GABA-independent activation of GABAB receptor by mechanical forces

Huo, Yujia; Zhou, Yiwei; Lin, Li; Yang, Fan; Meng, Jiyong; He, Feiteng; Zhang, Fengfan; Song, Mengdan; Shen, Cangsong; Liu, Yuxuan; Rondard, Philippe; Xu, Chanjuan; Shawn Xu, X. Z.; Liu, Jianfeng

doi:10.1038/s41467-025-64811-2

Download PDF

Article
Open access
Published: 07 November 2025

GABA-independent activation of GABA_B receptor by mechanical forces

Yujia Huo¹^na1,
Yiwei Zhou¹^na1,
Li Lin¹^na1,
Fan Yang¹,
Jiyong Meng¹,
Feiteng He^1,2,3,
Fengfan Zhang^1,2,3,
Mengdan Song¹,
Cangsong Shen¹,
Yuxuan Liu ORCID: orcid.org/0009-0007-0799-3227¹,
Philippe Rondard⁴,
Chanjuan Xu ORCID: orcid.org/0000-0002-5640-1896^1,5,
X. Z. Shawn Xu ORCID: orcid.org/0000-0001-7102-5035^2,3 &
…
Jianfeng Liu ORCID: orcid.org/0000-0002-0284-8377^1,5,6

Nature Communications volume 16, Article number: 9843 (2025) Cite this article

4498 Accesses
1 Citations
15 Altmetric
Metrics details

Subjects

Abstract

The heterodimeric GABA_B receptor, composed of GB1 and GB2 subunits, is a metabotropic G protein-coupled receptor (GPCR) activated by the neurotransmitter GABA. GABA binds to the extracellular domain of GB1 to activate G proteins through GB2. Here we show that GABA_B receptors can be activated by mechanical forces, such as traction force and shear stress, in a GABA-independent manner. This GABA-independent mechano-activation of GABA_B receptor is mediated by a direct interaction between integrins and the extracellular domain of GB1, indicating that GABA_B receptor and integrin form a mechano-transduction complex. Mechanistically, shear stress promotes the binding of integrin to GB1 and induces an allosteric re-arrangement of GABA_B receptor transmembrane domains towards an active conformation, culminating in receptor activation. Furthermore, we demonstrate that shear stress-induced GABA_B receptor activation plays a crucial role in astrocyte remodeling. These findings reveal a role of GABA_B receptor in mechano-transduction, uncovering a ligand-independent activation mechanism for GPCRs.

Structural basis of GABA_B receptor–G_i protein coupling

Article Open access 28 April 2021

G protein coupling and activation of the metabotropic GABA_B heterodimer

Article Open access 08 August 2022

Filamin A organizes γ‑aminobutyric acid type B receptors at the plasma membrane

Article Open access 03 January 2023

Introduction

γ-Aminobutyric acid (GABA) is the primary inhibitory neurotransmitter in the brain. The GABA_B receptor is a G protein-coupled receptor (GPCR) that binds to GABA^1,2. As a metabotropic receptor, GABA_B receptor plays a crucial role in regulating brain functions and is implicated in various physiological processes, such as locomotion, learning and memory, and cognition^3,4,5,6,7. It facilitates slow and long-term synaptic inhibition by inhibiting voltage-gated Ca²⁺ channels and preventing neurotransmitter release at presynaptic sites⁸. Additionally, it activates G protein-gated inwardly rectifying K⁺ channels and induces slow inhibitory potentials at postsynaptic sites in neurons⁸. GABA_B receptor also has the ability to trigger Ca²⁺ release^9,10and regulate astrocyte morphogenesis^10,11. Dysregulation of GABA_B receptor activity has been implicated in various diseases, such as epilepsy^12,13, anxiety¹⁴, depression^15,16, spasticity¹⁷, addiction¹⁸, pain¹⁹, Rett-like Phenotype²⁰, epileptic encephalopathy²¹, and fragile X syndrome²². Therefore, the GABA_B receptor represents an excellent therapeutic target. Baclofen (Lioresal) is a specific agonist of the GABA_B receptor and is used to treat spasticity in multiple sclerosis and alcohol abuse disorder^23,24,25. Notably, the GABA_B receptor is present not only in the central nervous system but also in peripheral regions such as the gastrointestinal (GI) tract, where it is involved in regulating intestinal motility, gastric emptying, and esophageal sphincter relaxation^26,27,28. This raises the possibility that mechanical forces may regulate GABA_B receptor activity. However, whether mechanical forces can regulate GABA_B receptor activity has not been explored.

GABA_B receptor is a class C GPCR that forms an obligatory heterodimer consisting of two subunits, GB1 and GB2. Each subunit comprises a large extracellular Venus flytrap domain (VFT) followed by canonical seven-transmembrane domains (7TMs)^29,30,31. The VFT domain consists of two lobes: LB1 and LB2³⁰. In the inactive state, GABA_B receptor interacts through the LB1 of two subunits and the intracellular tips of transmembrane domain 3 and 5 (TM3 and TM5)³². Agonists (GABA, baclofen) and antagonists (CGP54626) bind to a large crevice between LB1 and LB2 in the VFT domains of GB1 (VFT_GB1). While the agonists stabilize the closure of VFT_GB1, the antagonists prevent the closure of VFT_GB1 (Fig. 1a). Agonist binding brings LB1 of VFT_GB1 (LB1_GB1) closer to LB2 of VFT_GB1 (LB2_GB1) to stabilize VFT_GB1 closure, further bringing LB2_GB1 and LB2 of GB2 (LB2_GB2) in contact^30,33,34,35. The interplay between LB2_GB1 and LB2_GB2, which is essential for receptor activation, triggers a rearrangement from the inactive 7TM interface formed by intracellular tips of TM3 and TM5 of GB1 and GB2 to the active interface formed by TM6 of GB1 and TM6 of GB2, leading to the coupling of G_i/o proteins to GB2 in a shallow pocket formed by TM3 and three intracellular loops^{30,33,34,35,36} (Fig. 1a). Additionally, positive allosteric modulators (PAMs) of GABA_B receptor, such as Rac BHFF, GS39783 and CGP7930, bind within the TM6-TM6 interface to stabilize the active conformation of the receptor^30,33,34,37. This mode of GABA_B receptor activation has been extensively characterized and validated using multiple approaches. However, it is unclear whether additional mechanisms are in place to activate GABA_B receptor.

**Fig. 1: Traction force and shear stress activate GABA_B receptor.**

Here, we report a ligand-independent activation mechanism of the GABA_B receptor. We found that the GABA_B receptor can be activated by mechanical forces (e.g., traction force and shear stress) independent of GABA. We demonstrated that GABA_B receptors and integrins form a mechano-transduction complex and that shear stress-induced GABA_B receptor activation plays a crucial role in astrocyte remodeling. Thus, our findings reveal a role of the GABA_B receptor in mechano-transduction, uncovering a ligand-independent activation mechanism for GPCRs.

Results

GABA_B receptor is activated by mechanical forces

GABA_B receptor can be activated in a ligand-dependent manner by agonists, such as GABA and baclofen (Fig. 1a). However, whether a ligand-independent stimulus, such as mechanical force, can activate GABA_B receptor remains unknown. To test this possibility, we explored whether different forces, such as traction force and shear stress, play a role in GABA_B receptor activation (Fig. 1b). Both traction force and shear stress are common mechanical forces experienced by cells^38,39,40. We first examined the traction force. When growing on the surface of a substrate such as a culture dish coated with poly-D-lysine (PDL), cells usually adhere to the surface of the dish, and traction force develops between the cytoskeleton and extracellular matrix (ECM)⁴¹. However, no such traction force was observed in cells growing in suspension⁴². In addition, coating the culture dish with specialized ECM proteins, such as fibronectin (FN), which binds to the cell surface protein integrin, enhances traction force and promotes cell adhesion^43,44,45. Myosin II activity is commonly used as a reliable readout of traction force in the cell^46,47. We found that in cultured HEK293 cells, myosin II activity was nearly undetectable in suspension cells; in contrast, myosin II activity was clearly observed in adherent cells growing on PDL-coated dishes (Supplementary Fig. 1a). Treatment with FN further increased myosin II activity in adherent HEK293 cells (Supplementary Fig. 1b). These results are consistent with the notion that traction force develops in adherent cells and further increases when cells were attached to ECM proteins⁴⁸.

We then examined the activity of the GABA_B receptor in both adherent and suspended HEK293 cells expressing the GABA_B receptor and a chimeric Gq_i9, in which the G_i/o-coupled GABA_B receptor can couple to the PLC pathway³⁷. We thereby measured the production of the downstream metabolite inositol monophosphate (IP₁), using a commonly used assay that reports GPCR activity⁴⁹. Interestingly, when cells expressing GABA_B receptor were attached on dishes coated with PDL, the IP₁ production was significantly increased compared with that in suspension condition (Fig. 1c, left panel). The activity of GABA_B receptor was further increased in adherent cells growing on FN-coated dishes compared with PDL-coated dishes (Fig. 1c, middle panel). Disruption of traction force by blebbistatin, which inhibits myosin II cross-bridge cycling⁵⁰, blocked GABA_B receptor activity in adherent cells (Supplementary Fig. 1c). These results reveal a correlation between the GABA_B receptor activity and traction force, suggesting that mechanical forces can activate GABA_B receptor. Because FN coating reflects a more physiological condition, we decided to focus on characterizing cells growing under this condition. Next, we evaluated the effect of shear stress on the GABA_B receptor. Shear stress increased IP₁ production in adherent HEK293 cells expressing the GABA_B receptor and Gq_i9 but not in control cells expressing only Gq_i9 (Fig. 1c, right panel). This experiment suggests that shear stress can also activate the GABA_B receptor.

While IP₁ production serves as a reliable readout for GABA_B receptor activation, it only reports the accumulative rather than the dynamic activity of GABA_B receptor. To provide further evidence, we performed calcium imaging experiments to monitor the dynamic activity of GABA_B receptors in response to shear stress in real-time. We found that shear stress could also induce GABA_B receptor activity in cells expressing GABA_B receptor and Gq_i9 shown by the calcium imaging assay (Fig. 1d). A transient increase of Ca²⁺ release was observed after shear stress application, which quickly peaked and then gradually decreased to basal levels (Fig. 1d). The kinetics of shear stress-induced Ca²⁺ were slower, and the strength of shear stress-induced Ca²⁺ was lower than that of baclofen (Supplementary Fig. 1d). No such activity was observed in the control cells expressing only Gq_i9 (Supplementary Fig. 1e). Thus, both assays reveal that shear stress can activate GABA_B receptor. Taken together, these results demonstrated that GABA_B receptor can be activated by mechanical forces. No GABA or any other GABA_B receptor agonist was present in our assays and the concentration of GABA in the medium or the buffer was very low (Supplementary Fig. 2), indicating that the observed mechano-activation of the GABA_B receptor is ligand-independent.

Finally, to determine whether traction force directly activates GABA_B receptor-mediated G_i/o protein signaling, we employed an optimized bioluminescence resonance energy transfer (BRET)-based Gi protein sensor under physiological conditions, as recently described⁵¹. In this assay, we transfected only G_αi1-Nluc and Venus-G_γ2, omitting exogenous G_β subunits. Since functional G protein signaling requires the formation of a G_αβγ heterotrimer, this design ensures that G_i activation depends exclusively on endogenous G_β subunits. Consequently, BRET signal generation is constrained by the availability of endogenous G_β to complex with Venus-G_γ2 (Fig. 1e, left panel). As a positive control, GABA increased the net BRET in cells expressing GABA_B receptor and G_i protein sensor in both suspension and adhesion conditions, demonstrating sensor sensitivity (Fig. 1e, right panel). Traction force-induced net BRET was calculated by subtracting the BRET ratio in adhesion conditions from that in suspension. Cells expressing GABA_B receptor exhibited a significant increase in traction force-induced net BRET compared to vector-expressing controls (Fig. 1e, middle panel), indicating that mechanical force activates G_i signaling downstream of GABA_B receptor.

Mechano-activation of GABA_B receptor occurs through a physical interaction with integrin

How is GABA_B receptor activated by mechanical forces? The observation that the GABA_B receptor can be activated in adherent cells but not in suspension cells indicates that the mechano-activation of GABA_B receptor is cell condition-specific, suggesting the participation of additional proteins. As the ECM protein FN greatly enhanced the mechano-activation of GABA_B receptor (Fig. 1c) and FN acts by directly binding to the cell surface protein integrin⁵², we hypothesized that integrin may be involved in the mechano-activation of GABA_B receptor. The fact that integrin is a mechano-sensor, which connects both ECM proteins and the cytoskeleton and is sensitive to traction force and shear stress^53,54, further supports this model. To test this model, we turned our attention to integrin β₃, which is the primary receptor for FN^55,56. As a receptor of FN, integrin β₃ can function as a heterodimer with integrin α_v⁵⁷. Knockdown of integrin β₃ by siRNA abolished traction force-induced GABA_B receptor activation (Fig. 2a, Supplementary Fig. 3a). These results suggest that integrin β₃ plays an important role in the mechano-activation of GABA_B receptor.

**Fig. 2: Mechano-activation of GABA_B receptor requires integrin β₃ interaction.**

To investigate how integrin β₃ mediates the mechano-activation of GABA_B receptor, we asked whether GABA_B receptor physically interacts with integrin β₃. Indeed, when expressed in HEK293 cells, GABA_B receptor co-immunoprecipitated (co-IP) with endogenous integrin β₃. This was performed using two different approaches to tag (HA tag and Snap tag) the GB1 subunit of GABA_B receptor (Fig. 2b, Supplementary Fig. 3b–d). We also detected integrin α_v in the complex (Supplementary Fig. 3e), which is consistent with the notion that integrin β₃ functions as a heterodimer with integrin α_v^52,58. Thus, GABA_B receptor and integrin α_vβ₃ appear to form a protein complex. In support of this, we found that GABA_B receptor and integrin β₃ also co-localized in HEK293 cells (Supplementary Fig. 3f). These results together demonstrate GABA_B receptor physically interacts with integrin α_vβ₃ to form a protein complex.

Interestingly, the interaction between integrin β₃ and GABA_B receptor appeared to be much stronger in adherent cells (Fig. 2c). Disruption of traction force using blebbistatin greatly diminished the interaction between integrin β₃ and GABA_B receptor (Fig. 2d, Supplementary Fig. 3g). Conversely, applying shear stress to HEK293 cells further enhanced integrin β₃ and GABA_B receptor interaction in these cells (Fig. 2c). These findings indicate that mechanical forces promote the formation of a GABA_B receptor-integrin α_vβ₃ complex by facilitating the interaction between the two proteins.

To provide further evidence that integrin α_vβ₃ and GABA_B receptor physically interact with each other, we tested the inhibitor and the antagonist. The integrin β₃ inhibitor RGDS and the GABA_B receptor antagonist CGP54626 both inhibited the interaction between integrin β₃ and GABA_B receptor (Fig. 2e, f, Supplementary Fig. 3g). This suggests that the interaction between integrin β₃ and GABA_B receptor is rather specific. Furthermore, the formation of GABA_B receptor and integrin α_v β₃ complex increased with GABA treatment (Supplementary Fig. 3h). Overall, our observation suggests that the formation of GABA_B receptor-integrin α_vβ₃ complex may depend on their active conformation.

We then investigated whether the interaction between GABA_B receptor and integrin α_vβ₃ is direct. To test this, we performed a BRET titration experiment^59,60. The energy donor Rellina luciferase (Rluc) and the energy acceptor Venus were attached to the C-terminus of GB1 or GB2 subunit of GABA_B receptor, integrin β₁, integrin β₃, and integrin α_v (named as GB1_Rluc, GB2_Rluc, integrin β_1Venus, integrin β_3Venus, and integrin α_vVenus), respectively (Fig. 2g). Within a distance of 10 Å, energy transfer occurs between Rluc and Venus, which would indicate a direct interaction between the two proteins. In this assay, by examining the BRET ratio as a function of the relative amounts of the two tested proteins, one would not only be able to evaluate if a direct interaction occurs between the two proteins, but also can assess the relative strength of the interaction. We first performed control experiments. While no BRET signals were detected between Venus and GABA_B receptor (negative control), strong BRET signals were observed between mGlu2 and 5-HT_2a that are known to directly interact (positive control)⁶¹, validating the assay. Importantly, we observed strong BRET signals between GABA_B receptor and integrin β₃ (Fig. 2h)_. These BRET signals were much more robust than those between mGlu2 and 5-HT_2a, suggesting that the interaction between GABA_B receptor and integrin β₃ is stronger than that between mGlu2 and 5-HT_2a, which has been demonstrated to form oligomer⁶¹. By contrast, weak, if any, BRET signals were detected between integrin α_v and GABA_B receptor (Fig. 2h). Thus, although integrin α_v was present in the integrin α_vβ₃-GABA_B receptor complex (Supplementary Fig. 3e), it did not appear to directly interact with GABA_B receptor, further supporting the model that integrin β₃ rather than α_v directly interacts with GABA_B receptor. Notably, the BRET signals between GB1 and integrin β₃ were much more robust than those between GB2 and integrin β₃, suggesting that GABA_B receptor interacts with integrin β₃ primarily via its GB1 subunit (Fig. 2i). These results demonstrate that the mechano-activation of GABA_B receptor requires integrin α_vβ₃, which is primarily mediated by a direct interaction between integrin β₃ and the GB1 subunit of GABA_B receptor. Taken together, our data suggest that GABA_B receptor responds to mechanical forces through a mechano-transduction complex formed with integrin α_vβ₃ and that mechanical forces can promote the formation of this protein complex. FN can also bind to integrin α_vβ₁⁶². BRET signals were also observed between integrin β1 and GABA_B receptor (Supplementary Fig. 4a), suggesting the formation of mechano-transduction GABA_B receptor complex with FN-related integrin proteins. Interestingly, other ECM proteins, such as collagen I, also increased GABA_B receptor activation (Supplementary Fig.4b), suggesting the involvement of other integrin subtypes.

Both GB1 and GB2 are required for GABA_B receptor activation by mechanical forces

As GABA_B receptor interacted with integrin β₃ primarily through its GB1 subunit, we wondered if GB1 alone can interact with integrin β₃. As GB1 alone cannot localize to the plasma membrane, we tested GB1_ASA, a GB1 subunit mutant which can localize to the cell surface on its alone⁶³, and found that it cannot be activated by traction force (Fig. 3a). A similar phenomenon was observed with GB2 alone (Fig. 3a). Thus, both GB1 and GB2 subunits are required for the mechano-activation of GABA_B receptor. As GB2 is responsible for coupling G proteins to GABA_B receptor upon agonist binding, we tested GB2_L685P, a mutant form of GB2 that is incapable of activating G proteins⁶⁴. The traction force failed to induce GABA_B receptor activation in HEK293 cells expressing GB1 and GB2_L685P (referred to as GABA_B-ΔG) together with Gq_i9 (Fig. 3b). Thus, similar to ligand-dependent activation of GABA_B receptor, mechanical activation of this receptor also requires coupling of G proteins to the receptor via the GB2 subunit. These results indicate that while GABA_B receptor interacts with integrin β₃ primarily via the GB1 subunit, the GB2 subunit is also necessary for GABA_B receptor activation by mechanical forces and this ligand-independent activation mode required G protein coupling to GB2. Thus, both GB1 and GB2 subunits participate in the formation of the mechano-transduction complex with integrin α_vβ₃.

**Fig. 3: Both GB1 and GB2 subunits are required for GABA_B receptor activation by mechanical forces.**

Furthermore, to understand how mechano-activation occurs through the interaction between the GB1 and GB2 subunits, we generated a GB1 mutant by inserting two mutations (S246A and E465A) into GB1_VFT (referred to as GABA_B-ΔB) as previously reported^65,66,67 to prevent GABA binding but not to prevent the closure of GB1_VFT-brought GB1_LB2 and GB2_LB2 in contact (Fig. 3b). The GABA_B-ΔB composed by this GB1 mutant and GB2 wild type can still be activated by traction force to the similar extend as GABA_B receptor (Fig. 3b), demonstrating GABA-binding into GB1_VFT was not required in mechano-activation of GABA_B receptor and indicating that mechano-force alone also stabilize the closure of GB1_VFT-brought LB2 of two subunits in contact. An antagonist (CGP54626) can prevent GB1_VFT closure-induced two LB2 in contact³³. CGP54626 completely blocked traction force-induced GABA_B receptor activation, indicating that mechano-force induced GABA_B receptor activation requires the closure of GB1_VFT-brought two LB2 of two subunits in contact (Fig. 3c). This data is also consistent with the observation that CGP54626 inhibited the interaction between integrin β₃ and GABA_B receptor (Fig. 2f) whereas GABA_B-ΔB still interacts with integrin β₃ (Supplementary Fig. 4c). Overall, our results show that the traction force-activated GABA_B receptor requires both GB1 and GB2 subunit, and is dependent on the closure of GB1_VFT-induced LB2_GB1 and LB2_GB2 in contact, and GB2 subunit for G protein coupling, but independent of GABA binding, suggesting that mechano-force acts as a positive allosteric modulator agonist (PAM ago) of the GABA_B receptor.

Mapping the region in GABA_B receptor that interacts with integrin β₃

We then sought to map the region in GB1 that interacts with integrin β₃. First, we examined the role of VFT in the extracellular domain of GB1 (VFT_GB1). Deleting VFT in GB1with a truncated GABA_B receptor (GABA_B-ΔVFT) lacking the VFT domain of GB1 (GB1-ΔVFT) (Fig. 4a), abolished the interaction between integrin β₃ and GABA_B receptor, revealing a key role of VFT_GB1 in mediating the interaction (Fig. 4b, Supplementary Fig. 5a). Similarly, traction force and shear stress failed to induce GABA_B-ΔVFT activation in HEK293 cells (Fig. 4c, d), indicating that the VFT_GB1 is required for the mechano-activation of GABA_B receptor. Both results suggest that the VFT_GB1 may mediate the physical interaction between GB1 and integrin β₃.

**Fig. 4: VFT of GB1 is responsible for the interaction between GABA_B receptor and integrin β₃, and the mechano-activation of GABA_B receptor.**

Next, we used a glycan wedge scanning approach to map the interaction interface between the VFT_GB1 and integrin β₃. A consensus sequence NXS/T was introduced into GB1_VFT to enable the conjugation of a bulky N-glycan moiety to the side chain of the Asn residue, thereby forming a steric wedge to prevent GB1 from interacting with other proteins⁶⁸. We selected seven GB1 mutants: 320^STL322 (M1), 326^EER328 (M2), 330^KEA332 (M3), 337^TFR339 (M4), 347^AVP349 (M5), 352^NLK354 (M6) and 356^QDA358 (M7) (Fig. 5a–c). We have previously shown that the presence of an N-glycan moiety in these mutants do not affect agonist-induced GABA_B receptor activation⁶⁸. We found that although the traction force failed to activate M2, M4, M6 and M7, it was still able to activate M1, M3 and M5 (Fig. 5d). Moreover, the amount of integrin β₃ co-IPed with GB1 was greatly reduced in M7 mutant, but not in M3 mutant (Supplementary Fig. 5b). This indicates that residues 326-328, 337-339, 351-353 and 356-358 in GB1_VFT are important for its interaction with integrin β₃. Interestingly, these sequences in GB1 are highly conserved across different species (human, mouse, C. elegant, D. melanogaster, R. norvegicus, B. taurus, C. sabaeus), especially the last 5 residues RQDAR (Supplementary Fig. 5c). We thus tested this RQDAR motif in GB1_VFT, and found that the GABA_B-5A mutant (GB1^RQDAR-5A + GB2), in which RQDAR were mutated into five A (Ala) residues (Fig. 5b), exhibited a much weaker interaction with integrin β₃ (Supplementary Fig. 5d). Importantly, this GABA_B-5A mutant could still be activated by GABA (Fig. 5e), but lost sensitivity to traction force and shear stress (Fig. 5f–g). This set of experiments demonstrates that the GB1 subunit of GABA_B receptor interacts with integrin β₃ via its VFT domain and that the RQDAR motif in VFT_GB1 is important for GABA_B receptor’s interaction with integrin β₃ as well as its activation by mechanical forces.

**Fig. 5: Mapping the interaction region between GABA_B receptor and integrin β₃.**

Mechano-force acts as a positive allosteric modulator agonist (PAM ago) for GABA_B receptor activation

Ligand-induced GABA_B receptor activation features a close contact between LB2_GB1 and LB2_GB2, further triggers an allosteric rearrangement of 7TMs at the TM6-TM6 interface between GB1 and GB2 subunits (Fig. 6a), which is considered as a hallmark of the active state of GABA_B receptor^{30,33,34,35,36}. Upon ligand binding, the two Val residues in TM6 of GB1^6.56 and GB2^6.56 turn close to each other in the active state of the receptor³⁶ (Fig. 6b). The close proximity of the two Val residues in this active state enables the formation of GB1-GB2 dimers through covalent cross-linking of the two subunits, in which the two Val residues are mutated to Cys residue: GB1^6.56C and GB2^{6.56C 36}. Thus, this assay allows the probing of the active state of GABA_B receptor in HEK293 cells transfected only with GB1^6.56C and GB2^6.56C. Consistent with our previous reports, GABA treatment promoted the formation of GB1^6.56C-GB2^6.56C dimers³⁶. Of primary significance, shear stress also promoted the formation of GB1^6.56C-GB2^6.56C dimers (Fig. 6c). Furthermore, FN-treatment also increases the formation of GB1^6.56C-GB2^6.56C dimers (Fig. 6d, e). In all, this set of experiments demonstrates that mechanical forces can facilitate an allosteric interaction between two VFTs to further induce re-arrangement of 7TMs of GABA_B receptor towards an active conformation in a manner similar to that induced by ligand binding, demonstrating that the mechanical force acts as a PAM agonist for GABA_B receptor activation.

**Fig. 6: Mechano-force acts as a PAM ago for GABA_B receptor activation.**

We also observed that FN-treatment increases of GABA-induced formation of GB1^6.56C-GB2^6.56C dimers (Fig. 6d, e), suggesting the PAM effect of mechano-force on GABA-induced activation of GABA_B receptor. We further verified whether and how mechanical forces allosterically regulate GABA-induced GABA_B receptor activity. Interestingly, both the efficacy and potency of GABA-induced receptor activation was increased under adhesion and FN-treated conditions (suspension vs adhesion, E_max: 256 nM vs 552 nM, EC₅₀: 0.18 μM vs 0.08 μM; PDL vs FN, E_max: 168 nM vs 257 nM, EC₅₀: 0.19 μM vs 0.02 μM) (Fig. 6f-g), highlighting the potential PAM effect of mechano-force on GABA-induced GABA_B receptor function in vivo.

Finally, we used a FRET-based inter-subunit sensor of the GABA_B receptor to measure the conformational change between two VFTs of GABA_B receptor, as previously reported by us⁶⁹ (Supplementary Fig. 5e), while GABA treatment induced a significant decrease of FRET signal (Supplementary Fig. 5f). The present FRET-based assay is specifically configured for 96-well plate measurements and therefore cannot be implemented in shear stress experiments. To address this limitation while maintaining mechanosensitive responses, we utilized FN-coated substrates to enhance cellular traction forces. FN coating alone induced statistically significant FRET changes (Supplementary Fig. 5g), suggesting the traction force-induced GABA_B receptor conformational change. However, the detailed mechanism requires further investigation.

GABA_B receptor is required for shear stress-induced remodeling of astrocytes

Having characterized the mechanisms underlying GABA_B receptor activation by mechanical forces, we investigated whether and how mechanical force may regulate cellular physiology. GABA_B receptors are widely expressed in many types of neurons in the brain⁸. However, the relatively low abundance and high heterogeneity of neurons (compared to glial cells) pose a challenge for investigating this question in neurons. In addition to neurons, GABA_B receptors are also broadly expressed in glial cells, particularly in astrocytes^9,11, which are the most abundant neural cells in the brain⁷⁰. In response to mechanical insults experienced during traumatic brain injury, astrocytes undergo morphological, molecular, and functional remodeling, which transforms them into reactive astrocytes in a process called reactive astrogliosis⁷¹. Reactive astrocytes play an important role in tissue repair and remodeling following brain trauma^72,73,74. Other pathological conditions such as infection, ischemia, epilepsy, and cancer also trigger reactive astrogliosis^{73,75,76,77,78}. The robust remodeling of astrocytes induced by mechanical insults, high abundance of these glial cells in the brain, and relative ease of culture prompted us to explore whether GABA_B receptors contribute to mechano-induced reactive astrogliosis. To do so, we cultured primary astrocytes isolated from the mouse brain and assayed the effects of shear stress on their remodeling. We found that shear stress greatly increased the size of astrocytes and their expression of glial fibrillary acidic protein (GFAP) (Fig. 7a-c), two key parameters of astrocyte reactivity^78,79, indicating that shear stress promoted reactive astrogliosis. Importantly, siRNA knockdown of the GABA_B receptor abolished the shear stress-induced increase in the size of astrocytes as well as the expression level of GFAP, pointing to a key role of GABA_B receptor in the process (Fig. 7a-d). Additionally, baclofen and GABA increased both cell size and GFAP expression of astrocytes (Supplementary Fig. 6), which mimicked the effect of shear stress, demonstrating the physiological role of GABA_B receptor activation in astrocyte remodeling. Notably, physiological GABA levels (10 nM)^80,81 failed to increase cell size or GFAP expression or synergize with shear stress (Supplementary Fig. 6d-f). However, shear stress alone and 100 µM GABA produced similar effects, suggesting that maximal GABA_B receptor activation and mechanical stimulation may converge on common downstream pathways. Together, these results demonstrate that shear stress-induced reactive astrogliosis requires GABA_B receptors.

**Fig. 7: GABA_B receptor is required for shear stress-induced astrocyte remodeling.**

Shear stress activates astrocytes in a GABA_B receptor-dependent manner

The finding that GABA_B receptors are required for shear stress to promote reactive astrogliosis suggests that shear stress may activate GABA_B receptors in these primary cells just like when it was expressed in HEK293 cells. To test this hypothesis, astrocytes were recorded using calcium imaging to determine their response to shear stress. In astrocytes, Ca²⁺ is a major downstream event of GABA_B receptor and dependent on G_i/o protein, as previously reported^{9,82,83,84,85}. The pre-treatment of PTX totally blocked the baclofen-induced Ca²⁺ release in astrocytes (Supplementary Fig. 7a). Therefore, no transfection of G protein chimera was required to detect GABA_B receptor-induced Ca²⁺ signal in astrocytes. The cells with Ca²⁺ activation was characterized as previously⁸⁶ by an increasing in the Ca²⁺ signal to reach a peak after stimulus and sustain for more than 5 s. Owning to the heterogeneity of primary astrocytes, approximately 37.29% of astrocytes were sensitive to baclofen and were found to induce Ca²⁺ release, similar to a previous report⁹. About half (45.76%) of the astrocytes were sensitive to shear stress with a transient but significant increase of the Ca²⁺ signal (Fig. 8a). Among them, 62.04% were sensitive to baclofen, a GABA_B receptor-specific agonist, indicating that most shear stress-sensitive astrocytes expressed GABA_B receptors (Fig. 8a-b). Notably, siRNA knockdown of the GABA_B receptor greatly reduced the population of astrocytes that were sensitive to baclofen (reduced to 6.69% from 37.29%) (Supplementary Fig. 7b–d) as well as shear stress (reduced to 13.49% from 45.76%) (Fig. 8c, d), indicating that GABA_B receptors play a crucial role in mediating shear stress-induced response in these primary cells. The strength of the Ca²⁺ signal was significantly decreased for both shear stress and baclofen treatment when GABA_B receptor was knocked down, whereas as a control, the population of astrocytes with ATP sensitivity remained 100% and the Ca²⁺ signal was still strongly activated (Supplementary Fig. 7e). Furthermore, PTX pre-treatment also decreased the population of shear stress-sensitive cells from 45.76% to 28.57% (Supplementary Fig. 7f), indicating the involvement of G_i/o protein for shear stress-induced Ca²⁺ release in astrocytes. Overall, we demonstrated that shear stress can activate astrocytes in a GABA_B receptor-dependent manner. This suggests a model in which shear stress can activate GABA_B receptors in astrocytes, triggering reactive astrogliosis.

**Fig. 8: Shear stress activates GABA_B receptor in astrocytes.**

Discussion

As a classic class C GPCR, the activation mechanism of GABA_B receptor has been extensively characterized at both the biochemical and structural levels, which features a series of ligand binding-induced structural rearrangements in the receptor, culminating in its formation of a ternary complex with heterotrimeric G_i/o proteins^30,87. In this study, we found that GABA_B receptors were activated by mechanical forces in a GABA-independent manner. To the best of our knowledge, this is the first report of a ligand-independent activation mechanism for GABA_B receptor.

It is notable that the GABA_B receptor forms a protein complex with integrin and that GABA_B receptor sensing of mechanical forces requires a direct interaction with integrin. We thus propose that GABA_B receptor and integrin form a mechano-transduction complex. In this complex, integrin likely functions as a mechano-sensor, as integrin is well-known to sense mechanical forces such as traction force and shear stress in cellular mechanotransduction^53,88. On the other hand, as blocking integrin function or inhibiting its expression abolishes the mechano-activation of GABA_B receptors, GABA_B receptors may not directly sense mechanical forces but rather function as a transducer that transduces mechanical signals to downstream G proteins. Here we showed that GABA_B receptor interacts with the integrin subunit β3 and β1. Other integrins may also be involved as FN and RGDS can bind to several integrin types^57,62. A growing list of GPCRs have been reported to be mechanosensitive, such as AT1R^89,90, H1R^90,91, bradykinin B2R⁹², GPR68⁹³, and adhesion GPCRs^94,95,96. Unlike GABA_B receptors, these mechanosensitive GPCRs are believed to directly sense mechanical forces as a mechano-sensor, though the underlying mechano-transduction mechanisms are not well understood. Thus, GABA_B receptor represents the first GPCR that acts as a mechano-transducer rather than a mechano-sensor, revealing a role for GPCRs in mechano-transduction.

Strikingly, although mechanical forces activate GABA_B receptor in the absence of ligand binding, they trigger an allosteric rearrangement of the 7TMs in GABA_B receptor towards an active state in a manner similar to that induced by ligand binding. Specifically, both ligand binding and shear stress induced a similar allosteric rearrangement of 7TMs in the TM6-TM6 interface of the GB1 and GB2 subunits. This structural rearrangement has been shown to open a shallow cavity at the intracellular side of GABA_B receptor to provide access for G protein binding^{30,33,34,35,36}, which is a hallmark of the active state of GABA_B receptor. Notably, agonists such as GABA and baclofen bind to a larger crevice between LB1 and LB2 of VFT_GB1 to bring the two LB2 of two subunits in contact. As shear stress promotes the binding of integrin to LB2 of VFT_GB1, it is conceivable that shear stress may activate the GABA_B receptor by promoting integrin binding to LB2 of VFT_GB1, which in turn pushes the two LB2 in contact and triggers an allosteric rearrangement of 7TMs in the TM6-TM6 interface towards an active conformation, culminating in receptor activation. In this regard, shear stress-induced binding of integrin to GB1 would mimic the role of ligand (e.g. GABA) binding to GB1 in GABA_B receptor activation, providing a potential molecular mechanism by which mechanical forces activate GABA_B receptor and allosterically potentiate the GABA effect as a PAM ago (Fig. 9). It is also different from the adhesion GPCRs, which act as mechano-sensors and rely on an extremely large N terminus for ECM recognition and an autoproteolysis domain that undergoes self-cleavage for receptor activation^94,96. The GABA_B activation showed faster under baclofen treatment than shear stress induced Ca²⁺ signal in our experiments, which was also observed in GPR68⁹³. However, fundamental differences in stimulus application preclude strict kinetic comparisons: Baclofen can be applied locally at saturating concentrations for rapid, complete receptor activation, whereas higher shear stresses needed to accelerate mechano-activation would detach cells, compromising reliable signal detection.

**Fig. 9: Schematic model of GABA-independent allosteric activation of GABA_B receptor by mechanical forces through integrin interaction.**

We showed that shear stress could stimulate the activity of primary astrocytes in a GABA_B receptor-dependent, but GABA-independent manner. We also found that shear stress promotes reactive astrogliosis, a process by which astrocytes undergo remodeling in response to pathological conditions, such as brain trauma, to transition into reactive astrocytes that are important for tissue repair^72,73,74. Although the brain is typically considered as a protected organ, it may also experience transient shear stress, such as during traumatic brain injury, which can generate both localized and distributed forces throughout the brain^72,73,97. Importantly, shear stress-induced reactive astrogliosis requires GABA_B receptor. These results together suggest a model in which mechanical forces activate GABA_B receptors in astrocytes to promote reactive astrogliosis. Although GABA_B receptor appears to a major contributor to astrocyte mechano-sensitivity, siRNA knockdown of the GABA_B receptor eliminated most but not all mechanosensitive astrocytes. This is consistent with the notion that additional mechano-sensors are present in these glial cells, such as mechanosensitive Piezo channels as reported recently⁹⁸.

As the sole metabotropic GABA receptor, GABA_B receptor regulates a wide spectrum of physiological processes, ranging from synaptic inhibition to locomotion⁷, cognition⁶, addiction¹⁸, epilepsy^12,13, and astrocyte morphogenesis^10,11. To date, all the physiological functions carried out by GABA_B receptor have been attributed to its activation by GABA. Our discovery of a GABA-independent activation mechanism of the GABA_B receptor and its crucial role in promoting astrocyte remodeling raises the possibility that this mode of activation may contribute to additional aspects of GABA_B receptor functions in the brain. Our work also raises the possibility that other GPCRs could be potentially sensitive to mechanical forces by forming a mechano-transduction complex with integrin.

Methods

Antibodies

Mouse monoclonal GB1 antibody targeting the extracellular domain (#55051, 1:1000) was acquired from Abcam (Shanghai, China), and GB1 polyclonal antibody (#BS2717, 1:1000) was obtained from Bioworld Technology (Shanghai, China). Integrin β₃ antibody (#sc-46655, 1:100) and anti-mouse IgG (#sc-2025, 1:500) for the co-immunoprecipitation experiment were purchased from Santa Cruz Biotechnology (Shanghai, China). Integrin α_v antibody (#A2091, 1:1000) was purchased from ABclonal Technology (Wuhan, China). Integrin β₃ antibody (#13166, 1:1000), β-actin (#4967, 1:1000), phospho-Myosin Light Chain 2 (MLC-PP, #3675, 1:1000), GFAP (#3670, 1:1000), anti-mouse IgG HRP-linked antibody (#7076, 1:10000), anti-rabbit IgG HRP-linked antibody (#7074, 1:10000), anti-rabbit IgG (H + L) (DyLight^TM 800 4X PEG Conjugate) (#5151, 1:10000) and anti-mouse IgG (H + L) (DyLight^TM 800 4X PEG Conjugate) (#5257, 1:10000) were purchased from Cell Signaling Technology (Shanghai, China). Anti-HA antibody (#3F10, 1:100) was purchased from Roche (Shanghai, China). Cy3 AffiniPure Donkey Anti-Mouse IgG (H + L) (A0521, 1:500) was purchased from Beyotime Biotechnology (Shanghai, China).

Reagents

Dulbecco’s Modified Eagle Medium (DMEM, #8120251), fetal bovine serum (FBS, #10437028), penicillin-streptomycin (#15140-122), Opti-MEM medium (#31985070), cell dissociation buffer (#2075828), Fluo4-AM (#F14202), lipofectamine 2000 (#11668019) and Pierce^TM enhanced chemiluminescence reagents (#37074) were purchased from Thermo Fisher Scientific (Shanghai, China). Proteinase cocktail inhibitor (#04693159001) was bought from Roche (Shanghai, China). Protein G beads (#3394201) and nitrocellulose membranes (#HATF00010) were from Millipore (Shanghai, China). GABA (γ-aminobutyric acid) (#43811), Dichloro (1, 10-phenanthroline) copper (II) (#362204), Poly-D-Lysine (#P1149), and Poly-L-ornithine hydromide (#P3655) were bought from Sigma (Shanghai, China). Blebbistatin (#B1387) was purchased from ApexBio Technology (Shanghai, China). Recombinant Human Fibronectin (#40113ES10) was from Yeasen (Shanghai, China). CGP54626 hydrochloride (#HY-101378) and RGDS peptide (Arg-Gly-Asp-Ser, #HY-12290) were from Med Chem Express (Shanghai, China). Baclofen (#0796) and Rac BHFF (#3313) were from Tocris Bioscience (Shanghai, China). Coelenterazine H (#S2011) was purchased from Promega (Beijing, China). Snap-Surface Alexa Fluor 647 (#S9136) was from New England Biolabs (Ipswich, MA, USA). PTX was purchased from GLPBIO (#70323-44-3, Shanghai, China).

Plasmids

The pRK5 plasmids encoding N-terminal HA-tagged wild-type rat GB1a, N-terminal Flag-tagged wild-type rat GB2, GB1^ASA, GB1^ΔVFT, ^HA-Snap-GB1, ^HA-Snap-GB1^6.56C, ^Flag-Halo-GB2^6.56C, G_i1-Nluc, G_β1 and Venus-G_γ2 were generated in the lab^36,37,51,68. The pRK5 plasmids encode the GB1^ΔVFT, tagged with HA and Snap inserted after the signal peptide. The pRK5 plasmids encoding wild-type human integrin β₃ (UniProt: P05106) was tagged with HA tag, inserted immediately after the signal peptide. The integrin α_v plasmid (UniProt: P06756, #P40612) was purchased from the company (Miaolingbio, Wuhan, China). The probes (full-length mVenus, Rluc, YFP or RFP) were fused to the C terminus of the GB1, GB2, integrin β₃, integrin β₁, integrin α_v, mGlu2 or 5-HT_2a receptors. All the mutants for GABA_B receptor were generated by site-directed mutagenesis using the QuikChange mutagenesis protocol (Agilent Technologies, Stratagene, La Jolla, CA).

HEK293 cell culture and transfection

HEK293 cells (ATCC, CRL-1573, lot: 3449904) were cultured in DMEM supplemented with 10% fetal bovine serum (heat-inactivated) at 37 °C under 5% CO₂. Transfection was performed using Lipofectamine 2000 following the manufacturer's protocol. Two million cells were transfected with the indicated plasmids with the lipofectamine/DNA ratio at 2:1, and the total DNA at 1.5 μg in 35 mm diameter dishes.

Primary astrocyte culture

All experiments were approved by the Animal Experimentation Ethics Committee of the College of Life Science and Technology at Huazhong University of Science and Technology and were specifically designed to minimize the number of animals used. The cerebral cortex was dissected from KunMing mice (one day old) obtained from the Hubei Provincial Center for Disease Control and Prevention. Following careful removal of meninges, tissues were dissected and cut into small pieces using sharp blades, then digested in 1-2 ml of Trypsin/EDTA in a 37 °C water bath for 8 min. The supernatant was discarded, and the tissue was gently triturated using a 1 ml pipette. The homogenate was centrifuged at 180 g for 5 min. The pellet was re-suspended and seeded in a T75 flask pre-coated with poly-L-ornithine. Cells were cultured in DMEM medium, supplemented with 10% FBS at a density of 1 × 10⁴/cm². Twenty four hours after the initial plating, the media were changed with DMEM supplemented with 10% FBS, 100 units/mL of penicillin, and 100 µg/mL of streptomycin, and suspended cells were removed. The cells were cultured at 37 °C in a 5% CO₂ incubator for 7 days. The dishes were shaken at 260 rpm / min (2 h, 37 °C) to obtain purified astrocytes. The remaining enriched astrocyte culture was exposed to 0.5% trypsin for 5 min to cause detachment of the glial monolayer, and cells were then re-plated in a new T75 flask to further purify astrocytes. The astrocytes were used after three times of passage at day 21 for all the experiments.

Cell suspension and adhesion experiment

HEK293 cells were suspended using cell dissociation buffer and collected by centrifugation (180 g, 5 min) to remove the supernatant. Then cells were suspended in PBS and seeded into 96-well plate. For the suspension condition, the well was coated with 1% BSA. For the adhesion condition, the surface of the well was coated with poly-D-lysine (PDL) (5 μg/cm²). The cells were kept in the wells for 3-4 h at 37 °C under 5% CO₂, then lysis buffer was added directly for further measurement of IP₁ production measurements.

PDL and FN treatment

Poly-D-lysine (PDL) coated surfaces were prepared by incubating 5 μg/cm² PDL dissolved in phosphate-buffered saline in uncovered tissue culture dishes overnight at 37 °C. Fibronectin (FN)-coated surfaces were prepared by incubating 5 μg/cm² FN diluted in phosphate-buffered saline (PBS) in tissue culture dishes overnight at 37 °C as reported⁹⁹. The HEK293 cells expressing indicated plasmids were seeded into PDL-coated wells or FN-coated wells with culture medium for 24 h at 37 °C under 5% CO₂. Then cells were lysed for IP₁ production measurements.

Shear Stress loading experiments

A peristaltic pump (BT-CA600, Naturethink, China) was used to drive a stable flow shear stress. HEK293 cells were seeded on glass plates pre-coated with FN, then transfected with the indicated plasmids when cells grew to ∼80% confluence. After 24 h, glass plates were transferred onto a parallel-plate flow chamber (C901) and subjected to 15 dyn/cm² (1.5 Pascals) of shear stress for 15 min, followed by IP₁ production measurement.

IP₁ measurement

IP₁ production was measured using the IP-One HTRF kit (62IPAPEB, Revvity, Codolet, France). Cryptate-labeled anti-IP₁ monoclonal antibody and d2-labeled IP₁ were diluted in lysis buffer and added to the cell lysis in 96-well plate. After 1 h of incubation at 25 °C, the plates were read in PHERAstar FS (BMG Labtech, USA) with excitation at 337 nm and emission at 620 and 665 nm. The accumulation of IP1 concentration (nM) was calculated according to a standard dose-response curve.

Gi₁ protein dissociation measurement

HEK293 cells were transfected with optimized G_i protein sensors. For control cells with G_i sensor alone: vector, G_αi-Nluc and Venus-G_γ2 (70 ng + 1.5 ng + 20 ng/well in 96 well plate, 1270 ng + 30 ng + 350 ng /well in 6 well plate); For GABA_B receptor and G_i sensor: GB1, GB2, G_αi-Nluc and Venus-G_γ2 (30 ng + 40 ng+ 1.5 ng + 20 ng, 550 ng + 720 ng + 30 ng + 350 ng/well in 6 well plate). After 24 h of culture, cells in both 96-well plate and 6-well plate were starved in PBS for 30 min. Cells from 6-well plates were then detached using Versene (Gibco, #15040066, Shanghai, China), collected by centrifugation (180 g, 5 min), and resuspended in the same 96-well plate alongside adherent cells for BRET signal measurement. The signals emitted by the donor (460-500 nm band-pass filter, Em 480 nm) and the acceptor (510-550 nm band-pass filter, Em 530 nm) were recorded after the addition of 10 μM furimazine using the PHERAstar FS (BMG Labtech, USA) with the program PHERAstar control (Version 4.00 R4). All measurements were performed at 37 °C. The BRET signal (BRET ratio) was determined by calculating the ratio between the emission of acceptor and donor (Em 530 nm / Em 480 nm). The net BRET calculation is described in the corresponding figure legend.

Laminar shear stress stimulation

Coverslips were plated in the laminar shear stress imaging chamber (open diamond bath imaging chambers RC-26, Warner) prior to experiments. Then chambers were mounted onto the microscope and connected to the peristaltic pump (ISM827B, Ismatec). Continuous laminar flow was applied to cells for 100 s.

Shear stress (τ) in arterial segments was calculated in the following equation, according to previous research⁹¹,

$$\tau=\frac{32\mu Q}{{\pi d}^{3}}$$

(1)

where Q is the flow rate, μ is fluid viscosity and d is arterial diameter.

Polytetrafluoroethylene capillary tubes (d = 0.5mm) were adapted to model arteries and only focused on the fluorescence from transfected cells next to the fluid input terminal, enabling the estimation of the fluid shear stress on the surface of the coverslips. To calculate a specific value of shear stress, the flow rate (Q = 4.8 ml·min^-1) of imaging buffer was controlled through a peristaltic-pump and measured the viscosity of fluid flow (μ = 0.681 ± 0.017 mPa·s, mean ± s.e.m., n = 8) through viscometers. Finally, all the parameters were brought into Eq. (1) to calculate the value of fluid shear stress (τ = 4.44 ± 0.11 Pa, mean ± s.e.m.).

Calcium imaging

For HEK293 cells, they were seeded onto FN-coated coverslips 6 hours after plasmid transfection. After another 24 hours, HEK293 cells were incubated with 1 μM Fluo4-AM in the imaging buffer (130 mM NaCl, 5.1 mM KCl, 0.42 mM KH₂PO₄, 0.32 mM Na₂HPO₄, 5.27 mM glucose, 20 mM HEPES, 3.3 mM Na₂CO₃, 1 mM MgSO₄, 1.3 mM CaCl₂, 0.1% BSA, 2.5 mM probenecid, pH adjusted to 7.4) for 30 min at 37 °C. For primary astrocytes, they were incubated with 1 μM Fluo4-AM in the imaging buffer (145 mM NaCl, 2.5 mM KCl, 1 mM MgSO₄, 2 mM CaCl₂, 10 mM glucose, 10 mM HEPES, 3.3 mM Na₂CO₃, 1 mM MgSO₄, 2 mM CaCl₂, pH adjusted to 7.4) for 30 min at 37 °C. Cells were washed with imaging buffer and pre-incubated for 5 min at room temperature before calcium imaging. Intracellular Ca²⁺ fluorescence intensity was measured at 485 nm to indicate basal signal (F_basal) and response signal under stimulation of shear stress or baclofen (F_response). The fluorescence ratio (ΔF/F = (F_response-F_basal) / F_basal)¹⁰⁰ was calculated to represent the effect of shear stress or drugs on calcium signaling.

RNA interference

The integrin β₃ siRNA (#sc-63292) and control siRNA (#sc-37007) were purchased from Santa Cruz (Shanghai, China) and the GB1 siRNAs were synthesized from GenePharma (Suzhou, China) and the sequences are: GCGGUUUCCAACGUUCUUUTT (Forward), AAAGAACGUUGGAAACCGCTT (Reverse); GCUACAAGAAGAUCGGCUATT (Forward), UAGCCGAUCUUCUUGUAGCTT (Reverse); GGGAGAAGCCAGUUCCCAUTT (Forward), AUGGGAACUGGCUUCUCCCTT (Reverse).

To knockdown integrin β₃ expression, HEK293 cells were transfected with lipofectamine 2000 mixed with integrin β₃ siRNA, with a lipid/siRNA ratio at 2:1. The cells were then cultured for 24 h and subjected to IP₁ measurements. In parallel, Western blotting was performed to confirm the knockdown of integrin β₃.

To knock down GABA_B receptor expression, primary astrocytes were transfected with Lipofectamine 2000 mixed with GB1 siRNA. The GFP plasmid was co-transfected as reporter of transfection. The lipid/DNA and siRNA ratio was 3:1. Cells were then cultured for 48 h and subjected to Western blotting, calcium imaging and fluorescent imaging. In parallel, quantitative real-time PCR (qPCR) was performed to confirm the knockdown of GB1. The total RNA was extracted with TRIzol (Life Technologies), and qPCR reactions were performed in a 96-well format using Power SYBR Green (Thermo Fisher Scientific). The following primers were used: GB1 forward: ACAGACCAAATCTACCGGGC, GB1 reverse: GTGCTGTCGTAGTAGCCGAT. Relative mRNA levels were calculated using the ΔΔCT method.

Co-immunoprecipitation (Co-IP)

For HEK293 cells transfected with GABA_B receptor with HA-tagged GB1 and Flag-tagged GB2 (HA-GB1 and Flag-GB2), cells were lysed 24 hours after transfection with immunoprecipitation (IP) cell lysis buffer (20 mM Tris, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, with complete proteinase inhibitors, pH adjusted to 7.5) on ice for 30 min. For HEK293 cells transfected with GABA_B receptor with HA and Snap-tagged GB1, and Flag-tagged GB2 (HA-Snap-GB1 and Flag-GB2), cells were first labeled with 100 nM Snap-649 24 hours after transfection in culture medium at 37 °C for 2 h, then lysed with IP lysis buffer. Lysate were centrifuged at 11,000 g for 10 min at 4 °C. The supernatant was incubated with anti-HA or anti-integrin β₃ antibody overnight at 4 °C on a rotating wheel and then incubated with Protein G Beads (60 µL of a 50% bead slurry, Millipore) for 4–6 h at 4 °C. The pellet was washed four times with 600 µL of IP cell lysis buffer and resuspended with 2 × SDS sample buffer. Samples were boiled at 95 °C for 10 min and subjected to Western blotting analysis.

Western blotting

Equal amounts of protein were separated by SDS-polyacrylamide gel electrophoresis (PAGE) on 8 to 12% gels. Proteins were transferred to nitrocellulose membranes and washed in blocking buffer (10% BSA in Tris-buffered saline and 0.1% Tween 20) for 2 hours at room temperature. The blots were incubated with primary antibodies overnight at 4 °C and then incubated with HRP-linked or fluorescent dye-linked secondary antibodies for 2 hours at room temperature. Immunoblots were detected using Pierce^TM enhanced chemiluminescence reagents and visualized by X-ray film, or the membranes were imaged on an Odyssey CLx imager (LI-COR Bioscience, Lincoln, NE, USA) at 700 nm and 800 nm. The density of immunoreactive bands was measured by Image J software and normalized as the fold of the basal control.

BRET titration experiment

BRET titration experiments were performed to measure the direct interaction between proteins. Increasing amounts of Venus-tagged receptors were co-expressed with constant amounts of Rluc-tagged receptors in HEK293 cells and cultured for 24 h. Then, after one time wash with PBS, the substrate coelenterazine h (5 μM) was added and BRET signals (emission light at 480 nm and 530 nm, respectively) were detected by Mithras LB940 (Berthold Technologies, Germany). The BRET signals were plotted against the relative expression levels of each tagged receptor. netBRET ratio = [YFP emission at 530 nm/Rluc emission 480 nm] (where Rluc-tagged receptor is cotransfected with Venus-tagged receptor) - [YFP emission at 530 nm/Rluc emission 480 nm] (where Rluc-tagged receptor is transfected alone), in the same experiment. The results were analyzed by nonlinear regression assuming a model with one-site binding (GraphPad Prism, version 8, GraphPad software) on a pooled dataset from three independent experiments.

Fluorescent imaging

HEK293 cells and astrocytes were fixed with 4% formaldehyde and blocked with 2% BSA and 0.1% Triton X-100 in PBS. HEK293 cells were stained with 4′6-diamidino-2-phenylindole (DAPI) for 30 min. Then cells were washed with PBS and mounted with FluorSave reagent (AR1109, Boster Biological Technology Co. Ltd., Wuhan, China) for fluorescent imaging. Astrocytes were incubated with a primary mouse monoclonal GFAP antibody (1:100) at 4 °C overnight. After washing three times with PBS, cells were incubated with a secondary anti-mouse-Cy3 antibody at room temperature for 2 hours. After another washing of three times with PBS, the astrocytes were incubated with DAPI at room temperature for 30 min. Then cells were washed with PBS and mounted with Fluorsave reagent.

Fluorescent images of labeled cells were acquired using an Olympus FV3000 Laser Scanning Confocal Microscope (60 × objective, Olympus, Tokyo, Japan) equipped with appropriate fluorescence and filters (DAPI: 405/449 nm; YFP: 488/519 nm; RFP: 543/620 nm; Cy3: 543/620 nm; DAPI: 405/449 nm; GFP, 488/519 nm). The images were digitized and saved in TIFF format. respectively, more than five microscopic fields were randomly chosen for analysis. Images were processed and fluorescence (yellow in merge panels) was quantified with the Image J plugin JACoP using Manders’ co-localization coefficients M1&M2. The settings of the confocal microscope were kept the same for all images when fluorescence intensity was compared. The intensity and area of GFAP were quantified using ImageJ software.

Intracellular calcium release measurements

HEK293 cells were transfected with plasmids encoding the indicated GABA_B receptor and a chimeric protein G_qi9 for 24 h. The cells were then preincubated for 1 h with Ca²⁺-sensitive Fluo-4 (Life Technologies). The fluorescence signals (excitation at 485 nm and emission at 525 nm) were measured for 60 s (Flexstation 3, Molecular Devices) and recorded using a Flexstation 3 microplate reader (Molecular Devices, Sunnyvale, CA, USA). The agonist was added after the first 20 s. The Ca²⁺ response is expressed as an agonist-stimulated increase in fluorescence.

Cross-linking and fluorescent-labeled blot experiments

HEK293 cells were transfected with HA-Snap-GB1^6.56 and Flag-Halo-GB2^6.56 by Lipofectamine 2000 and plated in 12-well plates for 24 h. Then, cells were labeled with 100 nM Snap-649, a non-cell-permeant dye, in culture medium at 37 °C for 2 h. Cells were treated in different mechanical force condition with or without GABA (100 μM) treatment. Afterwards, cross-link buffer (1.5 mM Cu(II)-(o-phenanthroline), 1 mM CaCl₂, 5 mM MgSO₄, 16.7 mM Tris HCl, pH 8.0 and 100 mM NaCl) was added at 37 °C for 30 min. After incubation with 10 mM N-ethylmaleimide at 4 °C for 15 min to stop the cross-linking reaction, cells were lysed with lysis buffer (containing 50 mM Tris pH 7.4, 150 mM NaCl, 1% NP-40 and 0.5% sodium deoxycholate) at 4 °C for 1 h. After centrifugation at 12,000 × g for 30 min at 4 °C, supernatants were mixed with loading buffer at 37 °C for 10 min. In reducing conditions, samples were treated without DTT in loading buffer for 10 min before loading the samples. Equal amounts of proteins were resolved by 8% SDS-PAGE. Proteins were transferred to nitrocellulose membranes (Millipore). Membrane was imaged on an Odyssey CLx imager (LI-COR Bioscience, Lincoln, NE, USA) at 800 nm.

Inter subunit FRET sensor measurement

ACP-tag was inserted in the extracellular lobe1 of GB1b subunitand Snap-tag was inserted in the N-terminal of GB2 subunit⁶⁹. HEK293 cells were co-transfected to express GB1b subunit with the extracellular ACP-tag inserted in the lobe1 and N-terminal Snap-tag GB2 subunit using Lipofectamine 2000 in a 100-mm cell culture dish following the manufacturer’s instructions. Twenty-four hours after transfection, cells were plated in fibronectin (FN)-coated or polyornithine (PLO)-coated white 96-well plates (Greiner Bio-One) at 10⁵ cells per well and cultured 24 h at 37 °C and followed by 12 h at 30 °C with 5% CO₂.

To covalently label CoA-Lumi4®-Tb and Snap-Green on GABA_B receptors, combined labeling of Snap- and ACP-tag were performed following the protocol described previously with a small modification¹⁰¹. Briefly, transfected cells were first incubated with 300 nM Snap-Green in DMEM (1 ×) + GlutaMaxTM-I medium for 1 h at 37 °C, then washed once and incubated with 10 mM MgCl2, 1 mM DTT, 2 μM CoA-Lumi4®-Tb and 1 µM Sfp synthase in Tag-Lite® buffer for 1.5 h at 37 °C. Next, cells were washed three times in Tag-Lite® buffer, and incubated with 60 μL Tag-Lite® buffer. The trFRET measurements were performed in Greiner white 96-well plates, using a PHERAstar FS microplate reader with the following setup; after excitation with a laser at 337 nm (40 flashes per well), the fluorescence was collected at 520 nm. The acceptor ratio was calculated using the sensitized acceptor signal integrated over the time window [50 µs-100 µs], divided by the sensitized acceptor signal integrated over the time window [900 µs-1150 µs].

Molecular modeling and sequence alignment

The molecular model of GB1 VFT is generated with PyMOL software (Palo Alto, CA, USA) based on the cryo-EM structure of the GABA_B receptor (PDB: 7EB2). A model of GB1 VFT to show the residues in LB2 substituted by N-glycan was retrieved from GPCRdb. The protein sequences of the GABA_B1a subunit in various species were collected in UniProt (http://www.uniprot.org). The multiple sequence alignment was generated using Clustal Omega (https://www.ebi.ac.uk/Tools/msa/clustalo/) and the graphic was prepared on the ESPript 3.0 server (http://espript.ibcp.fr/ESPript/cgi-bin/ESPript.cgi).

Statistical analysis

Data are means ± s.e.m. from at least three independent experiments and statistical analyses were performed in GraphPad Prism 8 software. P-values were determined using the unpaired t test (two-tailed), paired t test (two-tailed) or ordinary one-way ANOVA with Tukey’s multiple comparisons test (****P < 0.0001, ***P < 0.001, **P < 0.01, *P < 0.05 were considered statistically significant). P > 0.05 was considered statistically not significant (ns). For dose-response experiments, data are normalized and analyzed using nonlinear curve fitting for the log (agonist) vs. response (three parameters) curves.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

Source data are provided with this paper.

References

Bowery, N. G. et al. International Union of Pharmacology. XXXIII. Mammalian gamma-aminobutyric acid_B receptors: structure and function. Pharm. Rev. 54, 247–264 (2002).
Article CAS PubMed Google Scholar
Ulrich, D. & Bettler, B. GABA_B receptors: synaptic functions and mechanisms of diversity. Curr. Opin. Neurobiol. 17, 298–303 (2007).
Article CAS PubMed Google Scholar
Bassetti, D. Keeping the Balance: GABA_B Receptors in the Developing Brain and Beyond. Brain Sci. 12, 419 (2022).
Enna, S. J. & Bowery, N. G. GABA_B receptor alterations as indicators of physiological and pharmacological function. Biochem Pharm. 68, 1541–1548 (2004).
Article CAS PubMed Google Scholar
Schuler, V. et al. Epilepsy, hyperalgesia, impaired memory, and loss of pre- and postsynaptic GABA_B responses in mice lacking GABA_B1. Neuron 31, 47–58 (2001).
Article CAS PubMed Google Scholar
Heaney, C. F. & Kinney, J. W. Role of GABA_B receptors in learning and memory and neurological disorders. Neurosci. Biobehav Rev. 63, 1–28 (2016).
Article CAS PubMed Google Scholar
Jacobson, L. H. et al. Differential roles of GABA_B1 subunit isoforms on locomotor responses to acute and repeated administration of cocaine. Behav. Brain Res. 298, 12–16 (2016).
Article CAS PubMed Google Scholar
Bettler, B., Kaupmann, K., Mosbacher, J. & Gassmann, M. Molecular structure and physiological functions of GABA_B receptors. Physiol. Rev. 84, 835–867 (2004).
Article CAS PubMed Google Scholar
Mariotti, L., Losi, G., Sessolo, M., Marcon, I. & Carmignoto, G. The inhibitory neurotransmitter GABA evokes long-lasting Ca²⁺ oscillations in cortical astrocytes. Glia 64, 363–373 (2016).
Article PubMed Google Scholar
Cheng, Y. T. et al. Inhibitory input directs astrocyte morphogenesis through glial GABA_BR. Nature 617, 369–376 (2023).
Article ADS CAS PubMed PubMed Central Google Scholar
Gould, T. et al. GABA_B receptor-mediated activation of astrocytes by gamma-hydroxybutyric acid. Philos. Trans. R. Soc. Lond. B Biol. Sci. 369, 20130607 (2014).
Article PubMed PubMed Central Google Scholar
Jafarian, M. et al. The effect of GABAergic neurotransmission on the seizure-related activity of the laterodorsal thalamic nuclei and the somatosensory cortex in a genetic model of absence epilepsy. Brain Res. 1757, 147304 (2021).
Article CAS PubMed Google Scholar
Cediel, M. L. et al. GABBR1 monoallelic de novo variants linked to neurodevelopmental delay and epilepsy. Am. J. Hum. Genet 109, 1885–1893 (2022).
Article CAS PubMed PubMed Central Google Scholar
Felice, D., Cryan, J. F. & O’Leary, O. F. GABA_B Receptors: Anxiety and Mood Disorders. Curr. Top. Behav. Neurosci. 52, 241–265 (2022).
Article CAS PubMed Google Scholar
Jacobson, L. H. et al. The Gamma-Aminobutyric Acid B Receptor in Depression and Reward. Biol. Psychiatry 83, 963–976 (2018).
Article CAS PubMed Google Scholar
Frankowska, M., Filip, M. & Przegalinski, E. Effects of GABA_B receptor ligands in animal tests of depression and anxiety. Pharm. Rep. 59, 645–655 (2007).
CAS Google Scholar
Chang, E. et al. A Review of Spasticity Treatments: Pharmacological and Interventional Approaches. Crit. Rev. Phys. Rehabil. Med 25, 11–22 (2013).
Article PubMed PubMed Central Google Scholar
Cousins, M. S., Roberts, D. C. & de Wit, H. GABA_B receptor agonists for the treatment of drug addiction: a review of recent findings. Drug Alcohol Depend. 65, 209–220 (2002).
Article CAS PubMed Google Scholar
Malcangio, M. GABA_B receptors and pain. Neuropharmacology 136, 102–105 (2018).
Article CAS PubMed Google Scholar
Vuillaume, M. L. et al. A novel mutation in the transmembrane 6 domain of GABBR2 leads to a Rett-like phenotype. Ann. Neurol. 83, 437–439 (2018).
Article PubMed Google Scholar
Yoo, Y. et al. GABBR2 mutations determine phenotype in rett syndrome and epileptic encephalopathy. Ann. Neurol. 82, 466–478 (2017).
Article CAS PubMed Google Scholar
Henderson, C. et al. Reversal of disease-related pathologies in the fragile X mouse model by selective activation of GABA_B receptors with arbaclofen. Sci. Transl. Med. 4, 152ra128 (2012).
Nieto, A., Bailey, T., Kaczanowska, K. & McDonald, P. GABA_B Receptor Chemistry and Pharmacology: Agonists, Antagonists, and Allosteric Modulators. Curr. Top. Behav. Neurosci. 52, 81–118 (2022).
Article CAS PubMed Google Scholar
Holtyn, A. F. & Weerts, E. M. GABA_B Receptors and Alcohol Use Disorders: Preclinical Studies. Curr. Top. Behav. Neurosci. 52, 157–194 (2022).
Article CAS PubMed Google Scholar
Logge, W. B., Morley, K. C. & Haber, P. S. GABA_B Receptors and Alcohol Use Disorders: Clinical Studies. Curr. Top. Behav. Neurosci. 52, 195–212 (2022).
Article CAS PubMed Google Scholar
Tedeschi, L. et al. Endogenous gamma-hydroxybutyric acid is in the rat, mouse and human gastrointestinal tract. Life Sci. 72, 2481–2488 (2003).
Article CAS PubMed Google Scholar
Auteri, M., Zizzo, M. G. & Serio, R. GABA and GABA receptors in the gastrointestinal tract: from motility to inflammation. Pharm. Res 93, 11–21 (2015).
Article CAS Google Scholar
Hyland, N. P. & Cryan, J. F. A Gut Feeling about GABA: Focus on GABA_B Receptors. Front Pharm. 1, 124 (2010).
Article Google Scholar
Pin, J. P. & Bettler, B. Organization and functions of mGlu and GABA_B receptor complexes. Nature 540, 60–68 (2016).
Article ADS CAS PubMed Google Scholar
Shen, C. et al. Structural basis of GABA_B receptor-G_i protein coupling. Nature 594, 594–598 (2021).
Article ADS CAS PubMed PubMed Central Google Scholar
Thor, C. M., David, M.-D., Jean-Philippe, P. & Julie, K. Class C G protein-coupled receptors:reviving old couples with new partners. Biophysics Rep. 3, 57–63 (2017).
Article Google Scholar
Park, J. et al. Structure of human GABA_B receptor in an inactive state. Nature 584, 304–309 (2020).
Article ADS CAS PubMed PubMed Central Google Scholar
Mao, C. et al. Cryo-EM structures of inactive and active GABA_B receptor. Cell Res 30, 564–573 (2020).
Article CAS PubMed PubMed Central Google Scholar
Shaye, H. et al. Structural basis of the activation of a metabotropic GABA receptor. Nature 584, 298–303 (2020).
Article ADS CAS PubMed PubMed Central Google Scholar
Papasergi-Scott, M. M. et al. Structures of metabotropic GABA_B receptor. Nature 584, 310–314 (2020).
Article ADS CAS PubMed PubMed Central Google Scholar
Xue, L. et al. Rearrangement of the transmembrane domain interfaces associated with the activation of a GPCR hetero-oligomer. Nat. Commun. 10, 2765 (2019).
Article ADS PubMed PubMed Central Google Scholar
Liu, L. et al. Allosteric ligands control the activation of a class C GPCR heterodimer by acting at the transmembrane interface. Elife 10, e70188 (2021).
Wang, N. et al. Mechanical behavior in living cells consistent with the tensegrity model. Proc. Natl Acad. Sci. USA 98, 7765–7770 (2001).
Article ADS CAS PubMed PubMed Central Google Scholar
Xiao, R., Liu, J. & Xu, X. Z. S. Mechanosensitive GPCRs and ion channels in shear stress sensing. Curr. Opin. Cell Biol. 84, 102216 (2023).
Article CAS PubMed PubMed Central Google Scholar
Halma, M. T. J. & Xu, L. Life under tension: the relevance of force on biological polymers. Biophysics Rep. 10, 48–56 (2024).
Article Google Scholar
Humphrey, J. D., Dufresne, E. R. & Schwartz, M. A. Mechanotransduction and extracellular matrix homeostasis. Nat. Rev. Mol. Cell Biol. 15, 802–812 (2014).
Article CAS PubMed PubMed Central Google Scholar
Dobereiner, H. G., Dubin-Thaler, B. J., Giannone, G. & Sheetz, M. P. Force sensing and generation in cell phases: analyses of complex functions. J. Appl Physiol. (1985) 98, 1542–1546 (2005).
Article PubMed Google Scholar
Wang, N. Review of Cellular Mechanotransduction. J. Phys. D Appl. Phys. 50, 233002 (2017).
Maruthamuthu, V., Sabass, B., Schwarz, U. S. & Gardel, M. L. Cell-ECM traction force modulates endogenous tension at cell-cell contacts. Proc. Natl Acad. Sci. USA 108, 4708–4713 (2011).
Article ADS CAS PubMed PubMed Central Google Scholar
Roca-Cusachs, P. et al. Integrin-dependent force transmission to the extracellular matrix by alpha-actinin triggers adhesion maturation. Proc. Natl Acad. Sci. USA 110, E1361–E1370 (2013).
Article CAS PubMed PubMed Central Google Scholar
Chrzanowska-Wodnicka, M. & Burridge, K. Rho-stimulated contractility drives the formation of stress fibers and focal adhesions. J. Cell Biol. 133, 1403–1415 (1996).
Article CAS PubMed Google Scholar
Fernandez-Gonzalez, R. et al. Myosin II dynamics are regulated by tension in intercalating cells. Dev. Cell 17, 736–743 (2009).
Article CAS PubMed PubMed Central Google Scholar
Schwarz, U. S. & Gardel, M. L. United we stand: integrating the actin cytoskeleton and cell-matrix adhesions in cellular mechanotransduction. J. Cell Sci. 125, 3051–3060 (2012).
CAS PubMed PubMed Central Google Scholar
Thomsen, W., Frazer, J. & Unett, D. Functional assays for screening GPCR targets. Curr. Opin. Biotechnol. 16, 655–665 (2005).
Engler, A. J., Sen, S., Sweeney, H. L. & Discher, D. E. Matrix elasticity directs stem cell lineage specification. Cell 126, 677–689 (2006).
Article CAS PubMed Google Scholar
Xu, C. et al. Specific pharmacological and G_i/o protein responses of some native GPCRs in neurons. Nat. Commun. 15, 1990 (2024).
Article ADS CAS PubMed PubMed Central Google Scholar
Hynes, R. O. Integrins: bidirectional, allosteric signaling machines. Cell 110, 673–687 (2002).
Article CAS PubMed Google Scholar
Sun, Z., Guo, S. S. & Fassler, R. Integrin-mediated mechanotransduction. J. Cell Biol. 215, 445–456 (2016).
Article CAS PubMed PubMed Central Google Scholar
Li, Z., Lee, H. & Zhu, C. Molecular mechanisms of mechanotransduction in integrin-mediated cell-matrix adhesion. Exp. Cell Res 349, 85–94 (2016).
Article CAS PubMed PubMed Central Google Scholar
Tan, Y. et al. Matrix softness regulates plasticity of tumour-repopulating cells via H3K9 demethylation and Sox2 expression. Nat. Commun. 5, 4619 (2014).
Article ADS CAS PubMed Google Scholar
Weisel, J. W. Fibrinogen and fibrin. Adv. Protein Chem. 70, 247–299 (2005).
Article CAS PubMed Google Scholar
Takada, Y., Ye, X. & Simon, S. The integrins. Genome Biol. 8, 215 (2007).
Article PubMed PubMed Central Google Scholar
Sun, G., Guillon, E. & Holley, S. A. Integrin intra-heterodimer affinity inversely correlates with integrin activatability. Cell Rep. 35, 109230 (2021).
Article CAS PubMed PubMed Central Google Scholar
Liu, J. et al. Biased signaling due to oligomerization of the G protein-coupled platelet-activating factor receptor. Nat. Commun. 13, 6365 (2022).
Article ADS CAS PubMed PubMed Central Google Scholar
Ayoub, M. A. & Pfleger, K. D. Recent advances in bioluminescence resonance energy transfer technologies to study GPCR heteromerization. Curr. Opin. Pharm. 10, 44–52 (2010).
Article CAS Google Scholar
Gonzalez-Maeso, J. et al. Identification of a serotonin/glutamate receptor complex implicated in psychosis. Nature 452, 93–97 (2008).
Article ADS CAS PubMed PubMed Central Google Scholar
Bachmann, M., Kukkurainen, S., Hytönen, V. P. & Wehrle-Haller, B. Cell Adhesion by Integrins. Physiological Rev. 99, 1655–1699 (2019).
Article CAS Google Scholar
Pagano, A. et al. C-terminal interaction is essential for surface trafficking but not for heteromeric assembly of GABA_b receptors. J. Neurosci. 21, 1189–1202 (2001).
Article CAS PubMed PubMed Central Google Scholar
Duthey, B. et al. A single subunit (GB2) is required for G-protein activation by the heterodimeric GABA_B receptor. J. Biol. Chem. 277, 3236–3241 (2002).
Article CAS PubMed Google Scholar
Galvez, T. et al. Mutagenesis and modeling of the GABA_B receptor extracellular domain support a venus flytrap mechanism for ligand binding. J. Biol. Chem. 274, 13362–13369 (1999).
Article CAS PubMed Google Scholar
Kniazeff, J., Galvez, T., Labesse, G. & Pin, J. P. No ligand binding in the GB2 subunit of the GABA_B receptor is required for activation and allosteric interaction between the subunits. J. Neurosci. 22, 7352–7361 (2002).
Galvez, T. et al. Mapping the Agonist-binding Site of GABA_B Type 1 Subunit Sheds Light on the Activation Process of GABA_BReceptors. J. Biol. Chem. 275, 41166–41174 (2000).
Article CAS PubMed Google Scholar
Rondard, P. et al. Functioning of the dimeric GABA_B receptor extracellular domain revealed by glycan wedge scanning. EMBO J. 27, 1321–1332 (2008).
Article CAS PubMed PubMed Central Google Scholar
Lecat-Guillet, N. et al. FRET-Based Sensors Unravel Activation and Allosteric Modulation of the GABA_B Receptor. Cell Chem. Biol. 24, 360–370 (2017).
Article CAS PubMed Google Scholar
Freeman, M. R. Specification and morphogenesis of astrocytes. Science 330, 774–778 (2010).
Article ADS CAS PubMed PubMed Central Google Scholar
Escartin, C. et al. Reactive astrocyte nomenclature, definitions, and future directions. Nat. Neurosci. 24, 312–325 (2021).
Article CAS PubMed PubMed Central Google Scholar
Burda, J. E., Bernstein, A. M. & Sofroniew, M. V. Astrocyte roles in traumatic brain injury. Exp. Neurol. 275, 305–315 (2016).
Article CAS PubMed Google Scholar
Burda, J. E. & Sofroniew, M. V. Reactive gliosis and the multicellular response to CNS damage and disease. Neuron 81, 229–248 (2014).
Article CAS PubMed PubMed Central Google Scholar
Sofroniew, M. V. Molecular dissection of reactive astrogliosis and glial scar formation. Trends Neurosci. 32, 638–647 (2009).
Article CAS PubMed PubMed Central Google Scholar
Vezzani, A. et al. Astrocytes in the initiation and progression of epilepsy. Nat. Rev. Neurol. 18, 707–722 (2022).
Article PubMed PubMed Central Google Scholar
Schwartz, H. et al. Incipient Melanoma Brain Metastases Instigate Astrogliosis and Neuroinflammation. Cancer Res 76, 4359–4371 (2016).
Article CAS PubMed Google Scholar
Zorec, R., Zupanc, T. A. & Verkhratsky, A. Astrogliopathology in the infectious insults of the brain. Neurosci. Lett. 689, 56–62 (2019).
Article CAS PubMed Google Scholar
Pekny, M. & Nilsson, M. Astrocyte activation and reactive gliosis. Glia 50, 427–434 (2005).
Article PubMed Google Scholar
Sofroniew, M. V. & Vinters, H. V. Astrocytes: biology and pathology. Acta Neuropathol. 119, 7–35 (2010).
Article PubMed Google Scholar
Becker, S. et al. Sensitive and simultaneous quantification of 16 neurotransmitters and metabolites in murine microdialysate by fast liquid chromatography-tandem mass spectrometry. Talanta 253, 123965 (2023).
Article CAS PubMed Google Scholar
Defaix, C. et al. Rapid analysis of glutamate, glutamine and GABA in mice frontal cortex microdialysis samples using HPLC coupled to electrospray tandem mass spectrometry. J. Pharm. Biomed. Anal. 152, 31–38 (2018).
Article CAS PubMed Google Scholar
Mederos, S. et al. GABAergic signaling to astrocytes in the prefrontal cortex sustains goal-directed behaviors. Nat. Neurosci. 24, 82–92 (2021).
Article CAS PubMed Google Scholar
Perea, G. et al. Activity-dependent switch of GABAergic inhibition into glutamatergic excitation in astrocyte-neuron networks. eLife 5, e20362 (2016).
Nagai, J. et al. Hyperactivity with Disrupted Attention by Activation of an Astrocyte Synaptogenic Cue. Cell 177, 1280–1292.e1220 (2019).
Article CAS PubMed PubMed Central Google Scholar
Mariotti, L. et al. Interneuron-specific signaling evokes distinctive somatostatin-mediated responses in adult cortical astrocytes. Nat. Commun. 9, 82 (2018).
Gong, J. et al. A Cold-Sensing Receptor Encoded by a Glutamate Receptor Gene. Cell 178, 1375–1386.e1311 (2019).
Article CAS PubMed PubMed Central Google Scholar
Zhang, W. et al. GABA_B receptor upregulates fragile X mental retardation protein expression in neurons. Sci. Rep. 5, 10468 (2015).
Article ADS PubMed PubMed Central Google Scholar
Cooper, J. & Giancotti, F. G. Integrin Signaling in Cancer: Mechanotransduction, Stemness, Epithelial Plasticity, and Therapeutic Resistance. Cancer Cell 35, 347–367 (2019).
Article CAS PubMed PubMed Central Google Scholar
Zou, Y. et al. Mechanical stress activates angiotensin II type 1 receptor without the involvement of angiotensin II. Nat. Cell Biol. 6, 499–506 (2004).
Article CAS PubMed Google Scholar
Mederos, et al. Gq-coupled receptors as mechanosensors mediating myogenic vasoconstriction. EMBO J 27, 3092–3103 (2008).
Erdogmus, S. et al. Helix 8 is the essential structural motif of mechanosensitive GPCRs. Nat. Commun. 10, 5784 (2019).
Article ADS CAS PubMed PubMed Central Google Scholar
Chachisvilis, M., Zhang, Y. L. & Frangos, J. A. G protein-coupled receptors sense fluid shear stress in endothelial cells. Proc. Natl Acad. Sci. USA 103, 15463–15468 (2006).
Article ADS PubMed PubMed Central Google Scholar
Xu, J. et al. GPR68 Senses Flow and Is Essential for Vascular Physiology. Cell 173, 762–775.e716 (2018).
Article CAS PubMed PubMed Central Google Scholar
Scholz, N. et al. The adhesion GPCR latrophilin/CIRL shapes mechanosensation. Cell Rep. 11, 866–874 (2015).
Article CAS PubMed Google Scholar
Scholz, N. et al. Mechano-dependent signaling by Latrophilin/CIRL quenches cAMP in proprioceptive neurons. Elife 6, e28360 (2017).
Yeung, J. et al. GPR56/ADGRG1 is a platelet collagen-responsive GPCR and hemostatic sensor of shear force. Proc. Natl Acad. Sci. USA 117, 28275–28286 (2020).
Article ADS CAS PubMed PubMed Central Google Scholar
Hemphill, M. A. et al. Traumatic Brain Injury and the Neuronal Microenvironment: A Potential Role for Neuropathological Mechanotransduction. Neuron 85, 1177–1192 (2015).
Article CAS PubMed Google Scholar
Chi, S. et al. Astrocytic Piezo1-mediated mechanotransduction determines adult neurogenesis and cognitive functions. Neuron 110, 2984–2999 e2988 (2022).
Article CAS PubMed Google Scholar
Galownia, N. C., Kushiro, K., Gong, Y. & Asthagiri, A. R. Selective desensitization of growth factor signaling by cell adhesion to fibronectin. J. Biol. Chem. 282, 21758–21766 (2007).
Article CAS PubMed Google Scholar
Zhang, L., Mo, Y., Mo, S., Xia, M. & Wei, C. Simultaneous detection of dynamic calcium signaling and ERK activity in living cells. Biophysics Rep. 10, 304–314 (2024).
Google Scholar
Monnier, C. et al. Trans-activation between 7TM domains: implication in heterodimeric GABA_B receptor activation. EMBO J. 30, 32–42 (2011).
Article ADS CAS PubMed Google Scholar

Download references

Acknowledgements

We thank the Research Core Facilities of Life Science (HUST, Wuhan) for their assistance in functional measurements. This work was supported by grants from National Key R&D Program of China (grant number 2021ZD0203302 and 2022YFE0116600 to J. L.), the National Natural Science Foundation of China (NSFC) (grant number 32330049, 82320108021 and 32421003 to J. L., 32271198 to C. X.), the Major Project of Guangzhou National Laboratory (grant number GZNL2023A03007 to J.L.), the Key Technologies R&D Program of Guangdong Province (grant number 2010A080813001 to J. L.) and the interdisciplinary Research Program of HUST (5003170102 to J.L). J.L. was also supported by Hubei Jiangxia Laboratory and the Program of the “Double First-Class” for Provincial and Ministry-affiliated Universities in Hubei (grant number 5001170159).

Author information

These authors contributed equally: Yujia Huo, Yiwei Zhou, Li Lin.

Authors and Affiliations

Cellular Signaling Laboratory, Key Laboratory of Molecular Biophysics of Ministry of Education, College of Life Science and Technology, Huazhong University of Science and Technology, Wuhan, Hubei, China
Yujia Huo, Yiwei Zhou, Li Lin, Fan Yang, Jiyong Meng, Feiteng He, Fengfan Zhang, Mengdan Song, Cangsong Shen, Yuxuan Liu, Chanjuan Xu & Jianfeng Liu
Life Sciences Institute, University of Michigan, Ann Arbor, MI, USA
Feiteng He, Fengfan Zhang & X. Z. Shawn Xu
Department of Molecular and Integrative Physiology, University of Michigan Medical School, Ann Arbor, MI, USA
Feiteng He, Fengfan Zhang & X. Z. Shawn Xu
Institut de Génomique Fonctionnelle (IGF), Univ. Montpellier, CNRS, INSERM, Montpellier, France
Philippe Rondard
Bioland Laboratory, Guangzhou Regenerative Medicine and Health Guangdong Laboratory, Guangzhou, China
Chanjuan Xu & Jianfeng Liu
Hubei Jiangxia Laboratory, Wuhan, Hubei, China
Jianfeng Liu

Authors

Yujia Huo
View author publications
Search author on:PubMed Google Scholar
Yiwei Zhou
View author publications
Search author on:PubMed Google Scholar
Li Lin
View author publications
Search author on:PubMed Google Scholar
Fan Yang
View author publications
Search author on:PubMed Google Scholar
Jiyong Meng
View author publications
Search author on:PubMed Google Scholar
Feiteng He
View author publications
Search author on:PubMed Google Scholar
Fengfan Zhang
View author publications
Search author on:PubMed Google Scholar
Mengdan Song
View author publications
Search author on:PubMed Google Scholar
Cangsong Shen
View author publications
Search author on:PubMed Google Scholar
Yuxuan Liu
View author publications
Search author on:PubMed Google Scholar
Philippe Rondard
View author publications
Search author on:PubMed Google Scholar
Chanjuan Xu
View author publications
Search author on:PubMed Google Scholar
X. Z. Shawn Xu
View author publications
Search author on:PubMed Google Scholar
Jianfeng Liu
View author publications
Search author on:PubMed Google Scholar

Contributions

Y.H., and Y.Z. performed traction force experiments, shear stress experiments, IP₁ measurements, Co-IP experiments, and GB1/integrin interface identification. Y.H. performed fluorescent imaging, BRET titration experiment,s and calcium imaging in astrocytes. L.L. performed the G_i1 protein dissociation experiments, calcium imaging in HEK293 cells and astrocytes, and intracellular calcium release measurements in HEK293 cells, molecular modeling, and sequence alignment. Y.H., Y.Z., and L.L. performed cross-linking experiments. F.Y. helped with the Western blotting detection, qPCR, BRET titration, and G_i1 protein dissociation experiments and calcium imaging in astrocytes and HEK293 cells. F.H. helped to set up the single-cell calcium imaging system. J.M. performed the inter subunit FRET measurement of GABA_B receptor with the guide of P.R. F.Z. and M.S. helped with the calcium imaging in HEK293 cells. C.S. helped with the molecular modeling. Y.L. helped with the Co-IP and G_i1 protein dissociation experiments. Y.H., Y.Z., L.L., F.Y., and Y.L. prepared the data. J.L. and C.X. conceived and supervised the whole project. X.Z.S.X. participated in the interpretation of the data and the preparation of the manuscript. J.L., X.Z.S.X., and C.X. wrote the manuscript with inputs from all the authors.

Corresponding authors

Correspondence to Chanjuan Xu, X. Z. Shawn Xu or Jianfeng Liu.

Ethics declarations

Competing interests

The authors declare no competing interests.

Peer review

Peer review information

Nature Communications thanks the anonymous, reviewer(s) for their contribution to the peer review of this work. A peer review file is available.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Supplementary Information

Reporting Summary

Transparent Peer review file

Source data

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

About this article

Cite this article

Huo, Y., Zhou, Y., Lin, L. et al. GABA-independent activation of GABA_B receptor by mechanical forces. Nat Commun 16, 9843 (2025). https://doi.org/10.1038/s41467-025-64811-2

Download citation

Received: 10 December 2024
Accepted: 26 September 2025
Published: 07 November 2025
Version of record: 07 November 2025
DOI: https://doi.org/10.1038/s41467-025-64811-2

Subjects

Abstract

Similar content being viewed by others

Structural basis of GABAB receptor–Gi protein coupling

G protein coupling and activation of the metabotropic GABAB heterodimer

Filamin A organizes γ‑aminobutyric acid type B receptors at the plasma membrane

Introduction

Results

GABAB receptor is activated by mechanical forces

Mechano-activation of GABAB receptor occurs through a physical interaction with integrin

Both GB1 and GB2 are required for GABAB receptor activation by mechanical forces

Mapping the region in GABAB receptor that interacts with integrin β3

Mechano-force acts as a positive allosteric modulator agonist (PAM ago) for GABAB receptor activation

GABAB receptor is required for shear stress-induced remodeling of astrocytes

Shear stress activates astrocytes in a GABAB receptor-dependent manner

Discussion

Methods

Antibodies

Reagents

Plasmids

HEK293 cell culture and transfection

Primary astrocyte culture

Cell suspension and adhesion experiment

PDL and FN treatment

Shear Stress loading experiments

IP1 measurement

Gi1 protein dissociation measurement

Laminar shear stress stimulation

Calcium imaging

RNA interference

Co-immunoprecipitation (Co-IP)

Western blotting

BRET titration experiment

Fluorescent imaging

Intracellular calcium release measurements

Cross-linking and fluorescent-labeled blot experiments

Inter subunit FRET sensor measurement

Molecular modeling and sequence alignment

Statistical analysis

Reporting summary

Data availability

References

Acknowledgements

Author information

Authors and Affiliations

Contributions

Corresponding authors

Ethics declarations

Competing interests

Peer review

Peer review information

Additional information

Supplementary information

Supplementary Information

Reporting Summary

Transparent Peer review file

Source data

Source data

Rights and permissions

About this article

Cite this article

Share this article

Search

Quick links

Structural basis of GABA_B receptor–G_i protein coupling

G protein coupling and activation of the metabotropic GABA_B heterodimer

GABA_B receptor is activated by mechanical forces

Mechano-activation of GABA_B receptor occurs through a physical interaction with integrin

Both GB1 and GB2 are required for GABA_B receptor activation by mechanical forces

Mapping the region in GABA_B receptor that interacts with integrin β₃

Mechano-force acts as a positive allosteric modulator agonist (PAM ago) for GABA_B receptor activation

GABA_B receptor is required for shear stress-induced remodeling of astrocytes

Shear stress activates astrocytes in a GABA_B receptor-dependent manner

IP₁ measurement

Gi₁ protein dissociation measurement