with OsD14 (Supplementary Fig. 14d), suggesting disparities in the molecular interactions between OsD14-zaxinone and AtD14-zaxinone. This observation aligns with the differing responses of rice and Arabidopsis to zaxinone treatment and may be a result of the distinct amino acids that are involved in zaxinone binding to the D14 proteins of both species. To evaluate this possibility, we superimposed the zaxinone-bound AtD14 (cyan) with OsD14 (PDB: 5DJ5; Supplementary Fig. 15a), which led to the identification of two amino acid substitutions, Y209F and C241S, in the binding pocket of OsD14. The presence of a tyrosine residue decreases the binding pocket’s volume due to the addition of an OH group, which causes minor clashes with zaxinone. Additionally, both tyrosine (Y) and serine (S) residues render the pocket more hydrophilic at positions where zaxinone displays hydrophobic interactions. This difference is illustrated in the modeling of zaxinone-bound AtD14F159Y_S191C, which mimics OsD14 (Supplementary Fig. 15b). Consequently, these substitutions are anticipated to diminish the pocket binding affinity for zaxinone. We confirmed this hypothesis experimentally by showing that the OsD14Y209F_C241S double mutant has a significantly lower IC50 for zaxinone compared to the wild-type OsD14 (37-fold reduction; Supplemental Fig. 15c). If zaxinone cannot be cleaved, its effect on AtD14 should last longer than that of (±)-GR24, which is hydrolyzed and released. To experimentally confirm this notion, we performed a time-course nanoDSF assay in which we incubated AtD14 with 50 µM ( ± )-GR24 for 0, 0.5, 1, 2, and 4 h or with 20 µM zaxinone for 0, 1, 2, 4, and 6 h. We observed a clear interaction between (±)-GR24 (destabilization by 7.7 ± 0.11 °C) and zaxinone (stabilization by 4.7 ± 0.05 °C) with AtD14 at 0 h. The (±)-GR24-associated Tm rapidly decreased from 7.7 ± 0.11 °C to 1.15 ± 0.05 °C within 2 h and dropped to 0.6 ± 0.05 °C at 4 h, indicating that the hydrolyzed (±)-GR24 was released (Fig. 3h; and Supplementary Fig. 16a and Supplementary Table 12). By contrast, the Tm shift caused by zaxinone treatment remained unaltered throughout the measurement period (above 4 °C; Fig. 3h; and Supplementary Fig. 16a and Supplementary Table 13), indicating that zaxinone remained stable over time.

This mechanism is supported by the finding that disrupting the SL receptor D14 or the SL signaling component MAX2/D3 increased the levels of SLs and related biosynthetic transcripts27,44. Taken together, our results allowed us to uncover a mechanism in which the apocarotenoid zaxinone binds to the binding pocket of the SL receptor AtD14, increasing the expression of SL biosynthetic genes (CCD7 and CCD8), and ultimately SL contents, by interfering with the negative feedback loop that requires the binding of SLs to AtD14. This hypothesis explains why AtMAX2 is required for the effect of zaxinone on SL biosynthesis and the relationship between SL and zaxinone responses.

Zaxinone interacts with AtKAI2

Our nanoDSF assays indicated that zaxinone interacts with AtKAI2, but only at higher concentrations compared to AtD14 (50 µM vs. 10 µM, respectively; Supplementary Fig. 9b and Supplementary Table 4-5), suggesting a weaker interaction with AtKAI2. Additionally, swissdock45,46 estimated stronger binding energy for the AtD14-zaxinone complex (-6.47 kcal/mol) than for AtKAI2-zaxinone (-4.63 kcal/mol), consistent with our binding results. In silico docking placed zaxinone in the active site of AtKAI2 with a binding pose matching that of the crystallographic AtD14-zaxinone complex, indicating that zaxinone likely binds and affects both receptors similarly (Supplementary Fig. 17a–c). We then tested whether AtKAI2 hydrolyzes zaxinone using a time-course experiment analogous to that performed for AtD14, and obtained similar results (Fig. 3h; Supplementary Fig. 16b and Supplementary Table 12). Nevertheless, our transcript data reveal a KAI2-specific response to zaxinone (Supplementary Data 30–32). Moreover, zaxinone treatment repressed the expression of several AtKAI2-dependent genes, including DLK2, SMXL2, and KUF1, in Col-0 but not in Atkai2 plants (Supplementary Data 2 and 14).

In Arabidopsis, the effects of the apocarotenoid zaxinone are largely mediated by the SL receptor AtD14, the KAR receptor AtKAI2, and their downstream signaling component AtMAX2. Despite its structural difference from SLs, zaxinone competitively binds to the active site of AtD14. Thus, zaxinone acts as a long-lasting, non-hydrolysable antagonist that opposes downstream signaling mediated by AtD14 in the presence of SLs by blocking the interaction between AtD14 and AtMAX2. Taken together, our results reveal a receptor for zaxinone and provide evidence that the butenolide hormone receptor AtD14 channel different endogenous signals in Arabidopsis.

Methods

Plant growth and treatments

Arabidopsis wild type (Col-0), Atd14-1, Atkai2-2, and max2-1 mutants (Col-0 background) were previously described47. Freshly propagated seeds were germinated and grown hydroponically in a box system (each box contained 25 lids with 0.5% agarose) supplemented with water and Hoagland (macronutrients in mM: 0.4 K2HPO4 · 3H2O, 0.8 MgSO4 · 7H2O, 0.18 FeSO4 · 7H2O, 5.6 NH4NO3, 0.8 K2SO4, 0.18 Na2EDTA · 2H2O; and micronutrients in µM: 23 H3BO3, 4.5 MnCl2 · 4H2O, 1.5 ZnCl2, 0.3 CuSO4 · 5H2O, and 0.1 Na2MoO4 · 2H2O with adjusted pH value of 5.75) nutrient solution for the first and second week, respectively31. Then, seedlings were transferred to 50 mL black Falcon tubes containing Hoagland nutrient solution and grown for 3 weeks31. Hoagland solution was refreshed every three days. Five-week old plants were treated with zaxinone (20 µM) or with a mock solution (acetone or DMSO) for six hours. Plants were grown in a plant growth chamber (Percival) under controlled conditions (photoperiod of 10/14 h day/night, 22 °C, 55% humidity, and 100 µmol m−2s−1 light intensity).

Seed germination assays

Freshly propagated Arabidopsis wild type Col-0, Atd14, Atkai2, Atmax2, and pyr1/pyl1,2,4,5,836 mutant seeds were surface sterilized with 20% bleach for 15 min and cold-treated for two days in Eppendorf tubes at 4 °C and in dark conditions. Seeds were germinated on Petri dishes containing Murashige and Skoog basal salt (MS) medium (1/2 MS salts + vitamins, 1% agar, 1% sucrose, and pH 5.75) with mock, zaxinone (50 µM) or ABA (2 µM). Then Petri dishes were placed on a phytotron with a photoperiod of 16/8 h day/night, 22 °C, 55% humidity, and 160 µmol m−2s−1 light intensity, for four days. Radicle appearance was recorded after 42-48 hours of treatment, and seedlings were photographed after 4 days of treatment.

Branching assays

Arabidopsis wild type Col-0, Atd14, and Atd14smxl6,7,834 were germinated directly on soil or in Petri dishes with 1/2 MS media for two weeks. After 18 days, Col-0 and Atd14 mutant plants were sprayed with mock, zaxinone (20 µM), and MP3 (5 µM) as a control, once per day (five puffs) for two weeks. The solutions were applied directly to the rosette core and tween-20 (0.01%) was added to each solution to improve the uptake of the compounds by the plant. Axillary shoot branches (> 5 mm) were recorded in 32-34 days old plants after two weeks of treatment.

Root growth assays

Arabidopsis wild type Col-0, Atd14, Atkai2, Atd14-kai2, and Atpyr1pyl1,2,4,5,836 mutants were germinated as described above. After five days growing in Petri dishes located vertically, uniform seedlings were selected and transferred to MS plates (1% agar and 1% sucrose) supplemented with mock, zaxinone (20 µM) or ABA (2 µM). Root length was recorded after one week of treatment.

Hypocotyl elongation assays

Arabidopsis wild type Col-0, Atd14, Atkai2, Atd14-kai2, and Atpyr1pyl1,2,4,5,836 were germinated and grown for three days in MS medium (1/2 MS salts + vitamins, 1% agar, 1% sucrose, and pH 5.75)31. Then, uniform three day-old seedlings were transferred to new Petri dishes (1/2 MS salts + vitamins, 1% agar, and pH 5.75) supplemented with mock, zaxinone (20 µM) or ABA (2 µM). Seedlings were grown vertically under continuous monochromatic red light at 22 °C. After three days of treatment the plates were scanned and hypocotyl length was recorded by using ImageJ software.

RNA extraction and gene expression analysis

Total RNA was extracted from Arabidopsis (WT Col-0, Atd14, Atkai2, and Atmax2) roots employing the TRI-Reagent and Direct-zol RNA Miniprep Kit (Zymo Research, R2072) according to the manufacturer’s instructions. The concentration and quality of the RNA samples was determined using a NanoDropTM 2000 Spectrophotometer. For cDNA synthesis, 1 µg of total RNA was used to synthesize total cDNA using the iScriptTM cDNA synthesis kit, following the manufacturer’s protocol (Bio-Rad, 1708890). Quantitative real-time PCR analysis (qPCR) was performed using the AdvancedTM Universal SYBR Green supermix, according to the manufacturer’s protocol (Bio-Rad, 10000076382). The reaction was prepared in 384-well plates in a total volume of 10 µL. PCR was performed using the StepOnePlusTM Real-Time PCR System. Primer list for ABA, SL and SL-related genes and the normalizer AtCACS (AT5G46630) can be found in the Supplementary Table 1831,33,37,38,39. The expression levels of all analyzed genes was normalized to that of the housekeeping gene AtCACS using the equation of 2−ΔΔCT 48. Four biological replicates and three technical replicates were used. Data visualization and statistical analysis were performed using the GraphPad Prism 9.1 software.

RNA sequencing

RNA sequencing was performed by Novogene (Novogene Co., Ltd., Beijing, China). A total of 2000 ng RNA from Arabidopsis (WT Col-0, Atd14, Atkai2 and max2) samples treated with mock and zaxinone were sent to Novogene. Messenger RNA was purified from total RNA using poly-T oligo-attached magnetic beads. After fragmentation, the first strand cDNA was synthesized using random hexamer primers, followed by the second strand cDNA synthesis using either dUTP for directional library or dTTP for non-directional library49. The directional library was ready after end repair, A-tailing, adapter ligation, size selection, USER enzyme digestion, amplification, and purification. The library was checked with Qubit and real-time PCR for quantification and bioanalyzer for size distribution detection. Quantified libraries were pooled and sequenced on Illumina platforms, according to effective library concentration and data amount and paired-end reads were generated.

RNAseq data analysis

Data analysis was performed by Novogene. Briefly, for quality control, raw data (raw reads) of fastq format were firstly processed through in-house perl scripts. Clean data (clean reads) were obtained by removing reads containing adapter, reads containing ploy-N and low quality reads from raw data. At the same time, Q20, Q30 and GC content the clean data were calculated. All the downstream analyses were based on the clean data with high quality. Reference genome and gene model annotation files were downloaded from genome website (the latest reference genome from TAIR website). Index of the reference genome was built using Hisat250 v2.0.5 and paired-end clean reads were aligned to the reference genome using Hisat2 v2.0.5. We selected Hisat2 as the mapping tool for that Hisat2 can generate a database of splice junctions based on the gene model annotation file and thus a better mapping result than other non-splice mapping tools. The mapped reads of each sample were assembled by StringTie (v1.3.3b)51 in a reference-based approach. StringTie uses a novel network flow algorithm as well as an optional de novo assembly step to assemble and quantitate full length transcripts representing multiple splice variants for each gene locus. FeatureCounts52 v1.5.0-p3 was used to count the reads numbers mapped to each gene. And then FPKM of each gene was calculated based on the length of the gene and reads count mapped to this gene. FPKM, expected number of Fragments Per Kilobase of transcript sequence per Millions base pairs sequenced, considers the effect of sequencing depth and gene length for the reads count at the same time, and is currently the most commonly used method for estimating gene expression levels. Differential expression analysis of two conditions/groups (fours biological replicates per condition) was performed using the DESeq2 R package (1.20.0)53. DESeq2 provide statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting p values were adjusted using the Benjamini and Hochberg’s approach for controlling the false discovery rate. Genes with an adjusted p value (padjust ≤0.05) and an absolute fold change of 2 were assigned as differentially expressed.

Recombinant protein expression and purification

The expression vectors pGEX-6P-1/AtD14 and pGEX-6P-1/AtKAI2 has been described previously6. AtDLK2 CDS sequence was amplified from Arabidopsis cDNA (primers DLK2_HISBAMH1 forward ATTGGATCCATGGTGGTTAATCAGAAGATATCCCG and DLK2_HISR NOT1 reverse TTAGCGGCCGCTCAAGGAGGCGCCTCATGACG). Then, it was cloned into the pQLinkH (plasmid # 13667 Addgene) expression vector for further expression and purification in E. coli. In addition, OsD14Y209F_C241S double mutant was synthesized and cloned by Twist Bioscience (San Francisco, USA) into pJEx411c (His-tag) vector for further expression and purification in E. coli. For GST-tag protein purification, proteins were expressed and purified as previously described in Wang et al.27 with small modifications. Briefly, BL-21 (DE3) E. coli cells carrying the pGEX-6P-1(GST-Tag)/AtD14 or pGEX-6P-1(GST-Tag)/AtKAI2 were incubated at 37 °C until reach an O.D.600 of 0.6. Then, cultures were induced with 0.5 mM isopropyl-β-D-thiogalactopyranoside (IPTG) and grown at 16 °C for 18 hours. Cells were harvested by centrifugation for 10 min at 4667 g at 4 °C and subsequently resuspended in lysis buffer (50 mM Tris-HCl/pH=8, 200 mM NaCl, and 2 mM dithiothreitol/DTT with detergent Triton X100/0.5%). After sonication on ice for 10 minutes (min), the lysate was centrifuged for one hour at 37,156 g at 4 °C. The supernatant was incubated with glutathione-sepharose beads (GE Healthcare) for two hours at 4 °C. The column was washed three times with lysis buffer for 15 min at 4 °C. Afterwards, the GST moiety was cleaved from the protein using PreScissionTM Protease (GE Healthcare) at 4 °C for two hours. The purified protein was concentrated using 10 K Amicon filter units (Merck Millipore).

Concentration dependence and specificity interaction assays using nanoDSF

Arabidopsis AtD14, AtKAI2, and AtDLK2 proteins were obtained as described above. A concentration of 6 µM was used for the thermal stability assays. All proteins and metabolites were diluted to the desired concentration in 1x elution buffer. Concentration curves were assayed for AtD14, AtKAI2, and AtDLK2 incubated with zaxinone (1, 10, 50, and 100 µM), (±)-GR24 (1, 50, 100, and 250 µM), (-)-GR24 (0, 50, 100, 250 and 500 µM) and KAR2 (1, 50, 100, and 250 µM). Specificity assays (AtD14 and AtKAI2) were performed by diluting zaxinone, (±)-GR24, (-)-GR24 and KAR2 in elution buffer to a final concentration of 50 µM. Proteins were diluted to a concentration of 6 µM. Metabolites were incubated with each protein, immediately loaded into the capillaries, and placed in the Prometheus NT.48 (Nanotemper). Capillaries were run according to Veyel et al.54 All experiments were performed at least twice (n = 4-5), and the error provided in the text represent the standard deviation. In all nanoDSF graphs one representative replicate from the unfolding curve for each protein in the absence and presence of the studied metabolite was shown in each graph. Raw data corresponding to the first derivative of the ratio of the fluorescence 350 nm/330 nm was exported to excel and graphs and statistical analysis were performed using the GraphPad Prism 9.1 software. Experiments were also performed for rice OsD14 following the same protocol as for AtD14. Additional experiments for binding specificity were performed using D'Orenone (50 µM), Apo11 (1, 10, 50, and 100 µM) and OH-Apo11 (1, 10, 50, and 100 µM).

Yoshimulactone green (YLG) hydrolysis assay

AtD14 protein (3 µM) was mixed with reaction buffer (1x PBS) in a 100 µL volume on a 96-well black plate (Greiner). The fluorescence intensity in the reaction was measured in a SpectraMaxi3 (Molecular Devices) fluorimeter according to Hameed et al.41 AtD14 was mixed with Zaxinone, and racemic (±)-GR24 using serial dilutions to cover substrates concentration ranges. Protein-substrate mixes were incubated for 30 min. Then, YLG (1 µM; Tokyo Chemical Industry Co. Ltd.) was added and the reaction was incubated for two hours. The change in fluorescence observed over the course of two hours incubation of YLG in buffer without AtD14 was subtracted from the data collected in the presence of AtD14. Relative fluorescence was plotted and inhibitory curves and their respective IC50 values were calculated using GraphPad Prism 9.1 four-parameter logistic curve. Experiments were also performed for rice OsD14 and OsD14Y209F_C241S following the same protocol as for AtD14.

Tryptophan intrinsic fluorescence

The fluorescence emitted from tryptophans in the structure of AtD14 (~10 µM) protein was quantified in a flat-bottomed, black 96-well plate (Greiner) using a SpectraMaxi3 plate reader (Molecular Devices). In the assay, eight different concentrations (0.0048, 0.8, 1.6, 3.12, 6.25, 12.5, 25, and 50 μM) were used for zaxinone and (±)-GR24. Each reaction was done in triplicate and in a final volume of 50 µL using PBS buffer (100 mM phosphate, pH 6.8, 150 mM NaCl). AtD14 tryptophans were excited at 280 nm and emission intensity was measured at 333 nm, and the differences in fluorescence intensity were recorded and analyzed. Data were normalized and dissociation coefficient values (Kd) were calculated by fitting to a binding saturation single-site model with GraphPad Prism 9.1 software. Experiments were also performed for rice OsD14 following the same protocol as for AtD14.

Time-course substrate stability nanoDSF experiments

AtD14 protein 6 µM was incubated with reaction buffer (1x PBS), and at each time point (0, 30, 60, 120, 240 min for (±)-GR24; 0, 15, 45, 120, 240 for MP3; 0, 60, 120, 240, 360 min for zaxinone) GR24, MP3, and zaxinone diluted in PBS were added to the protein solution to initiate the reaction. The final concentration of the metabolites was 50 µM for (±)-GR24 and 20 µM for zaxinone in the interaction assays with AtD14. For AtKAI2 interaction assays (-)-GR24 and zaxinone final concentration was 100 µM. After 4 h ((-)-GR24) or 6 h (zaxinone) incubation at 23 °C, all the reactions were loaded in the capillaries (~12 µL) and placed in PrometheusNT.48 (Nanotemper) device. Samples were run and analyzed as described above. Experiments were also performed for rice OsD14 following the same protocol as for AtD14.

AtD14 protein purification, crystallization and structure determination

Cells were harvested by centrifugation at 8000 g for 15 min. Cells from one-liter culture were re-suspended in 25 ml lysis buffer (50 mM Tris-HCl pH 7.5, 250 mM NaCl, 3 mM DTT, 0.2 % Triton X-100) and lysed by sonication. Cell debris was removed by centrifugation at 75,000 g for 30 min, and proteins were purified from the supernatant using glutathione sepharose 4B resins (GE Healthcare). The N-terminal GST tag of AtD14 was removed by overnight incubation with Prescission Protease (GE healthcare) at 4 °C. After GST cleavage, the resin flow-through containing AtD14 was further purified on a HiLoad16/60 Superdex 200 prep-grade gel filtration column (GE Healthcare) using a buffer containing 20 mM HEPES pH 7.5, 150 mM NaCl, 3 mM DTT. The purified protein was concentrated at 15 mg/ml and stored at -80 °C. 15 mg/ml AtD14 were first mixed with zaxinone in a 1:5 ratio and then co-crystallized by equilibrating 1.0 μl of protein mixed with 1.0 μl of reservoir solution (0.2 M magnesium chloride hexahydrate, 0.1 M Bis-Tris pH 6.5 and 25 % PEG 3350) using the hanging drop vapor diffusion method. The crystals grew in 7 days at 23 °C. For data collection, 25% glycerol was added to the mother liquor as a cryo-protectant, and the crystals were flash-cooled in liquid nitrogen. The data were collected at 100 K in the beamline Proxima 1 at the SOLEIL Synchrotron (France), using EIGER-X 16 M detector (proposal numbers 20201179 and 20210195). The data were processed in XDS, and checked with the online ContaMiner server for contaminant proteins55. The crystal structure of AtD14 was determined by molecular replacement using Balbes56 (CCP4 online) with the AtD14 structure (PDB 4IH4) as a search model. The structure was manually inspected using Coot57 and refined using Phenix Refine58 (Supplementary Table 11). The figures were drawn using PYMOL (pymol.org).

Mutational analysis of the AtD14 structure and the superimposition of OsD14 and AtKAI2 structures over the AtD14-zaxinone structure

In silico site-directed mutagenesis was performed using PyMOL to mutate the AtD14 residues identified as critical for zaxinone binding. The structures of AtKAI2 (PDB: 4HTA) and OsD14 (PDB: 5DJ5) were superimposed on the AtD14-zaxinone structure using PyMOL. After superimposing the models, the side chains of AtKAI2 and OsD14 involved in interactions with zaxinone were checked for clashes with the ligand molecule. The figures were drawn using PyMOL.

Binding energy calculations for zaxinone interactions with AtD14 and AtKAI2

The docking was performed using the SwissDock45,46 web server, and the resulting outputs were analyzed to identify the optimal binding model. The corresponding free energy values associated with the binding interactions were then determined from the output.

Interaction assays with single point amino acid Atd14 mutants

We generated AtD14 (AtD14S97A and AtD14S97C) point mutants in pGEX-6P-1 by using previously published MBP-tagged AtD14S97A and AtD14S97C vectors11. Both mutated versions were expressed and purified as described above. Pure proteins (6 µM) were tested for binding with MP3 and zaxinone at different concentrations (0, 1, 10, 50, 100, and 250 µM). Samples were run and analyzed as described above for the NanoDSF experiments.

GST Pull-down of C-terminal helix (CTH) of AtMAX2

Purified GST-AtD14 was bound to glutathione sepharose 4B beads. GST-bound AtD14 was incubated with 100 μM zaxinone for 4 hours first, and then 100 μM ( ± )-GR24 was added to the same sample for competition experiments. In parallel AtD14 was incubated with 100 μM ( ± )-GR24 only, and AtD14 without the addition of GR24 was used as a control. The N-terminally fluorescein isothiocyanate (FITC) labeled CTH sequence of AtMAX2 (667-693) was synthesized by GenScript Biotech Corp. FITC has an excitation wavelength of 488 nm and emits at 520 nm. FITC-CTH was incubated with the above samples for 2 h and then washed 3 times with buffer (50 mM Tris-HCl, pH 7.5, 250 mM NaCl, 3 mM DTT). Raisin-associated proteins were eluted by adding 20 mM reduced glutathione to the samples. The eluted protein samples were subjected to a Biorad imager using an excitation wavelength of 488 nm.

Fluorescence anisotropy

Fluorescence anisotropy assay was carried out on a PHERAstar plate reader (BMG Labtech) with a filter (480/520 nm) and automated polarizer at 25 °C. In the assay, commercially synthesized CTH peptide of AtMAX2 (Genscript Inc.) was labeled with FITC at the N-terminus. 100 μM ( ± )-GR24 was added to the AtD14, and the AtD14 pre-incubated with 10, 50 or 100 μM zaxinone for 4 hours respectively, these proteins were then titrated against 50 nM FITC-CTH of AtMAX2, starting with 250 μM of AtD14 protein, and then serially diluted until a protein concentration of 490 nM in the buffer containing 50 mM Tris-HCl pH 7.5, 250 mM NaCl, 3 mM DTT.

ABA quantification

We perform ultrasound-assisted extraction (UAE) of plant hormones from Arabidopsis roots following the protocol used in Mi et al.59 Briefly, for the quantification of endogenous hormone levels 20 mg of freeze dried ground root tissues were spike with 2 ng of D6-ABA along with 500 µl of 100% MeOH. Sonicate for 15 min follow by centrifuge at 4 °C, 18,407 g for 8 min. The supernatant is transfer to new 2 ml Eppendorf tube and kept on ice. The extraction was repeated with 500 µl of 100% MeOH without internal standard. Then, the two supernatants were combined into 2 ml Eppendorf tube. Vacuum dry the supernatant collected and stored in -20 °C. Hormones were purified using SPE by dissolving the dried sample in 50 µl MeOH, follow by 1 ml H2O and vortex. C18 SPE column (50 mg/ml) was preconditioned with 1 ml MeOH and 1 ml H2O. Sample solution was loaded onto C18 SPE column held on a vacuum manifold. C18 SPE column was washed with 1 ml of H2O. Plant hormones were eluted with 1 ml of 50% acetonitrile. Samples were dried in a nitrogen concentrator. Plant hormones were quantified using UHPLC-MS (a Vanquish™ Duo UHPLC Systems coupled with a TSQ Altis™ triple quadrupole mass spectrometer (Thermo Scientific) with a heated-electrospray ionization source) by dissolving plant hormone extracts with 100 µl of 50% acetonitrile and vortexed for 10 s. Sample solution were filtered using a 0.2 µm filter into an amber autosampler vial with an insert. Vials were kept at 4 °C. The chromatographic separation was carried out on an ACQUITY UPLC HSS T3 column (2.1 × 100 mm, 1.8 μm, Waters) and a VanGuard pre-column (2.1 × 5 mm, 1.8 μm, Waters) maintained at 40 °C. Mobile phases consist of 5% aqueous acetonitrile (A) and acetonitrile (B), both containing 0.01% formic acid. Both were employed for eluting ABA with the gradient program: 0-12 min, 5% B to 80% B; 12-13 min, 80% B to 100% B; 13-16 min, 100% B at 0.4 mL/min of flow rate. The MS parameters were as follows: negative ion, 3000 V; sheath gas, 45 Arb; aux gas, 10 Arb; sweep gas, 1 Arb; ion transfer tube temperature, 325 °C; vaporizer temperature, 300 °C; cycle time, 1 s; Q1 resolution (FWHM), 0.7; Q3 resolution (FWHM), 0.7; CID gas (mTorr), 1.5; and chromatographic peak width (sec), 6.

SL quantification

Lyophilized Arabidopsis roots were ground to a fine powder. ~20 mg dry weight powder was extracted twice with 1 ml of acetone containing 20 ng GR24 (internal standard) and were sonicated for 15 min at room temperature. After centrifugation, the two extracts were combined and dried under nitrogen. The extract was dissolved in 120 μl of acetonitrile:water (50:50, v:v), followed by filtration using 0.22 μm filter. Detection of MeCLA was performed on UHPLC-Q-Orbitrap-MS (Q-Exactive Plus). Mass Spectrometry parameters were set as follows: capillary temperature of 250 °C, AUX gas temperature of 310 °C, sheath gas of 30 Arb, AUX gas of 10 Arb, spray voltage of 3 kV in positive ion mode, and collision energy of 20 eV in Parallel Reaction Monitoring (PRM) analysis. UHPLC separation was performed on a UHPLC (Thermo ScientificTM UltiMateTM 3000 UHPLC) equipped with an ODS column (Waters C18, 2.1 × 100 mm, 1.7 μm). The column temperature was maintained at 30 °C. The mobile phase consisted of water:methanol 25:75(v/v) (solvent A) and methanol (solvent B), both of which contained 0.1% [v/v] formic acid. LC separation was conducted with a multi-step gradient at a flow rate of 0.2 ml/min. 20% B to 45% B in 5 min; 55% B at 10 min; 85% B at 15 min; 100% B at 17 min, hold at 100% B for 4 min and then equilibrate at 20% for 4 min. Quantification of MeCLA in Arabidopsis was performed with PRM of ion pairs for GR24 and MeCLA using the following mass transitions: GR24 299.0914 > 97.0288; MeCLA 347.18530 > 97.02870.

Striga seed germination assays

Arabidopsis WT and mutant plants treated with mock and zaxinone were compared for their strigolactone producing capacity through parasitic seeds germination bioassays by adopting a procedure described by Jamil et al.60. For the purpose, the Arabidopsis plants were grown hydroponically in boxes and 50 ml tubes for two and three weeks, respectively, under +Pi (32 days) and -Pi (three days) conditions. The strigolactones were collected from the root exudates of each treated plant through C18 column which was applied on pre-conditioned Striga seeds to see effect on germination. For Col-0 and Atd14 bioassays experiment we combined two 50 mL Falcon tubes while for the Col-0, kai2 and max2 experiment, we used one 50 mL Falcon tube to collect the exudates. For the experiment comprising Col-0 and d14smxl6,7,8 quadruple mutant we exposed the plants to one week -Pi to further enhanced SL accumulation and we used one 50 mL Falcon tube to collect the exudates. For pre-conditioning, the Striga hermonthica seeds were surface sterilized with 50% commercial bleach for five minutes and washed with sterilized milliQ water six times. The seeds were dried in a laminar flow cabinet and spread uniformly on 9 mm glass fiber filter paper disks (~50–100 seeds per disc). Then, 12 disks with Striga seeds were transferred into a Petri plate, containing a Whatman filter paper and moistened with 3 ml sterilized water. The Petri plates were sealed and wrapped in aluminum foil and incubated at 30 °C for 10 days. The pre-conditioned seeds were treated with each sample (at 55 µl per disc; n = 4–5 for each treatment) and incubated again at 30 °C for 24 h. The seeds were scanned by a microscope and germinated and total Striga seeds were counted using the software SeedQuant61 to calculate the germination percentage.

Statistical analyses

All experiments were performed with at least 3 biological replicates. Statistical tests were carried out either by ANOVA, non-paired two-tails Student t-test, binding saturation single-site model and four-parameter logistic curve using the software GraphPad Prism 9.1.0. For differential gene expression analysis the package DESeq2 on R was used.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.