Introduction

Parathyroid hormone-related peptide (PTHrP) is a polypeptide highly homologous to parathyroid hormone (PTH) in the N-terminal sequence and spatial structure, both of which can act through PTHrP/PTH receptors1,2,3. PTHrP can be produced by a variety of cells and plays a key role in growth and development2,4,5,6. It is widely distributed in the body and expressed in various organs such as the brain, spinal cord, heart, lung, pancreas, skin, and bone7,8,9,10,11,12. PTHrP can be proteolytically converted into several biologically active fragments, including N-terminus (1–36), intermediate fragment (37–86), nuclear localization sequence (NLS, 87–107), and C-terminus (108–139)4,11,13. These bioactive fragments have different functions, among which the N-terminus plays a PTH-like role, the intermediate fragment is involved in placental calcium transport, NLS can transport heterologous plasma proteins into the nucleus, and C-terminus has an inhibitory effect on bone resorption5,14,15,16,17.

In order to further study the in vivo functions of PTHrP NLS and C-terminus, Professor Andrew Karaplis and Professor Dengshun Miao et al. used genetic engineering technology to knock in (KI) a stop codon (TGA) after the 84th amino acid sequence of PTHrP and constructed a mouse model expressing only PTHrP (1–84), but not NLS and C-terminus, namely PTHrP NLS and C-terminal knockout mice (also PTHrP KI mice)18,19. Homozygous PTHrP KI mice developed aging phenotypes such as growth retardation, osteoporosis, muscle atrophy and hyperkeratosis of the skin, and even death within 1–2 weeks after birth18.

Aging is a natural and unavoidable biological process characterized by gradual declines in cellular functions and progressive structural changes in multiple organ systems20,21,22. Aging is associated with molecular and physiological changes in lung function, reductions in lung remodeling and regenerative capacity, and the increase in susceptibility to acute and chronic lung diseases20,21,23,24,25. However, the effect of NLS and C-terminus deletion of PTHrP on lung development remains unclear. Therefore, this study aims to preliminarily explore the effect of PTHrP NLS and C-terminus deletion on lung development by histology, immunohistochemistry and Western blotting, thus providing a new theoretical and experimental basis for PTHrP (87–139) as a target for the treatment of pulmonary interstitial fibrosis induced by premature aging.

Materials and methods

Mice and genotyping

All experiments were approved by the Committee on the Ethics of Animal Experiments of Nanjing Medical University (Permit Number: IACUC-1809007) and performed in accordance with institutional guidelines for Laboratory Animal Research. This study complies with the ARRIVE guidelines for reporting animal experiments. The PTHRP knock-in heterozygous mice (+/-) were generated on a C57BL/6 background (provided by Prof. Andrew Karaplis). Wild-type (+/+), heterozygous (+/-), and homozygous (-/-) littermates were obtained by crossing male and female heterozygotes. The mice used in this study were 10 days old. For each genotype (WT and KI groups), three independent mice (n = 3 per genotype) were used as biological replicates, with both male and female pups included without sex-based restrictions during group allocation. Each experiment was conducted using tissues derived from these distinct biological individuals. On the ninth day after birth, the tail of the mice was cut and placed in a 1.5 ml Eppendorf tube. Samples were digested overnight at 56 °C with proteinase K, followed by standard phenol-chloroform DNA extraction. Target fragments were amplified using primers (Forward: 5’GCTGTGTCTGAACATCAGCTAC3’, Reverse: 5’-ATGCGCCTTAAGCTGGGCTC’). PCR products were digested with BstE II at 37 °C for 2 h. Digested products were resolved on a 2% agarose gel.

Histology

In our experiment, we used 3% pentobarbital sodium (50 mg/kg, intraperitoneal injection) as the anesthetic agent to ensure the mice were fully anesthetized before any procedures. The method of euthanasia employed was cervical dislocation following deep anesthesia, which was carried out in accordance with the guidelines approved by our Institutional Animal Care and Use Committee (IACUC) to minimize animal suffering. And then washed with normal saline through the heart, and the lungs were directly isolated. The tissue proteins were extracted from the lungs of 4 animals for Western blotting assay, and the lungs from the other 4 animals were used for morphological observation.

Lungs for morphological observation were fixed with periodate-lysine-paraformaldehyde (PLP) solution at 4 °C overnight. Then the lung tissues were dehydrated and embedded in paraffin, and sagittal sections of 5 μm thickness were cut on a rotary microtome. Subsequently, the sections were subjected to hematoxylin-eosin (HE), immunohistochemical, or Masson’s staining as described below.

HE staining and masson’s staining

Paraffin sections were placed in an oven at 37 °C for 2 h, followed by routine dewaxing and hydration. After washing with running water for 3 min, the sections were stained with hematoxylin for 5–10 min. Then they were washed with running water for 3 min, and differentiated with hydrochloric acid alcohol for 5–10 s, followed by washing with running water for 3 min. HE-stained sections were further stained with eosin for 30 s. Masson-stained sections were further stained with Ponceau S solution for 5–10 min, washed with 0.2% acetic acid solution for 1–2 min, and differentiated with 1% phosphomolybdic acid solution for 1–2 min. After being washed with 1% acetic acid solution for 1–2 min, they were stained with 1% aniline blue solution for 1–2 min and washed with 1% acetic acid solution for 1–2 min.

After dehydration and transparency, the sections were mounted with neutral gum. Images were captured using a Leica DM4000B upright fluorescence microscope (Leica Microsystems, Germany) equipped with a 40×objective lens. For each lung tissue section, five non-overlapping fields were randomly selected to ensure representative sampling. Image resolution was set to 1920 × 1440 pixels, and consistent bright-field illumination was maintained across all samples. Positive stained areas were identified in ImageJ v1.48 (NIH, USA) using a standardized thresholding method (Otsu’s algorithm) to minimize inter-observer variability. Background signal was subtracted by measuring the mean gray value of unstained regions in the same field. Integrated density (positive area × mean gray value) and normalized data were statistically analyzed using GraphPad Prism 9.0 (GraphPad Software, USA).

Immunohistochemical staining

Sections were deparaffinized, rehydrated, and boiled in 0.01 M PBS (pH 7.4) for 15 min to retrieve antigen. Then, endogenous peroxidase was inactivated with 3% hydrogen peroxide, and the sections were blocked with 10% goat serum in 0.5% BSA/PBST for 1 h. Goat serum was substituted for the primary antibody as a negative control. Sections were incubated with primary antibodies at 4 °C overnight. Goat Anti-Type I Collagen-UNLB (1:200, Southern Biotech, USA), monoclonal mouse Anti-Actin Antibody (1:200, Santa Cruz Biotechnology, USA), polyclonal rabbit TGF-beta 1 antibody (1:100, ABclonal, China), Smad2 monoclonal rabbit antibody (1:50, Cell Signaling Technology, USA), monoclonal mouse anti-proliferating cell nuclear antigen (PCNA) (1:400, Dako, Denmark), polyclonal rabbit Anti-Caspase-3 antibody (1:300, abcam, USA), monoclonal mouse Anti-IL-1β Antibody (1:200, Santa Cruz Biotechnology, USA), monoclonal mouse Anti-IL-6 Antibody (1:200, Santa Cruz Biotechnology, USA), monoclonal mouse Anti-TNFα Antibody (1:200, Santa Cruz Biotechnology, USA), monoclonal mouse Anti-DNA/RNA Damage antibody (1:400, abcam, USA), monoclonal rabbit Anti-Chk2 antibody (1:400, abcam, USA) and monoclonal rabbit Anti-gamma H2A.X (phospho S139) antibody (1:400, abcam, USA) were used in this study. The sections were washed three times to remove unconjugated primary antibodies, and the corresponding secondary antibodies were added, followed by incubation at room temperature for 1 h. The sections were washed 3 times to remove unbound secondary antibodies. Then, color was developed with DAB chromogenic solution, and the sections were counterstained with hematoxylin and coverslipped with neutral gum as mounting media. Consistent with H&E imaging (Sect. 2.3), images were acquired under identical microscope settings (40× objective, 1920 × 1440 resolution). Positive areas were quantified using the same Image J protocol as in Sect. 2.3, with threshold values pre-calibrated against negative control slides. Results from three biological replicates were averaged for statistical comparisons.

Western blotting

Proteins were extracted from the lungs and quantified by the BCA Protein Assay Kit (Beyotime, Shanghai, China). Twenty microgram proteins of each sample were electrophoretically separated using SDS gels and transferred to nitrocellulose membranes. The membranes were incubated overnight at 4 °C with the following antibodies: Goat Anti-Type I Collagen-UNLB (1:1000, Southern Biotech, USA), monoclonal mouse Anti-Actin Antibody (1:800, Santa Cruz Biotechnology, USA), polyclonal rabbit TGF-beta 1 antibody (1:800, ABclonal, China), Smad2 monoclonal rabbit antibody (1:1000, Cell Signaling Technology, USA), monoclonal mouse anti-proliferating cell nuclear antigen (PCNA) (1:1000, Dako, Denmark), polyclonal rabbit Anti-Caspase-3 antibody (1:1000, abcam, USA), polyclonal rabbit Anti-CDKN2A/p16INK4a antibody (1:2000, abcam, USA), polyclonal rabbit Anti-CDKN2A/p19ARF antibody (1:1000, abcam, USA), monoclonal mouse Anti-p21 Waf1/Cip1/CDKN1A Antibody (F-5) (1:1000, Santa Cruz Biotechnology, USA), monoclonal mouse Anti-p27 Kip1/CDKN1B Antibody (F-8) (1:1000, Santa Cruz Biotechnology, USA), monoclonal mouse Anti-p53 Antibody (DO-1) (1:1000, Santa Cruz Biotechnology, USA), monoclonal mouse polyclonal rabbit Bax Antibody (1:1000, Cell Signaling Technology, USA), monoclonal rabbit Bcl-2 (D17C4) Rabbit mAb (Mouse Preferred) (1:1000, Cell Signaling Technology, USA), monoclonal mouse Anti-IL-1β Antibody (1:800, Santa Cruz Biotechnology, USA), monoclonal mouse Anti-IL-6 Antibody (1:800, Santa Cruz Biotechnology, USA), monoclonal mouse Anti-TNFα Antibody (1:800, Santa Cruz Biotechnology, USA), polyclonal rabbit Anti-NF-κB p65 antibody (1:2000, abcam, USA), polyclonal rabbit Anti-Superoxide Dismutase 1 antibody (1:1000, abcam, USA), polyclonal rabbit Anti-SOD2/MnSOD antibody (1:1000, abcam, USA), polyclonal rabbit Anti-Peroxiredoxin 1/PAG antibody (1:5000, abcam, USA), monoclonal mouse Anti-DNA/RNA Damage antibody (1:100, abcam, USA), monoclonal rabbit Anti-Chk2 antibody (1:100, abcam, USA), and monoclonal rabbit Anti-gamma H2A.X (phospho S139) antibody (1:2000, abcam, USA). Monoclonal mouse anti-β-actin antibody (1:2000; Bioworld, USA) was used as a loading control. This was followed by incubation for 1 h with the corresponding secondary antibody as HRP-conjugated goat anti-rabbit IgG, HRP-conjugated goat anti-mouse IgG, or HRP-conjugated rabbit anti-goat IgG (1:2000; Biosharp, Hefei, Anhui, China). The membranes were imaged using the BIO-RAD ChemiDoc XRS + system (BIO-RAD, USA). Exposure time (5–60 s) was optimized based on preliminary experiments to ensure signals remained within the linear dynamic range (without pixel saturation). Original images were archived in TIFF format without post-acquisition adjustments. Density analysis was performed using Image J software (NIH, USA) with β-actin serving as the internal control. Statistical analysis was performed using GraphPad Prism 9.0 (GraphPad Software, USA), with statistical significance defined as an adjusted p-value < 0.05 after Bonferroni correction for multiple comparisons.

Statistical analysis

All data were analyzed using GraphPad Prism software and are presented as mean ± SEM. Comparisons between two groups were performed using unpaired or paired t-tests, as appropriate. To rigorously address the multiple hypothesis testing problem, we applied a family-wise Bonferroni correction by treating each figure as an independent hypothesis family (e.g., Fig. 1 = Family 1, Fig. 2 = Family 2). Within each family, all between-group comparisons were collectively adjusted to control the family-wise error rate (FWER) at α = 0.05. The correction procedure followed three steps:

  1. 1.

    1.Count: Determine the total number of between-group comparisons (n) within a figure (e.g., n = 3 for Fig. 1)0.2. Adjust: Multiply raw p-values by n to calculate adjusted p-values: adjusted p = raw p × n.

  2. 2.

    3. Evaluate : Compare adjusted p-values against the global threshold of α = 0.05 (adjusted p < 0.05 required for significance). For example, in Fig. 1 (3 comparisons), the raw p-value is 0.0006, and the adjusted p-value becomes 0.0018 (0.0006 × 3). This approach ensures that the probability of Type I errors across all comparisons within a figure is ≤ 5%. The number of comparisons per figure was as follows: Fig. 1 (3), Fig. 2 (1), Fig. 3 (5), Fig. 4 (4), Fig. 5 (11), Fig. 6 (7), Fig. 7 (3), and Fig. 8 (5). A detailed workflow of the correction process is provided in Supplementary Fig. 3. This methodology was applied uniformly across all figures to maintain statistical rigor and transparency.

Results

Deletion of PTHrP NLS and C-terminus led to structural changes in lungs

To investigate the impact of PTHrP KI on lung development, we conducted a comparative analysis of morphological features, body weight, lung weight, lung morphology, and histology between PTHrP KI and WT mice.The results demonstrated that PTHrP KI mice exhibited significantly smaller body size (Fig. 1A) and markedly reduced body weight compared to WT mice (Fig. 1B, adjusted p < 0.01). Additionally, PTHrP KI mice displayed smaller lungs (Fig. 1C), significantly decreased lung weight (Fig. 1D, adjusted p < 0.01), and a notably higher lung-to-body weight ratio than WT mice (Fig. 1E, adjusted p < 0.05). To further evaluate the effects of PTHrP KI on lung development, histological differences between PTHrP KI and WT lungs were examined using hematoxylin and eosin (H&E) staining.Histological analysis of H&E-stained lung sections revealed structural anomalies in PTHrP KI mice, including alveolar simplification, inflammatory cell infiltration, and regions of collagen deposition (Fig. 1F).These findings suggest that loss of PTHrP’s NLS and C-terminus disrupts pulmonary architecture and may promote fibrotic remodeling.

Fig. 1
figure 1

Deletion of PTHrP NLS and C-terminus led to structural changes in lungs. (A) Gross images of WT and KI mice. (B) Statistical results of body weight in WT and KI mice. (C) Gross images of lungs from WT and KI mice. (D) Statistical results of lung weight in WT and KI mice. (E) Statistical results of lung-to-body weight ratio (%) in WT and KI mice. (F) H&E-stained microscopic images of lungs from WT and KI mice (magnification, ×400; scale bar, 25 μm). (A-F) Data are from three independent biological replicates (n = 3 WT and 3 KI mice). Adjusted P-value = Original P-value × Number of multiple comparisons (Bonferroni correction) adjusted p = raw p × 3 *p < 0.05, **p < 0.01, ***p < 0.001.

Full size image

Deletion of PTHrP NLS and C-terminus reduced the expression of PTH1R in lung tissue

To investigate whether the absence of NLS and C-terminal domains in PTHrP would cause changes in the level of PTH1R in lung tissue, we evaluated the lung tissue sections of PTHrP KI and WT mice using PTH1R immunohistochemical staining (Fig. 2A). Quantitative analysis using ImageJ software revealed a significant reduction in PTH1R-positive area from 11.77 ± 1.34% in WT mice to 3.14 ± 0.59% in KI mice (adjusted p < 0.01) (Fig. 2B).These data indicate that PTHrP NLS and C-terminal deletion can reduce the expression of PTH1R in lung tissue.

Fig. 2
figure 2

Deletion of PTHrP NLS and C-terminus reduced the expression of PTH1R in lung tissue. A.Representative PTH1R immunohistochemical micrographs (400× magnification, scale bar = 25 μm). B. Statistical results of PTH1R IHC-positive area percentage in WT and KI mice. (A-B) Data are from three independent biological replicates (n = 3 WT and 3 KI mice) *p < 0.05, **p < 0.01, ***p < 0.001.

Full size image

Deletion of PTHrP NLS and C-terminus led to pulmonary fibrosis

To investigate whether the deletion of the NLS and C-terminal domains in PTHrP induces pulmonary fibrosis, lung histological sections from PTHrP KI and WT mice were evaluated by Masson’s trichrome staining, collagen I (Col-1) IHC staining, and α-SMA IHC staining (Fig. 3A and C). Quantitative analysis with Image J software revealed that the Masson-positive area was significantly increased from 7.72 ± 0.29% in WT mice to 13.63 ± 0.57% in KI mice (Fig. 3D, adjusted p < 0.01). Consistently, Col-1-positive areas showed an increase from 3.13 ± 0.57% (WT) to 12.50 ± 0.57% (KI) (adjusted p < 0.001), while α-SMA-positive areas rose from 1.21 ± 0.47% to 5.76 ± 0.72% (adjusted p < 0.01) (Fig. 3E and F).

To corroborate these histological findings, Col-1 and α-SMA expression were further examined in lung tissues using Western blotting analysis (Fig. 3G). Quantification with Image J software demonstrated that both Col-1 (adjusted p < 0.05) and α-SMA (adjusted p < 0.001) protein levels were significantly elevated in KI mice compared to WT controls (Fig. 3H). Taken together, these data indicate that deletion of both the NLS and C-terminal domains in PTHrP promotes the development of pulmonary fibrosis.

Fig. 3
figure 3

Deletion of PTHrP NLS and C-terminus led to pulmonary fibrosis. A. Representative masson staining micrograph (400× magnification, scale = 25 μm). B. Representative Col-1 immunohistochemical micrographs (400× magnification, scale bar = 25 μm). C. Representative α-SMA immunohistochemical micrographs (400× magnification, scale bar = 25 μm). D. Statistical results of Masson staining-positive area percentage in WT and KI mice. E. Statistical results of Col-1 IHC-positive area percentage in WT and KI mice. F. Statistical results of α-SMA IHC-positive area percentage in WT and KI mice. G. Western blot results of Col-1 and α-SMA proteins in lung tissues, with β-actin serving as the loading control. H. Statistical results of Col-1 and α-SMA protein expression levels. (A-H) Data are from three independent biological replicates (n = 3 WT and 3 KI mice). Adjusted P-value = Original P-value × Number of multiple comparisons (Bonferroni correction) adjusted p = raw p × 5 *p < 0.05, **p < 0.01, ***p < 0.001.

Full size image

Deletion of PTHrP NLS and C-terminus caused activation of TGF-β/Smad signaling

To investigate the association between pulmonary fibrosis induced by PTHrP NLS/C-terminus deletion and TGF-β/Smad pathway activation, we performed IHC analysis of TGF-β1 and Smad2 expression in lung tissues from PTHrP KI and WT mice (Fig. 4A and B). Quantitative analysis using Image J software revealed that WT mice exhibited positive areas of 1.82 ± 0.29% for TGF-β1 and 0.50 ± 0.07% for Smad2. In contrast, KI mice showed significantly increased positive areas of 9.59 ± 1.01% for TGF-β1 and 2.29 ± 0.49% for Smad2 (Fig. 4C and D, adjusted p < 0.05 for all comparisons).

To further validate the association between PTHrP truncations and TGF-β/Smad pathway activation, we performed Western blot analysis of TGF-β1 and Smad2 expression in lung tissues (Fig. 4E). The results demonstrated markedly elevated protein levels of both TGF-β1 and Smad2 in KI mice compared to WT controls (Fig. 4F, adjusted p < 0.05 for all comparisons). These integrated findings demonstrate that genetic ablation of PTHrP NLS and C-terminal domains potentiates TGF-β/Smad signaling activation, providing mechanistic insights into the pathogenesis of PTHrP-associated pulmonary fibrosis.

Fig. 4
figure 4

Deletion of PTHrP NLS and C-terminus caused activation of TGF-β/Smad signaling. A. Representative TGF-β1 immunohistochemical micrographs (400× magnification, scale bar = 25 μm). B. Representative Smad2 immunohistochemical micrographs (400× magnification, scale bar = 25 μm). C. Statistical results of TGF-β1 IHC-positive area percentage in WT and KI mice. D. Statistical results of Smad2 IHC-positive area percentage in WT and KI mice. E. Western blot results of TGF-β1 and Smad2 proteins in lung tissues, with β-actin serving as the loading control. F. Statistical comparison of TGF-β1 and Smad2 protein expression levels. (A-F) Data are from three independent biological replicates (n = 3 WT and 3 KI mice) Adjusted P-value = Original P-value × Number of multiple comparisons (Bonferroni correction) adjusted p = raw p × 4 *p < 0.05, **p < 0.01, ***p < 0.001.

Full size image

Deletion of PTHrP NLS and C-terminus reduced lung cell proliferation and promoted apoptosis and senescence

To investigate whether structural abnormalities induced by deletion of the PTHrP NLS and C-terminal domains were associated with reduced proliferation and enhanced apoptosis, we performed IHC analysis of proliferating cell nuclear antigen (PCNA) and cleaved Caspase-3 in lung tissues from PTHrP KI and WT mice (Fig. 5A and B). Quantitative analysis using Image J software revealed that WT mice exhibited a PCNA-positive cell percentage of 5.97 ± 0.07%, whereas KI mice showed a significant reduction to 3.59 ± 0.11% (Fig. 5C, adjusted p < 0.001). Conversely, the cleaved Caspase-3-positive area percentage increased from 3.26 ± 0.27% in WT mice to 7.21 ± 0.45% in KI mice (Fig. 5D, adjusted p < 0.05).

To further validate the relationship between deletion of the PTHrP NLS and C-terminal and pulmonary developmental abnormalities, we analyzed protein expression levels of proliferation-, apoptosis-, and senescence-associated markers by Western blotting (Fig. 5E). Compared with the WT control group, PCNA expression in KI mice showed significant downregulation (adjusted p < 0.05), whereas Bcl-2 expression did not reach statistical significance after multiple testing correction (unadjusted p < 0.05, adjusted p > 0.05). The pro-apoptotic markers Caspase-3 and Bax were significantly upregulated in KI mice (both adjusted p < 0.05). Among senescence-associated markers, p16 and p27 showed significant elevation (adjusted p < 0.05), while p19、p21 and p53 expression levels remained unchanged despite nominal significance in unadjusted analyses (unadjusted p < 0.05, adjusted P > 0.05).(Fig. 5F). These findings suggest that deletion of the PTHrP NLS and C-terminal domains impairs pulmonary development through mechanisms involving suppressed cellular proliferation, enhanced apoptosis, and accelerated cellular senescence.

Fig. 5
figure 5

Deletion of PTHrP NLS and C-terminus reduced lung cell proliferation and promoted apoptosis and senescence. (A) Representative PCNA immunohistochemical micrographs (400× magnification, scale bar = 25 μm). (B) Representative cleaved Caspase-3 immunohistochemical micrographs (400× magnification, scale bar = 25 μm). (C) Statistical results of the percentage of PCNA-positive area in WT and KI mice. (D) Statistical results of the percentage of cleaved Caspase-3-positive area in WT and KI mice. (E) Western blot results of PCNA, Caspase-3, Bax, Bcl-2, p16, p19, p21, p27, and p53 proteins in lung tissues, with β-actin serving as the loading control. (F) Statistical comparison of PCNA, Caspase-3, Bax, Bcl-2, p16, p19, p21, p27, and p53 protein expression levels. (A-F) Data are from three independent biological replicates (n = 3 WT and 3 KI mice). Adjusted P-value = Original P-value × Number of multiple comparisons (Bonferroni correction) adjusted p = raw p ×11 *p < 0.05, **p < 0.01, ***p < 0.001.

Full size image

Deletion of PTHrP NLS and C-terminus promoted production of inflammatory cytokines in the lungs

To investigate whether pulmonary hypoplasia induced by deletion of the PTHrP NLS and C-terminal domains is associated with enhanced pulmonary inflammation, we performed IHC analysis of IL-1β, IL-6, and TNF-α expression in lung tissues from PTHrP KI and WT mice (Fig. 6A and C). Quantitative analysis using Image J software demonstrated significantly increased inflammatory marker expression in KI mice compared to WT controls. WT lungs showed IL-1β-positive areas of 4.03 ± 0.42%, IL-6-positive areas of 2.98 ± 0.66%, and TNF-α-positive areas of 3.35 ± 0.12%. In contrast, KI mice exhibited markedly elevated values of 16.19 ± 0.38% (IL-1β), 8.78 ± 0.79% (IL-6), and 12.34 ± 0.22% (TNF-α) (Fig. 6D and F, adjusted p < 0.05 for all comparisons).

To further validate the association between PTHrP NLS/C-terminal deletion-induced pulmonary hypoplasia and inflammatory activation, we conducted Western blot analysis of lung tissue lysates (Fig. 6G). Quantitative densitometry revealed significant upregulation of pro-inflammatory cytokines in KI mice compared with WT controls, with IL-1β, IL-6 and TNF-α (adjusted p < 0.05) showing statistically significant elevation after Bonferroni correction. Total NF-κB p65 protein levels exhibited no significant intergroup difference following multiple testing adjustment (unadjusted p < 0.05, adjusted p > 0.05)(Fig. 6H). These findings suggest that ablation of PTHrP’s NLS and C-terminal domains exacerbates pulmonary inflammation primarily through cytokine overproduction, while canonical NF-κB signaling activation may require further verification through phosphorylation status or nuclear translocation analyses.

Fig. 6
figure 6

Deletion of PTHrP NLS and C-terminus promoted production of inflammatory cytokines in the lungs. (A) Representative IL-1β immunohistochemical micrographs (×400 magnification, scale bar = 25 μm). (B) Representative IL-6 immunohistochemical micrographs (×400 magnification, scale bar = 25 μm). (C) Representative TNF-α immunohistochemical micrographs (×400 magnification, scale bar = 25 μm). (D) Statistical results of the percentage of IL-1β-positive area in WT and KI mice. (E) Statistical results of the percentage of IL-6-positive area in WT and KI mice. (F) Statistical results of the percentage of TNF-α-positive area in WT and KI mice. (G) Western blot results of IL-1β, IL-6, TNF-α, and p65 proteins in lung tissues, with β-actin serving as the loading control. (H) Statistical comparison of IL-1β, IL-6, TNF-α, and p65 protein expression levels. (A-H) Data are from three independent biological replicates (n = 3 WT and 3 KI mice). Adjusted P-value = Original P-value × Number of multiple comparisons (Bonferroni correction) adjusted p = raw p ×7 *p < 0.05, **p < 0.01, ***p < 0.001.

Full size image

Deletion of PTHrP NLS and C-terminus promoted lung oxidative stress

To investigate whether pulmonary hypoplasia resulting from deletion of the PTHrP NLS and C-terminal regions is correlated with elevated oxidative stress, we performed Western blot analysis of SOD1, SOD2, and Prdx1 expression levels in lung tissues (Fig. 7A). Quantitative analysis using Image J software demonstrated significantly reduced protein expression levels of SOD1 (adjusted p < 0.05), SOD2 (adjusted p < 0.05), and Prdx1 (adjusted p < 0.01) in lung tissues from KI mice compared to WT controls (Fig. 7B).These results indicate that PTHrP NLS and C-terminal domain deletions induce pulmonary hypoplasia through mechanisms associated with increased oxidative stress.

Fig. 7
figure 7

Deletion of PTHrP NLS and C-terminus promoted lung oxidative stress. (A) Western blot results of SOD1、SOD2 and Prdx1 proteins in lung tissues, with β-actin serving as the loading control. (B) Statistical comparison of SOD1、SOD2 and Prdx1 protein expression levels. (A-B) Data are from three independent biological replicates (n = 3 WT and 3 KI mice). Adjusted P-value = Original P-value × Number of multiple comparisons (Bonferroni correction) adjusted p = raw p ×3 *p < 0.05, **p < 0.01, ***p < 0.001.

Full size image

Deletion of PTHrP NLS and C-terminus promoted lung DNA damage

To investigate whether pulmonary hypoplasia induced by deletion of the PTHrP NLS and C-terminal regions is associated with enhanced DNA damage in lung tissues, we performed IHC staining for 8-hydroxy-2’-deoxyguanosine (8-OHdG), checkpoint kinase 2 (Chk2), and phosphorylated H2A histone family member X (γH2A.X) on lung sections from PTHrP KI and WT mice (Fig. 8A and C). Quantitative analysis using Image J software demonstrated that the 8-OHdG-positive area in WT mice was 2.93 ± 0.38%, while Chk2 and γH2A. X positivity occupied 0.07 ± 0.01% and 0.04 ± 0.01%, respectively. In contrast, KI mice exhibited significantly increased positivity for all markers: 8.29 ± 0.70% for 8-OHdG (adjusted p < 0.01), 5.94 ± 0.15% for Chk2 (adjusted p < 0.001), and 6.11 ± 0.75% for γH2A.X (adjusted p < 0.01) (Fig. 8D and F).

To further corroborate the link between PTHrP NLS/C-terminal deletion-induced pulmonary hypoplasia and DNA damage accumulation, we conducted Western blot analysis of 8-OHdG and γH2A. X expression in lung lysates (Fig. 8G). Densitometric quantification revealed significantly elevated protein levels of both DNA damage markers in KI mice compared to WT controls (8-OHdG adjusted p < 0.05; γH2A.X adjusted p < 0.001) (Fig. 8H). Collectively, these data demonstrate that targeted deletion of PTHrP’s NLS and C-terminal domains exacerbates DNA damage in developing lungs, which is strongly associated with the observed pulmonary hypoplasia phenotype.

Fig. 8
figure 8

Deletion of PTHrP NLS and C-terminus promoted lung DNA damage. (A) Representative 8-OHdG immunohistochemical micrographs (×400 magnification, scale bar = 25 μm). (B) Representative Chk2 immunohistochemical micrographs (×400 magnification, scale bar = 25 μm). (C) Representative γ-H2A.X immunohistochemical micrographs (×400 magnification, scale bar = 25 μm). (D) Statistical results of the percentage of 8-OHdG-positive area in WT and KI mice. (E) Statistical results of the percentage of 8-Chk2-positive area in WT and KI mice. (F) Statistical results of the percentage of γ-H2A.X-positive area in WT and KI mice. (G) Western blot images of 8-OHdG and γ-H2A.X in lung tissues, with β-actin as loading control. (H) Statistical comparison of 8-OHdG and γ-H2A.X protein expression levels. (A-H) Data are from three independent biological replicates (n = 3 WT and 3 KI mice). Adjusted P-value = Original P-value × Number of multiple comparisons (Bonferroni correction) adjusted p = raw p ×5 *p < 0.05, **p < 0.01, ***p < 0.001.

Full size image

Discussion

PTHrP plays a crucial role in the growth and development of multiple organs26,27,28,29. PTHrP and its type 1 receptor are widely expressed in the lungs and can regulate lung function. In this study, immunohistochemical analysis revealed a significant reduction in PTH1R-positive cells in the lungs of PTHrP KI mice compared to WT littermates.This downregulation of PTH1R may reflect disrupted feedback mechanisms or transcriptional regulation caused by the KI mutation. Given that PTH1R mediates critical pathways in lung homeostasis, including epithelial-mesenchymal crosstalk and cellular differentiation, its reduced expression could exacerbate the observed phenotypic alterations in KI mice. PTHrP KI mice show impaired growth and premature aging of bones, skin, brain, spinal cord and other organs, but there has been no report on the development of lungs in PTHrP KI mice6,18,30,31,32,33,34,35.

Notably, while the truncated PTHrP1-36 in KI mice retains the intact PTH1R-binding domain, the observed reduction in receptor levels suggests potential compensatory regulation. Continuous stimulation by the truncated ligand or disrupted negative feedback loops might alter receptor sensitivity or trafficking. Further investigations (e.g., qPCR/WB for PTH1R mRNA/protein levels, ligand-receptor binding assays) are needed to clarify whether the mutation directly impacts PTH1R expression or downstream signaling fidelity.This study intends to investigate the functions of PTHrP NLS and C-terminus in lung development by constructing the PTHrP KI mouse model. In order to clarify the effect of PTHrP NLS and C-terminus deletion on the lung, we used histology, immunohistochemistry and Western blotting techniques to compare and analyze the phenotypic differences in the lungs of 10-day-old PTHrP KI and littermate WT mice. The results indicated that the lung weight was reduced and the lung mass index was increased in PTHrP KI mice, and HE staining showed that compared with those in WT mice, inflammatory cell infiltration and fibrosis appeared in the lungs of PTHrP KI mice. These findings suggested that PTHrP NLS and C-terminus deletion can lead to structural abnormalities of the lungs.

It has been reported that PTHrP NLS can play a role in the development of skin, brain, spinal cord, bone and other organs through endocrine, paracrine or autocrine pathways6,19,34,36,37,38. Therefore, after discovery of lung dysplasia in PTHrP KI mice, the effects of PTHrP NLS and C-terminus on the proliferation and apoptosis of mouse lung cells were further observed. Immunohistochemistry, Western blotting and other methods were employed to detect cell proliferation- and apoptosis-related proteins, and the experimental results demonstrated that deletion of PTHrP NLS and C-terminus can lead to decreased proliferation and increased apoptosis of lung cells, which is consistent with the effects of PTHrP NLS and C-terminus on cell proliferation and apoptosis reported in other tissues. The decrease in cell proliferation ability and the increase in apoptosis are often related to the abnormal regulation of cell cycle. P16, p19, p21, p27 and p53 are cyclin-dependent kinase inhibitors (CDKIs)39,40. P16 and p19 can inhibit the binding of Cyclin D to cyclin-dependent kinase 4/6 (CDK4/6) by suppressing the expression of downstream genes required to enter S phase from G1 phase, thus causing cell cycle arrest in G1 phase. P27 can inhibit Cyclin D, Cyclin E and CDK2, causing cell cycle arrest in G1 phase[40,41]. P53 can induce cell cycle arrest by inducing the expression of p2142. Therefore, we further detected the expression changes of p16, p19, p21, p27 and p53 in lung tissues by Western blotting. The increase of aging related markers p16 and p27 indicated that the lung cell cycle of KI mice was stagnant. p16 blocks G1 phase by inhibiting CDK4/6, and p27 plays a similar role by inhibiting CDK2 complex, which synergically leads to proliferation inhibition. No significant changes in p53/p21: The P53-P21 pathway was not significantly activated, suggesting that aging may be driven by p53-independent pathways such as oxidative stress or telomere damage. No change in p19 (ARF) further supports this hypothesis.

Both IHC and Western blot results showed that the expression of PCNA in KI mice lung tissue was significantly decreased, suggesting that the loss of NLS and C-terminal domain led to a decrease in cell proliferation. PTHrP may regulate the transcription of proliferation-related genes, such as cyclin, through its NLS and domain deletion may interfere with its intranuclear function.The concurrent reduction in PTH1R may further compromise proliferative signals, as PTH1R activation is known to promote epithelial cell survival and alveolar repair. Thus, the combined effects of truncated PTHrP and diminished PTH1R expression likely create a permissive environment for cell cycle arrest and apoptosis.

In lung development, cell apoptosis is associated with some specific molecules, such as pro-apoptotic molecules (e.g., Bax and Caspase proteins) and anti-apoptotic molecules (e.g., Bcl-2)43,44. In the lung, a balance should be maintained between pro-apoptotic and anti-apoptotic effects. Caspase-3 is one of the members of the cysteine protease family, as well as the main effector molecule of apoptosis45. It exists in the form of zymogen in cells and can be activated to initiate apoptosis when it receives apoptosis signals inside and outside the cells. Bcl-2 is a membrane protein that can block the activity of Caspase protein and can also restrain cell apoptosis through mechanisms such as anti-oxidation46. Caspase-3 and Bax were significantly elevated in KI mice, indicating that the mitochondrial apoptosis pathway was activated. The increase in cleaved caspase-3-positive areas observed by immunohistochemistry (IHC), supported by significant Western blot findings, indicates an enhanced trend of apoptosis. The anti-apoptotic protein Bcl-2 was not significantly down-regulated, suggesting that PTHrP loss may induce apoptosis through non-Bcl-2 dependent pathways such as direct activation of the Caspase cascade or endoplasmic reticulum stress. The NLS and C-terminal domains of PTHrP play a key role in lung development by regulating the balance of cell proliferation, apoptosis, and senescence. Its absence leads to multi-dimensional cell dynamic dysregulation, which eventually leads to structural abnormalities in lung tissue. This discovery provides a new perspective for understanding the molecular mechanism of lung development and the treatment of related diseases.

Studies have reported that the phenotype associated with senescent cells is one of the important causes of inflammatory aging47,48. During cellular senescence, a large number of inflammatory factors such as IL-1β, IL-6 and TNF-α are released, which then mediate inflammation49,50,51. Therefore, we compared the expression levels of IL-1β, IL-6 and TNF-α in the lungs of PTHrP KI and WT mice by immunohistochemistry and Western blotting. The results showed that the protein expressions of IL-1β, IL-6 and TNF-α in the lungs of PTHrP KI mice were significantly higher than those of WT mice. Since the NF-κB pathway is a key signaling molecule mediating senescence-associated secretory phenotype (SASP), therefore, we used Western blotting to detect the protein expression of p65 in the lungs of PTHrP KI and WT mice. After multiple tests and adjustments, there was no statistically significant difference in total NF-κB p65 protein level between groups. The original significance may have been diluted due to the strict correction of Bonferroni method, or the correction was not significant due to insufficient sample size. There are also typical NF-κB signaling activations that may require phosphorylation and need to be further validated by our analysis. These results indicate that deletion of PTHrP NLS and C-terminus leading to up-regulation of lung inflammatory factors may play an important role in premature aging of the lungs in PTHrP KI mice.

Oxidative stress has been linked to various disease states as well as physiological aging52. Therefore, the present study investigated whether lung dysplasia resulting from deletion of PTHrP NLS and C-terminus is closely related to increased oxidative stress. Our results found that SOD1, SOD2 and Prdx1 protein expression levels were significantly down-regulated in the lung tissues of PTHrP KI mice. Deletion of SOD1, SOD2 and Prdx1 significantly increased the production of reactive oxygen species (ROS) in cells. The balance of ROS production and antioxidant defense determines the degree of oxidative stress. PTHrP NLS and C-terminus deletion may contribute to lung dysplasia through increased oxidative stress.

Previous studies have shown that oxidative stress can activate DNA damage response pathways53. DNA damage response is a complex network of multi-signaling pathways involving DNA repair-related process that occurs in cells54,55,56. ROS can cause DNA damage (damaged and broken DNA double-strands can be labeled by 8-OHdG) and will further activate phosphorylated Chk2, promoting the phosphorylation and conversion of histone H2A.X to γ-H2A.X, and activating the DNA damage response57,58. Therefore, the present study investigated whether lung dysplasia resulting from PTHrP NLS and C-terminus deletion is closely associated with increased DNA damage. Our study demonstrated a DNA damage response in the lungs of PTHrP NLS and C-terminus deletion mice, including significant increases in 8-OHdG, Chk2 and γ-H2A.X positive cells, and the protein expression levels of 8-OHdG and γ-H2A.X in the lung were significantly increased. Based on these, PTHrP NLS and C-terminus deletion may contribute to lung dysplasia by increasing DNA damage.

Pulmonary fibrosis is a progressive and end-stage lung disease, and also a disease of aging59. Since PTHrP KI mice exhibited impaired growth of multiple organs and premature aging, we used Masson’s staining, immunohistochemical staining and Western blotting to detect fibrosis-related indicators. The results showed that the ratio of the positive area of Masson’s staining and the positive areas of Col-1 and α-SMA to the total area in PTHrP KI mice was significantly increased. Moreover, the protein expression levels of Col-1 and α-SMA in the lungs were also significantly increased. Therefore, the results suggest that PTHrP NLS and C-terminus deletion can cause pulmonary fibrosis in mice.

Previous studies have shown that activation of TGF-β signaling leads to pulmonary fibrosis60. The expressions of TGF-β and its receptors are significantly increased. The overexpression of active TGF-β in mice can be used as a sufficient and non-essential condition to induce the occurrence and development of pulmonary fibrosis61. Inhibition of TGF-β activity can slow down the disease progression in experimental animal models of pulmonary fibrosis. Therefore, we investigated whether pulmonary fibrosis induced by NLS and C-terminus deletion of PTHrP is closely related to TGF-β signaling activation. The results showed that the positive areas of TGF-β1 and Smad2 in the lungs of PTHrP KI mice were significantly increased. The expression levels of TGF-β1 and Smad2 were significantly increased. These results suggested that pulmonary fibrosis induced by NLS and C-terminus deletion of PTHrP is closely related to the activation of the TGF-β/Smad signaling pathway. Finally, the interplay between PTHrP truncation and PTH1R downregulation may extend to fibrosis-related pathways. TGF-β/Smad activation, a hallmark of pulmonary fibrosis in KI mice, could be exacerbated by the loss of PTH1R-mediated antagonism of TGF-β signaling. Future studies should explore whether PTH1R agonism or PTHrP analogs could rescue fibrotic phenotypes in this model, offering therapeutic insights for aging-related lung diseases.

Conclusion

Taken together, the findings suggest that deletion of the NLS and C-terminus of PTHrP can reduce lung cell proliferation, facilitate cell apoptosis, increase the expression of inflammatory factors, cause increased oxidative stress and DNA damage, and lead to lung dysplasia. Meanwhile, deletion of the NLS and C-terminus of PTHrP can induce pulmonary fibrosis by activating the TGF-β/Smad signaling pathway. This study is the first to demonstrate that PTHrP NLS and C-terminus play important roles in lung development.