NLRP3-induced systemic inflammation controls the development of JAK2V617F mutant myeloproliferative neoplasms

Koerber, Ruth-Miriam; Krollmann, Calvin; Cieslak, Kevin; Tregel, Elisabeth; Saenz, Maria L.; Brümmendorf, Tim H.; Koschmieder, Steffen; Griesshammer, Martin; Gütgemann, Ines; Baldauf, Conny K.; Fischer, Thomas; Brossart, Peter; Kolbe, Carl Christian; Latz, Eicke; Wolf, Dominik; Teichmann, Lino L.

doi:10.1038/s41467-025-65673-4

Download PDF

Article
Open access
Published: 26 November 2025

NLRP3-induced systemic inflammation controls the development of JAK2V617F mutant myeloproliferative neoplasms

Nature Communications volume 16, Article number: 10591 (2025) Cite this article

3405 Accesses
1 Citations
76 Altmetric
Metrics details

Subjects

Abstract

The development of Philadelphia chromosome-negative classical myeloproliferative neoplasms (MPN) involves an inflammatory process that facilitates outgrowth of the malignant clone and correlates with clinical outcome measures. This raises the question to which extent inflammatory circuits in MPN depend on activation of innate immune sensors. Here, we investigate whether NLRP3, which precipitates inflammasome assembly upon detection of cellular stress, drives murine JAK2V617F mutant MPN. Deletion of Nlrp3 within the hematopoietic compartment completely prevents increased IL-1β and IL-18 release in MPN. NLRP3 in JAK2V617F hematopoietic cells, but not in JAK2 wild type radioresistant cells, promotes excessive platelet production via stimulation of the direct thrombopoiesis differentiation pathway, as well as granulocytosis. It also promotes expansion of the hematopoietic stem and progenitor cell compartment despite inducing pyroptosis at the same time. Importantly, NLRP3 inflammasome activation enhances bone marrow fibrosis and splenomegaly. Pharmacological blockade of NLRP3 in fully established disease leads to regression of thrombocytosis, splenomegaly and bone marrow fibrosis. These findings suggest that NLRP3 is critical for MPN development and its inhibition represents a new therapeutic intervention for MPN patients.

Interleukin-1 contributes to clonal expansion and progression of bone marrow fibrosis in JAK2V617F-induced myeloproliferative neoplasm

Article Open access 13 September 2022

Association of the composition of the bone marrow tumor microenvironment in BCR::ABL1-negative myeloproliferative neoplasms with IFN-γ signaling and driver mutations

Article Open access 05 August 2025

JAK2 inhibitor persistence in MPN: uncovering a central role of ERK activation

Article Open access 26 January 2022

Introduction

The Philadelphia chromosome-negative, classical myeloproliferative neoplasms (for simplicity referred to as MPNs) are caused by somatic mutations in hematopoietic stem cells that promote clonal expansion of myeloid progenitor cells. MPNs encompass several clinicopathologic entities, i.e. polycythemia vera (PV), essential thrombocythemia (ET), and primary myelofibrosis (PMF). The diseases are characterized by myeloid cell proliferation, high risk of thromboembolism, constitutional symptoms and have the potential to progress to acute myeloid leukemia.

The gain-of-function V617F mutation in Janus tyrosine kinase 2 (JAK2) is the most common inducer of MPNs and is detected in 95% of PV and 50-60% of ET and PMF patients¹. Notably, JAK2V617F has also been found in 3% of healthy individuals in a Danish general population study². JAK2V617F causes constitutive STAT as well as PI3K/Akt and Ras/Raf/MAPK/ERK signaling. The oncogenic property of JAK2V617F resides in its ability to initiate ligand-independent signaling downstream of the erythropoietin receptor (EPOR), thrombopoietin receptor (TPOR), and granulocyte-stimulating factor receptor (G-CSFR), resulting in erythrocytosis, thrombocytosis, and neutrophilia, respectively³. In addition, JAK2 mediates signals from a multitude of other surface receptors, including receptors for chemokines, interleukins, interferons and receptor tyrosine kinases, many of which are critically involved in inflammatory responses⁴.

It is now well recognized that chronic inflammation impacts clinical outcome in MPN. TNFα has been shown to promote clonal dominance of JAK2V617F expressing cells by inhibiting healthy hematopoiesis⁵. Overexpression of IL-8 has been linked to constitutional symptoms, and that of HGF, CXCL9, and IL-1RA to splenomegaly⁶. PV and ET patients have higher serum concentrations of C-reactive protein than healthy individuals, which are associated with an increased incidence of cardiovascular events⁷. Most importantly, IL-8, IL-2R, IL-12, IL-15, and CXCL10 are independently associated with poorer overall survival in PMF⁶. Thus, inflammation in MPN is closely related to clonal selection, symptom burden, thromboembolism and survival.

Recent work has established IL-1β as a major regulator of inflammation in the aging hematopoietic stem cell niche⁸ and in MPN^9,10. Deletion of Il1b in a JAK2V617F MPN mouse model reduced serum levels of a broad range of inflammatory cytokines¹⁰. Importantly, genetic or pharmacological inhibition of IL-1β or its receptor IL-1R1 was sufficient to ameliorate hallmark symptoms of MPN such as splenomegaly and myelofibrosis^9,10. However, IL-1β is produced by cells as a cytosolic pro-form that depends on cleavage by the proinflammatory protease caspase-1 for its activity and extracellular release. Caspase-1 also matures IL-18 and gasdermin D, which can induce pyroptosis, a form of lytic cell death¹¹. In addition it can degrade the transcription factor GATA1, which specifies erythroid cells and megakaryocytes¹². Activation of caspase-1 requires the assembly of cytoplasmic multiprotein complexes termed inflammasomes¹³. The type of inflammasome driving MPN development remains to be identified.

Inflammasomes consists of a sensor, the adaptor molecule Apoptosis-associated speck-like protein containing a caspase recruitment domain (ASC) and the effector caspase-1. The best characterized inflammasome sensors are NLRP1, NLRP3, NLRC4, and AIM2. NLRP3 (NOD-, LRR-, and pyrin domain-containing 3) is essential for the immune response to numerous pathogens, but is also involved in chronic sterile inflammatory diseases, such as cryopyrin-associated periodic syndrome, type II diabetes, Alzheimer’s disease, atherosclerosis, and gout¹⁴. Recently, it has been implicated in the pathogenesis of myelodysplastic syndrome (MDS)¹⁵ and KRAS mutant myeloid neoplasms¹⁶. NLRP3 expression is increased in bone marrow cells from MPN patients and NLRP3 inflammasome activation is enhanced in response to various stimuli in monocytes from MPN patients, human JAK2V617F mutant iPSC-derived and murine bone marrow-derived macrophages (BMDM)^17,18,19.

Here, we define the specific contributions of the inflammasome sensor NLRP3 to the pathogenesis of MPN by adopting two strategies, genetic deletion and pharmacological inhibition, to inactivate NLRP3 in a conditional JAK2V617F-driven mouse model of MPN.

Results

MPN patients exhibit increased spontaneous inflammasome activation

We performed cytokine profiling on serum samples from 173 MPN patients from the German Study Group MPN (GSG-MPN) bioregistry and 37 healthy controls. K-means clustering, an unsupervised algorithm, revealed a cluster of 17 cytokines (cluster A) that was upregulated in 43% of MPN patients but only in 13% of healthy controls (Fig. 1a). Notably, this cluster contained IL-1β and IL-18, whose maturation depends on caspase-1, suggesting inflammasome activation. The cluster also included IL-6, whose expression is induced by IL-1β, and TNFα, a priming factor for the NLRP3 inflammasome. We confirmed that IL-1β, IL-18 and TNFα levels were higher in MPN patients than in healthy controls when considered individually (Fig. 1b). In addition, serum concentrations of HMGB1, an alarmin that depends on inflammasome activation for its extracellular release, was also increased in MPN patients compared to healthy individuals (Fig. 1c). We then tested whether this heightened inflammasome activity in MPN patients is due to increased transcriptional priming. IL1B and CASP1 mRNA was upregulated in PBMCs from MPN patients compared to those from healthy controls (Fig. 1d). To determine whether JAK2V617F promotes transcriptional priming in a cell-intrinsic fashion, we used a published scRNA-seq dataset of hematopoietic stem and progenitor cells (HSPCs) from MPN patients containing single cell genotype information²⁰. JAK2V617F mutant HSPC showed stronger expression of an inflammasome gene signature than JAK2 wild type (WT) HSPCs from the same patients (Fig. 1e). These data support the concept that JAK2V617F cell-intrinsically upregulates inflammasome pathway components.

Many of the PV and MF patients in this study were treated with the JAK inhibitor ruxolitinib, which exerts anti-inflammatory in addition to antimyeloproliferative effects. Data from a phase 1-2 trial demonstrate that ruxolitinib influences some serum cytokine levels within 28 days of treatment²¹. Notably, there was no difference in serum IL-1β and IL-18 concentrations between untreated PV and MF patients and those receiving ruxolitinib under real-world conditions in our data set (Fig. 1f).

Altogether, these findings demonstrate spontaneous inflammasome priming and activation in MPN patients.

ASC speck formation in MPN patients is mediated by NLRP3

A hallmark of inflammasome activation is the ASC speck. We therefore quantified speck formation in peripheral blood mononuclear cells (PBMC) from MPN patients and healthy volunteers by flow cytometry²². The percentage of ASC speck positive cells in PBMCs without prior stimulation or after LPS plus nigericin was greater in MPN patients than in healthy individuals (Fig. 2a, b) and positively correlated with serum IL-1β concentrations (Fig. 2c). The increase in ASC speck positive cells was not due to a higher percentage of myeloid cells in MPN patients, as it was present in lymphocytes and myeloid cells (Fig. 2d). To assess the role of NLRP3 in ASC speck formation, we used flow cytometry to examine co-localization of NLRP3 and ASC specks in PBMCs from MPN patients. NLRP3 largely co-stained with ASC specks, indicating the formation of NLRP3-ASC complexes (Fig. 2e, f). To further confirm NLRP3’s involvement, we treated MPN patient PBMCs with the NLRP3 inhibitor MCC950. This treatment reduced the proportion of cells with ASC specks (Fig. 2g).

Thus, NLRP3 contributes at least in part to inflammasome activation observed in MPN patients.

Caspase-1 dependent cytokine secretion in Jak2 ^VF mice depends on the NLRP3 inflammasome

In the Vav-Cre;Jak2^V617F/+ mouse model (Jak2^VF hereafter) of MPN, expression of JAK2V617F induces a PV-like phenotype²³. We investigated whether inflammasome activation, as observed in MPN patients, also occurs in Jak2^VF mice. IL-1β, IL-18, TNFα and HMGB1 serum levels were markedly elevated in Jak2^VF relative to WT mice (Fig. 3a). Western blot analysis revealed higher amounts of pro-IL-1β in Jak2^VF than WT BMDM even without any stimulation and cleaved IL-1β was reliably detectable in the supernatant of LPS plus nigericin stimulated BMDM from Jak2^VF mice but barely evident in those from WT mice (Fig. 3b). To determine whether the expression of NLRP3 itself is dependent on JAK2V617F, we performed immunohistochemistry for NLRP3 on bone marrow sections from Jak2^VF, WT and Nlrp3^−/− mice. This analysis revealed a robust elevation of NLRP3 staining in Jak2^VF mice, supporting the hypothesis that JAK2V617F drives NLRP3 protein expression (Fig. 3d, e). To specifically test the role of the NLRP3 inflammasome in MPN we generated global NLRP3-deficient Jak2^VF mice (Jak2^VF;Nlrp3^−/−). Strikingly, loss of NLRP3 in Jak2^VF mice normalized IL-1β, IL-18 and TNFα serum concentrations (Fig. 3a). Using the murine myeloid cell line 32D, we found that caspase 1 activation is not solely induced by JAK2V617F, but also by other known MPN driver mutations, including CALRdel52 and CALRins5 (Fig. 3c).

In summary, in a JAK2V617F mutant mouse model of MPN, secretion of caspase-1 dependent cytokines relied on the NLRP3 inflammasome.

NLRP3 drives thrombocytosis and granulocytosis in murine MPN

Jak2^VF mice develop elevated erythrocyte, leukocyte and platelet counts²³. We sought to investigate the impact of the NLRP3 inflammasome on blood cell production. Jak2^VF, Jak2^VF;Nlrp3^−/− or WT bone marrow was transplanted into lethally irradiated WT mice (called Jak2^VF BM, Jak2^VF;Nlrp3^−/− BM and WT BM mice hereafter) and blood was obtained by the submandibular vein method repeatedly over 25 weeks. Platelet numbers were greatly reduced in Jak2^VF;Nlrp3^−/− BM compared to Jak2^VF BM mice; in fact, they were indistinguishable from those in WT BM mice (Fig. 4a). Hemoglobin and, for the most part, leukocyte levels were not affected by the deletion of Nlrp3. However, leukocyte counts are known to depend on the method of blood acquisition, with cardiac and vena cava bleeds providing the most consistent results²⁴. Therefore, after 26 weeks, mice were sacrificed and blood from the abdominal vena cava was collected. In this analysis, platelets and leukocytes were both lower in Jak2^VF;Nlrp3^−/− BM than in Jak2^VF BM mice (Fig. 4b). The drop in leukocytes was mainly due to a decrease in neutrophils, basophils, and eosinophils. Platelet leukocyte aggregates have been associated with thrombosis in MPN and are correlated with platelet counts²⁵. As expected, neutrophil-platelet and inflammatory monocyte-platelet aggregates were decreased in Jak2^VF;Nlrp3^−/− BM relative to Jak2^VF BM mice (Fig. 4c).

A recent report suggested that NLRP3 may promote hematopoietic stem cell engraftment after transplantation²⁶. In this study, platelets and leukocytes were reduced in mice transplanted with Nlrp3^−/− bone marrow compared to those receiving WT bone marrow until 3 weeks after transplantation, but the difference disappeared after 4 weeks. Thus, an engraftment defect due to NLRP3 deficiency was an unlikely explanation for the lower platelet and leukocyte counts in Jak2^VF;Nlrp3^−/− BM than in Jak2^VF BM mice, which persisted at least until 26 weeks after transplantation. Nevertheless, to investigate this possibility, we analyzed unmanipulated Jak2^VF and Jak2^VF;Nlrp3^−/− mice (i.e. non-transplanted). Jak2^VF;Nlrp3^−/− mice showed lower platelets and granulocytes than Jak2^VF mice, consistent with the results obtained in transplanted animals (Figs. 4d and S1a).

To investigate whether NLRP3 in non-hematopoietic radioresistant cells (such as epithelial and stromal cells) affects hematopoiesis in MPN we transplanted lethally irradiated WT and Nlrp3^−/− mice with Jak2^VF bone marrow. Lack of NLRP3 in radioresistant cells caused a slight reduction in platelets and leukocytes at week 5 after transplantation but had no effect beyond the engraftment period (Fig. S1b).

We conclude that Nlrp3 deletion in hematopoietic cells impedes thrombocytosis and granulocytosis in JAK2V617F-induced murine MPN.

The NLRP3 inflammasome promotes HSPC expansion and myeloid differentiation

JAK2V617F leads to an expansion of the HSPC compartment in MPN. The size of the LS-K cell population in the bone marrow was diminished in Jak2^VF;Nlrp3^−/− BM relative to Jak2^VF BM mice and comparable to that in WT BM mice (Fig. 5a and gating schematic in Fig. S2). Likewise, there were fewer LSK cells in the bone marrow of Jak2^VF;Nlrp3^−/− BM than of Jak2^VF BM mice. All LSK subsets, i.e. HSCs (hematopoietic stem cells), MPPs (multipotent progenitor) and HPCs (hematopoietic progenitor cells), in Jak2^VF;Nlrp3^−/− BM mice were reduced to numbers similar to or lower than those observed in WT BM mice. We made largely similar findings in the spleen (Fig. 5b). Thus, the NLRP3 inflammasome drives enlargement of the HSPC pool in the bone marrow and spleen in murine MPN.

HSCs represent a functionally heterogenous population. In MPN, HSCs show myeloid-biased differentiation. The expression level of CD150 on HSCs can be used to distinguish myeloid- from lymphoid-biased HSCs²⁷. Notably, deficiency for NLRP3 decreased the frequency of HSCs expressing high levels of CD150 in murine MPN (Fig. 5c), suggesting that NLRP3 imparts a myeloid skew, in keeping with published data on IL-1β²⁸.

Pyroptosis is an inflammatory form of cell death caused by caspase-1 cleavage of gasdermin D following inflammasome activation. We asked whether NLRP3 induces pyroptosis in HSPCs. To identify pyroptotic cells, we used the fluorescently labeled caspase-1/-4/-5 inhibitor 5-FAM-YVAD-FMK and scatter characteristics. Surprisingly, NLRP3 in JAKV617F mutant MPN indeed stimulated pyroptosis in HSPCs (Fig. 5d) even though it increased the HSPC population size. To resolve this discrepancy, we examined cell proliferation by Ki67 staining and found that NLRP3 enhanced proliferation across all HSPC subsets (Fig. 5e). We attempted to directly detect pyroptosis by staining for cleaved gasdermin D but encountered high levels of nonspecific staining with all tested antibody clones.

To address cell-type specific inflammasome activation, we performed intracellular pro-IL-1β staining in both mature and immature bone marrow cells from Jak2^VF and Vav-Cre mice. Among mature cell populations, we observed a considerable increase in pro-IL-1β production in B cells when JAK2V617F was present (Fig. S3a). This indicates that B cells may contribute to the NLRP3-driven inflammatory response in MPN. Interestingly, JAK2V617F-positive neutrophils did not display higher levels of pro-IL-1β compared to their Vav-Cre counterparts, arguing against the notion that neutrophils are key drivers of NLRP3-dependent disease progression in this model. Among immature cell populations, JAK2V617F elevated pro-IL-1β levels across all examined populations, with statistical significance reached in CMPs (common myeloid progenitors), MEPs (megakaryocyte-erythroid progenitors), and MkPs (megakaryocyte progenitors) (Fig. S3a). Staining with 5-FAM-YVAD-FMK confirmed higher caspase activity in JAK2V617F mutant CMPs, MEPs, and MkPs compared to Vav-Cre cells (Fig. S3b). These findings suggest that a broad range of myeloid and lymphoid cell populations, including B cells and several progenitor populations, contribute to the NLRP3-mediated inflammatory cascade in the context of JAK2V617F-induced MPN.

Overall, NLRP3 promoted expansion and myeloid skewing of the HSPC pool in murine JAK2V617F-driven MPN.

NLRP3 stimulates the direct thrombopoiesis pathway

NLRP3 deficiency potently suppressed platelet production in JAK2V617F-induced MPN. To better understand how NLRP3 regulates thrombopoiesis, we quantified megakaryocytes and MkPs in the bone marrow and spleen. Megakaryocytes were manually counted on tissue sections, as they tend to be underrepresented in flow cytometric assays because of their large cell size and fragility. Jak2^VF;Nlrp3^−/− BM mice contained substantially fewer megakaryocytes and MkPs than Jak2^VF BM mice in bone marrow and spleen, respectively (Fig. 6a–c). Deletion of Nlrp3 in Jak2^VF mice also reduced megakaryocyte size and dysplastic features of the nuclei (Fig. 6d). Importantly, thrombopoietin serum concentrations were similar in Jak2^VF BM and Jak2^VF;Nlrp3^−/− BM mice (Fig. 6e). Thus, NLRP3 deficiency did not lower platelet, megakaryocyte and MkP counts by reducing thrombopoietin levels.

Until recently, the thrombopoiesis differentiation pathway was thought to proceed from HSCs via CMPs to MkPs. However, several studies have now provided evidence that megakaryocytes can also be replenished by direct differentiation of HSCs into MkPs^29,30,31. Both the long and the short route are considered to be active simultaneously³⁰. CD48 expression on MkPs distinguishes MkPs directly connected to HSCs (CD48^lo MkPs) from those that differentiate from CMPs (CD48^hi MkPs) (Fig. 6f). The frequency of MkPs that were CD48^lo was decreased in Jak2^VF;Nlrp3^−/− BM compared with Jak2^VF BM mice (Fig. 6g), indicating that loss of NLRP3 impairs platelet production via the short route. Remarkably, deficiency for NLRP3 selectively reduced the frequency of actively cycling CD48^lo but not CD48^hi MkPs, as assessed by Ki67 staining (Fig. 6h). To elucidate the mechanism by which NLRP3 influences MkP development, we injected WT mice with IL-1β and monitored CD48^lo and CD48^hi MkP subsets. We found that IL-1β increased the frequency of CD48^lo MkPs while decreasing CD48^hi MkPs within the bone marrow MkP population (Fig. 6i). These findings suggest that NLRP3 promotes MkP production via the short route through IL-1β.

We also examined how NLRP3 deficiency alters gene expression in HSCs and MkPs by 3’-RNA sequencing of sorted cells from Jak2^VF and Jak2^VF;Nlrp3^−/− mice. The analysis revealed that deleting Nlrp3 enhances the expression of an oxidative phosphorylation (OXPHOS) signature (Fig. S4a-h). We validated this metabolic shift using a biochemical assay measuring OXPHOS and glycolysis. Inhibiting OXPHOS with oligomycin confirmed that mitochondrial ATP production was higher in Jak2^VF;Nlrp3^−/− than in Jak2^VF bone marrow cells (Fig. S4i), consistent with reports showing that NLRP3 promotes glycolysis via IL-1β³².

Collectively, these data demonstrate that NLRP3 stimulates the direct thrombopoiesis pathway in murine MPN, at least in part by inducing proliferation of associated CD48^lo MkPs.

NLRP3 inflammasome activation propagates bone marrow fibrosis and splenomegaly

Jak2^VF mice develop bone marrow fibrosis and, as a consequence of extramedullary hematopoiesis, splenomegaly. It remained unclear how NLRP3 would affect these major clinical manifestations of MPN. Because bone marrow transplantation delays the onset of fibrosis we assessed non-transplanted Jak2^VF, Jak2^VF;Nlrp3^−/− and WT mice. Scoring of silver-stained tissue sections revealed that fibrosis development in the bone marrow and spleens of Jak2^VF mice was greatly ameliorated in the absence of NLRP3 (Fig. 7a, b). Expression of the fibrosis-related gene COL1A1, which encodes for type I collagen, was also decreased by deleting Nlrp3 (Fig. 7c). Consistent with this, splenomegaly was reduced in Jak2^VF;Nlrp3^−/− mice compared to Jak2^VF mice (Fig. 7d, e). The attenuation of fibrosis caused by the lack of NLRP3 aligned with the lower number of megakaryocytes in Jak2^VF;Nlrp3^−/− mice, which are key drivers of bone marrow fibrosis³³.

Pharmacological blockade of NLRP3 alleviates thrombocytosis, bone marrow fibrosis and splenomegaly

In the Nlrp3 gene deletion studies, Jak2^VF hematopoietic cells were already NLRP3-deficient in utero. We asked whether blocking NLRP3 after disease is already established would also lessen myeloproliferation. For this purpose, we used the novel oral NLRP3 inhibitor IFM-2384. Jak2^VF BM mice received a chow formulation of IFM-2384 or control chow for 20 weeks starting 16 weeks after transplantation. On target efficacy was proven by reduced serum levels of IL-1β, TNFα and HMGB-1 in NLRP3 inhibitor-exposed Jak2^VF BM mice (Fig. 8a). When blood was drawn from the submandibular vein, we found that in the IFM-2384 group, platelets decreased continuously from 914 G/L before to 333 G/L after 16 weeks of therapy (Fig. 8b). In contrast, thrombocytosis remained stable in the control group. There was also a trend for lower leukocytes in mice fed with IFM-2384 compared to those with control chow but this effect did not reach statistical significance. After 20 weeks of treatment, the mice were sacrificed and blood was obtained from the abdominal vena cava, which showed that NLRP3 inhibition decreased platelets and leukocytes, including neutrophils (Fig. S5). In keeping with the platelet data, there were fewer bone marrow megakaryocytes in Jak2^VF BM mice fed IFM-2384 containing chow compared to those given control chow (Fig. 8d). Furthermore, IFM-2384 administration restricted HSPC expansion in murine MPN (Fig. 8c). Finally, NLRP3 blockade considerably mitigated splenomegaly and bone marrow fibrosis in Jak2^VF BM mice (Fig. 8e, f). The reduction in bone marrow fibrosis observed in Jak2^VF BM mice treated with IFM-2384 was likely due to the inhibitor’s action on mutant hematopoietic cells, rather than on the stromal compartment. This is supported by transplantation experiments indicating that NLRP3 in radioresistant non-hematopoietic cells does not influence BM fibrosis (Fig. S1c).

**Fig. 8: Pharmacological blockade of NLRP3 alleviates thrombocytosis and splenomegaly.**

These inhibitor studies further support the notion that NLRP3 is a viable therapeutic target in MPN.

Discussion

Our study provides detailed insights into the essential contributions of the NLRP3 inflammasome to MPN development. By targeting NLRP3 genetically or pharmacologically in a JAK2V617F mutant mouse model, we formally establish that NLRP3 potently promotes malignant thrombocytosis and, to a lesser extent, granulocytosis. Notably, deletion of Nlrp3 specifically impaired platelet production via the direct thrombopoiesis pathway. The loss of NLRP3 protected Jak2^VF mice from fibrosis in the bone marrow and spleen, highlighting the importance of inflammasome activation in fibrogenesis. Splenomegaly, another key manifestation of MPN, was also markedly diminished in the absence of NLRP3.

The model of thrombopoiesis has recently been considerably advanced based on the finding that MkPs can arise directly from HSCs without first proceeding through CMPs^29,30,31. In a mouse model of mutant Calr-driven ET, it was recently shown that megakaryocyte differentiation mainly occurred via a short route that directly links HSCs with MkPs³⁴. Furthermore, single-cell transcriptomic data in MPN patients revealed that a direct differentiation route from HSCs to MkPs is aberrantly expanded compared with healthy individuals³⁵. These studies provide evidence that the direct thrombopoiesis pathway may be the predominant contributor to increased platelet output in MPN. The drivers that increase platelet production via this trajectory in MPN have not been explored. Our study suggests, based on the differential expression of CD48 on MkPs, that the NLRP3 inflammasome is a major stimulator of the direct thrombopoiesis pathway in MPN.

NLRP3 might promote MPN development through several mechanism, including maturation of IL-1β and IL-18, initiation of pyroptosis by cleaving the pore-forming cell death executor gasdermin D and degradation of the hematopoietic lineage specifying transcription factor GATA1. Recently, the contribution of IL-1β and IL-1R1 were evaluated in MPN^9,10. In these studies, deficiency for IL-1β or IL-1R1 attenuated bone marrow fibrosis and splenomegaly. These defects in the IL-1 pathway also impaired granulocyte and platelet production. In our work, NLRP3 exerted similar outcomes in JAK2V617F positive MPN, indicating that the phenotype of Jak2^VF mice lacking NLRP3 is at least partly due to the reduction in mature IL-1β.

Inflammasome activation triggers pyroptosis via cleavage of gasdermin D by caspase 1. In MDS, the NLRP3 inflammasome has been implicated in the pathogenesis of cytopenia because it induced pyroptosis in HSPCs isolated from MDS patients¹⁵. We show that in MPN, NLRP3 also provokes pyroptosis in HSPCs but this did not cause cytopenia. On the contrary, NLRP3 rather promoted myeloproliferation. Therefore, other effects of NLRP3 appear to be more dominant over the impairment of hematopoiesis by pyroptosis in MPN. In the case of thrombopoiesis, it is noteworthy that IL-1β upregulates the megakaryocytic transcription factors NF-E2 and GATA1, as well as c-Fos and c-Jun, which are components of the dimeric activating protein-1 (AP-1) transcription-factor complex, thereby directly stimulating megakaryopoiesis³⁶.

The transcription factor GATA1, which enforces megakaryocytic and erythroid differentiation, has been identified as a target of caspase-1¹². Caspase-1 inhibition upregulates GATA1 protein in mouse HSPCs, thereby promoting erythrocytosis. Degradation of GATA1 downstream of NLRP3 inflammasome activation has been proposed as a mechanism leading to anemia in MDS³⁷. However, in our study of MPN in mice, NLRP3 had no effect on blood hemoglobin content and thus on erythrocytosis, although it was clearly activated. Overall, this highlights that the function of NLRP3 in MPN cannot readily be inferred from other diseases and its role has to be tested in vivo for each individual disease.

In addition to NLRP3, other inflammasomes may regulate malignant hematopoiesis in MPN. Expression of AIM2 is induced by JAK2V617F³⁸ and in a mouse model of Jak2 mutant clonal hematopoiesis, Aim2 deficiency reduced atherosclerosis in an IL-1β-dependent manner¹⁸. Furthermore, NLRP1a has been found to trigger pyroptosis in HSPCs during hematopoietic stress caused by chemotherapy or viral infection leading to prolonged cytopenia³⁹. We here focused on NLRP3 because its expression is increased in MPN patients¹⁷. We show that serum concentrations of IL-1β and IL-18 in Jak2^VF mice lacking NLRP3 are reduced to those in WT mice. This does not exclude the possibility that other inflammasomes are also involved in the development of MPN, but it does indicate that NLRP3 is an important inflammasome sensor in this disease.

Formation of the NLRP3 inflammasome complex is widely considered to involve a two-signal mechanism, with signal 1 required for transcriptional upregulation of NLRP3 and other inflammasome components (also known as ‘priming’). Subsequently, signal 2 can trigger NLRP3 inflammasome activation leading to caspase-1 activation. Signal 1 is typically induced by cytokine receptors or Toll-like receptor ligands, but the stimuli for signal 2 are more diverse and a unifying mechanism has yet to be defined¹⁴. Notably, numerous studies have now established that two signals are not always needed for assembly of the NLRP3 inflammasome, especially in vivo^40,41. Our work reveals that JAK2V617 causes inflammasome priming, likely in a cell-intrinsic fashion. This is consistent with the fact that JAK2V617 induces NFκB signaling⁴². Whether a dedicated signal 2 is essential for NLRP3 activation in MPN remains to be elucidated in future studies. It is worth pointing out that in other myeloid malignancies reactive oxygen species (ROS) have been linked to NLRP3 activation^15,16, but ROS inhibitors appear to rather block priming than activation⁴³.

Our work has also limitations. In our mouse models all hematopoietic cells were of the Jak2^VF genotype. Thus, it was not possible to assess whether NLRP3 activation promotes clonal outgrowth of JAK2V617 mutant cells. We also did not investigate the effect of the NLRP3 inflammasome on WT hematopoiesis. Because a Western-type calorically rich diet induces Nlrp3-dependent inflammation, we anticipate that such an analysis would need to take into account dietary conditions⁴⁴.

In conclusion, we have delineated unique immunopathological effects of the NLRP3 inflammasome in JAK2 mutant MPN. Although more work is needed to define its regulation, our data confirm NLRP3 as a therapeutic target in patients with MPN, particularly those in whom excessive platelet production is of primary concern, such as in ET and prefibrotic PMF.

Methods

Primary human samples

MPN blood samples were obtained from patients enrolled in the German Study Group Myeloproliferative Neoplasms (GSG-MPN) bioregistry, approved by the Institutional Review Boards of the participating centers (DRKS-ID: DRKS00006035). Healthy control blood samples were drawn at the University Hospital of Bonn and collection was approved by the Ethics Committee of the Medical Faculty of the University of Bonn (154/13). Human studies were conducted according to the guidelines of the Declaration of Helsinki, and all subjects provided written informed consent before blood sampling.

Isolation and processing of human PBMCs

Whole blood was collected into EDTA tubes, and PBMCs were isolated by density gradient centrifugation with lymphocyte separation medium (PromoCell). PBMCs were either immediately used or cryopreserved at -80 °C in RPMI1640 complemented with 20% FCS and 10% DMSO. Monocytes were isolated from PBMCs using the Pan Monocyte Isolation Kit (Miltenyi).

Mice

Vav-Cre;Jak2^V617F/+ C57BL/6 mice (Jak2^VF) were generated and kindly provided by Jean-Luc Villeval²³. Jak2^VF;Nlrp3^−/− mice were generated by interbreeding Jak2^VF with Nlrp3^−/− C57BL/6 mice (Millennium Pharmaceuticals). C57BL/6 J mice were purchased from Jackson Laboratories. Mice were maintained under special pathogen free (SPF) conditions, housed in individually ventilated cages (IVCs) in groups of no more than five animals. The housing rooms were standardized to a constant air temperature of approximately 22 °C, a humidity level of 50–60%, and up to 15 air changes per hour. The day-night cycle was centrally controlled and consisted of 12 h of light and 12 h of darkness. Experimental procedures were performed in accordance with the German Animal Welfare Act and approved by the State Agency for Nature, Environment and Consumer Protection, NRW (81-02.04.2017.A488, 81-02.04.2019.A427). Male and female mice were used in approximately equal numbers, except for the bone marrow transplantation recipients, which were all female.

Bone marrow transplantation

10–12-week-old recipients were irradiated with 2 × 4.5 Gy in a 4 h interval and injected intravenously with 2.5 × 10⁶ bone marrow cells harvested from 6–8-week-old donors. To generate Jak2^VF BM, Jak2^VF;Nlrp3^−/− BM and WT BM mice, WT recipients were transplanted with 100% Jak2^VF, Jak2^VF;Nlrp3^−/− or WT bone marrow (“neat” transplant). In all groups, care was taken to balance the ratio of female to male donors. Female mice were used as recipients.

Preparation of single-cell suspensions

To prepare bone marrow cells, femurs were extracted and soft tissue removed with a scalpel and by gentle rolling over paper towels. Femurs were cut open on one side and placed into a 0.5 ml tube with a small hole at the tip, which was inserted into another 1.5 ml tube. Bone marrow cells were flushed from the bone by centrifugation. For splenocytes, spleens were removed, minced and pressed through a metal strainer. All cells were treated with Red Blood Cell Lysis buffer (Biolegend) and suspensions were filtered through 70 μm Nitex nylon mesh before further use.

Sampling of mouse blood and treatment of mice

Blood was collected from the submandibular vein in live animals or from the abdominal vena cava after sacrifice. Blood counts were measured on an auto hematology analyzer (Mindray BC-5000 Vet) using EDTA-anticoagulated blood. In the pharmacological studies, mice were either fed a chow-based formulation of the NLRP3 inhibitor IFM-2384 (0.18 mg/g, IFM Therapeutics) or a control diet for 20 weeks.

In vitro NLRP inflammasome activation

Cells were primed with LPS for 3 h or overnight at 37 °C with 100–200 ng/ml LPS in RPMI1640 containing penicillin, streptomycin and 10% FCS. To activate NLRP3, nigericin (10 µM, Sigma Aldrich) was added to the cultures for 1 h. For detection of ASC specks, caspase-1 was inhibited with belnacasan (50 µM, Selleckchem) prior to stimulation with nigericin.

Multiplex bead-based assays and ELISA

Human cytokines were measured with a custom ProcartaPlex Immunoassay (Thermo Fisher Scientific) and murine cytokines by LEGENDplex assay (Biolegend). The ProcartaPlex assay was read on a Luminex FlexMAP 3D System and LEGENDplex assays on a FACS Canto II (BD). Human and murine HMGB-1 were quantified by ELISA (IBL).

Quantitative RT–PCR

RNA was extracted from cells with the Maxwell RSC simplyRNA Cells Kit (Promega) on a Maxwell RSC instrument and mRNA reverse transcribed with the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific). GAPDH was used as housekeeping gene. qPCR was performed using the SensiFast Sybr No-Rox Mix (Bioline) on a RealPlex 2 Thermocycler (Eppendorf).

Primer sequences (5’-3’)

GAPDH forward GAGTCAACGGATTTGGTCGT

GAPDH reverse TTGATTTTGGAGGGATCTCG

IL1B forward TGGGCAGACTCAAATTCCAGCT

IL1B reverse CTGTACCTGTCCTGCGTGTTGA

CASP1 forward ACAACCCAGCTATGCCCACA

CASP1 reverse GTGCGGCTTGACTTGTCCAT

Histology

Tissues were formalin-fixed, embedded in paraffin and sectioned (4–6 µm). Megakaryocytes were quantified in a blinded fashion on hematoxylin and eosin-stained sections. Fibrosis was scored in a blinded fashion on Gomori stained sections (0 = very little scattered linear reticulin with no intersections corresponding to normal BM, 1 = loose network of reticulin with few intersections, 2 = diffuse and dense increase in reticulin with extensive intersections, focal thick collagen fibers, 3 = coarse bundles of collagen fibers).

Flow cytometry

Surface staining was performed on ice in PBS containing 0.5% BSA and 0.05% sodium azide. Intracellular staining was carried out using the FoxP3/Transcription Factor Staining Buffer Set (Thermo Fisher Scientific) or the Cytofix/Cytoperm Fixation/Permeabilisation Kit (BD). For exclusion of dead cells ethidium monoazide bromide (EMA) or ZOMBIE dyes (Biolegend) were used. Activated caspase-1/4/5 was detected with 5-FAM-YVAD-FMK kits (AAT Bioquest or ImmunoChemistry Technologies). Data were acquired on a Canto II (BD) or Northern Lights (Cytek) flow cytometer and analyzed with FlowJo 10.8.1 (BD).

Antibody clones for flow cytometry

PE-conjugated anti-ASC (clone HASC-71, Cat.# 653904, mouse antibody, 1:100 dilution, Biolegend), PerCP/Cyanine5.5-conjugated anti-CD3 (clone 17A2, Cat.# 100218, rat antibody, 1:200 dilution, Biolegend), Pacific Blue-conjugated anti-CD11b (clone M1/70, Cat.# 101224, rat antibody, 1:200 dilution, Biolegend), Pacific Blue-conjugated anti-CD11c (clone N418, Cat.# 117322, Armenian hamster antibody, 1:200 dilution, Biolegend), PerCP/Cyanin 5.5-conjugated anti-CD19 (clone 6D5, Cat.# 115532, rat antibody, 1:200 dilution, Biolegend), FITC-conjugated anti-CD34 (clone RAM34, Cat.# 11-0341-82, rat antibody, 1:100 dilution, Invitrogen), Pacific Blue-conjugated anti-CD41 (clone MWReg30, Cat.# 133932, rat antibody, 1:200 dilution, Biolegend), PE-conjugated anti-CD42b (clone Xia.G5, Cat.# M040-2, rat-antibody, dilution 1:40, Emfret), Brilliant Violet 510-conjugated anti-CD48 (clone HM48-1, Cat.# 103443, Armenian hamster antibody, 1:200 dilution, Biolegend), APC-conjugated anti-CD117 (clone ACK2, Cat.# 135108, rat antibody, 1:100 dilution, Biolegend), PE-conjugated anti-CD150 (clone TC15-12F12.2, Cat.# 115904, rat antibody, 1:200 dilution, Biolegend), APC-conjugated anti-CD201 (EPCR) (clone RCR-16, Cat.# 351906, rat antibody, 1:200 dilution, Biolegend), Alexa Fluor 488-conjugated anti-GbVI (clone FAB6758G, Cat.# FAB6758G, rat antibody, 1:100 dilution, R&D), Pacific Blue-conjugated anti-F4/80 (clone BM8, Cat.# 123124, rat antibody, 1:400 dilution, Biolegend), PerCP-conjugated anti-Gr-1 (clone RB6-8C5, Cat.# 108426, rat antibody, 1:200 dilution, Biolegend), FITC-conjugated anti-ICAM (clone YN1/1.7.4., Cat.# 116105, rat antibody, 1:100 dilution, Biolegend), FITC-conjugated anti-Ki-67 (clone 16A8, Cat.# 652410, rat antibody, 1:400 dilution, Biolegend), APC-conjugated anti-Ly6C (clone HK1.4, Cat.# 128016, rat antibody, 1:800 dilution, Biolegend), PerCP-conjugated anti-Ly6G (clone 1A8, Cat.# 127654, rat antibody, 1:200 dilution, Biolegend), APC-conjugated anti-NLRP3 (clone REA668, Cat.# 130-111-210, human antibody 1:100 dilution, Milteny), FITC-conjugated anti-pro-IL-1β (clone NJTEN3, Cat.# 11-7114-82, rat antibody, 1:100 dilution, Invitrogen), FITC-conjugated rat IgG1κ isotype control antibody (clone RTK2071, Cat.# 400406, rat antibody, 1:100 dilution, Biolegend; used as control antibody in the pro-IL-1β staining), PE-Cy7-conjugated anti-Sca-1 (clone D7, Cat.# 25-5981-82, rat antibody, 1:300 dilution, Invitrogen), PerCP-conjugated, anti-Ter-119 (clone Ter119, Cat.# 116226, rat antibody, 1:200 dilution, Biolegend), Unconjugated anti-CD16/32 (Trustain, clone 93, Cat.# 101320, rat antibody, 1:400 dilution, Biolegend), PE-conjugated anti-VCAM (clone M/K-2, Cat.# RMCD10604, rat antibody, 1:40 dilution, Invitrogen).

Generation of bone-marrow derived macrophages (BMDMs)

7 × 10⁶ bone marrow cells were cultured in tissue-culture-treated petri dishes in 8 ml of IMDM supplemented with glutamine, penicillin, streptomycin, 2-mercaptoethanol (all from Thermo Fisher Scientific), 10% FCS (Merck) and M-CSF (20 ng/ml, Biolegend). On day 4, 4 ml of fresh, prewarmed complete medium was added. On day 7, supernatants with non-adherent cells were discarded and adherent cells were carefully detached with a cell scraper and washed with PBS.

Glycolysis/oxidative phosphorylation assay

Cell metabolism of bone marrow cells was assessed using the Glycolysis/OXPHOS assay Kit (Dojindo Laboratories) according the manufacturer’s protocol.

3’-mRNA sequencing and gene expression analysis

For 3’-mRNA sequencing, RNA was extracted from sorted cells using the PicoPure RNA Isolation Kit (Thermo Fisher Scientific). Libraries were prepared with the Lexogen QuantSeq 3’-mRNA-Seq Library Prep Kit (FWD) and sequenced on an Illumina NovaSeq 6000 using single-end 100 bp reads. Raw data were pre-processed using Lexogen’s web-based Kangooroo platform. Differential gene expression was analyzed in R (4.4.2) with DESeq2 (1.46.0), and gene set enrichment analysis (GSEA) was performed using clusterProfiler (4.14.6). Data visualization was carried out with ggplot2 (3.5.1) and enrichplot (1.26.6).

32D cell culture

32D cells (DSMZ, ACC 411) transduced with the pMSCV-MPL-HA-IRES-puromycin vector followed by a second transduction with the empty pMSCV-IRES-GFP vector or pMSCV-IRES-GFP containing the JAK2V617F, CALRdel52 or CALRins5 oncogene were described previously⁴⁵. 32D cells were cultured in RPMI 1640 medium with GlutaMAX (Gibco) supplemented with 10% FCS (Merck) and 1% penicillin/streptomycin (Gibco). For 32D MPL-HA cells without oncogene (empty second vector) the medium was additionally supplemented with 5 ng/ml murine IL-3 (Thermo Fisher Scientific). All cells were maintained at 37 °C in a humidified incubator with 5% CO₂.

Caspase 1 bioluminescent assay

Caspase 1 activation in 32D cells was measured with the Caspase-Glo 1 Inflammasome Assay (Promega) according to the manufacturer’s protocol. Luminescence was measured on a GloMax Multi+ Detection System (Promega).

Western blot

Whole cells lysates from BMDMs were prepared in RIPA buffer (Sigma-Aldrich) containing phosphatase inhibitor cocktails 2&3 (Sigma-Aldrich). Supernatant proteins were precipitated with chloroform/methanol. Protein concentrations were determined by bicinchoninic acid assay (Pierce). 40 μg of whole-cell lysates or precipitates of 500 µl supernatant were separated on a polyacrylamide gel and transferred on poly-vinyl dinitrofluoride (PVDF) membranes. PVDF membranes were then immunoprobed with antibodies against murine IL-1ß (DY401, R&D) and ß-Actin (#4967, Cell Signaling) followed by HRP-labeled secondary antibodies. Proteins were detected with an ECL system (GE Healthcare) on a ChemiDoc XRS+ (Bio-Rad).

Quantification and statistical analysis

Statistical analysis was performed with GraphPad 9 (Prism). The statistical tests used are indicated in the figure legends. Independent experiments were pooled and analyzed together whenever possible. Clustering analysis and visualization were performed using the ComplexHeatmap package (2.14.0) in R (4.4.2).

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

The raw data for charts and graphs, and unedited blot images are available in the Source Data. 3’-mRNA sequencing data have been deposited in the Zenodo repository and can be accessed via https://doi.org/10.5281/zenodo.16893730⁴⁶. Source data are provided with this paper.

References

Nangalia, J., Grinfeld, J. & Green, A. R. Pathogenesis of myeloproliferative disorders. Annu. Rev. Pathol. Mech. Dis. 11, 101–126 (2016).
Article CAS Google Scholar
Cordua, S. et al. Prevalence and phenotypes of JAK2 V617F and calreticulin mutations in a Danish general population. Blood 134, 469–479 (2019).
Article CAS PubMed Google Scholar
Vainchenker, W. & Kralovics, R. Genetic basis and molecular pathophysiology of classical myeloproliferative neoplasms. Blood 129, 667–679 (2017).
Article CAS PubMed Google Scholar
Bousoik, E. & Montazeri Aliabadi, H. “Do we know Jack” about JAK? A closer look at JAK/STAT signaling pathway. Front. Oncol. 8, 287 (2018).
Article PubMed PubMed Central Google Scholar
Fleischman, A. G. et al. TNFα facilitates clonal expansion of JAK2V617F positive cells in myeloproliferative neoplasms. Blood 118, 6392–6398 (2011).
Article CAS PubMed PubMed Central Google Scholar
Tefferi, A. et al. Circulating interleukin (IL)-8, IL-2R, IL-12, and IL-15 levels are independently prognostic in primary myelofibrosis: a comprehensive cytokine profiling study. JCO 29, 1356–1363 (2011).
Article CAS Google Scholar
Barbui, T. et al. Inflammation and thrombosis in essential thrombocythemia and polycythemia vera: different role of C-reactive protein and pentraxin 3. Haematologica 96, 315–318 (2011).
Article CAS PubMed Google Scholar
Mitchell, C. A. et al. Stromal niche inflammation mediated by IL-1 signalling is a targetable driver of haematopoietic ageing. Nat. Cell Biol. 25, 30–41 (2023).
Article CAS PubMed PubMed Central Google Scholar
Rahman, M. F.-U. et al. Interleukin-1 contributes to clonal expansion and progression of bone marrow fibrosis in JAK2V617F-induced myeloproliferative neoplasm. Nat. Commun. 13, 5347 (2022).
Article ADS CAS PubMed PubMed Central Google Scholar
Rai, S. et al. Inhibition of interleukin-1β reduces myelofibrosis and osteosclerosis in mice with JAK2-V617F driven myeloproliferative neoplasm. Nat. Commun. 13, 5346 (2022).
Article ADS CAS PubMed PubMed Central Google Scholar
Shi, J. et al. Cleavage of GSDMD by inflammatory caspases determines pyroptotic cell death. Nature 526, 660–665 (2015).
Article ADS CAS PubMed Google Scholar
Tyrkalska, S. D. et al. Inflammasome regulates hematopoiesis through cleavage of the master erythroid transcription factor GATA1. Immunity 51, 50–63.e5 (2019).
Article CAS PubMed PubMed Central Google Scholar
Xue, Y., Enosi Tuipulotu, D., Tan, W. H., Kay, C. & Man, S. M. Emerging activators and regulators of inflammasomes and pyroptosis. Trends Immunol. 40, 1035–1052 (2019).
Article CAS PubMed Google Scholar
Akbal, A. et al. How location and cellular signaling combine to activate the NLRP3 inflammasome. Cell Mol. Immunol. 19, 1201–1214 (2022).
Article CAS PubMed PubMed Central Google Scholar
Basiorka, A. A. et al. The NLRP3 inflammasome functions as a driver of the myelodysplastic syndrome phenotype. Blood 128, 2960–2975 (2016).
Article CAS PubMed PubMed Central Google Scholar
Hamarsheh, S. et al. Oncogenic KrasG12D causes myeloproliferation via NLRP3 inflammasome activation. Nat. Commun. 11, 1659 (2020).
Article ADS CAS PubMed PubMed Central Google Scholar
Zhou, Y. et al. Genetic polymorphisms and expression of NLRP3 inflammasome-related genes are associated with Philadelphia chromosome-negative myeloproliferative neoplasms. Hum. Immunol. 81, 606–613 (2020).
Article CAS PubMed Google Scholar
Fidler, T. P. et al. The AIM2 inflammasome exacerbates atherosclerosis in clonal haematopoiesis. Nature 592, 296–301 (2021).
Article ADS CAS PubMed PubMed Central Google Scholar
De Luca, G. et al. High cell-free DNA is associated with disease progression, inflammasome activation and elevated levels of inflammasome-related cytokine IL-18 in patients with myelofibrosis. Front. Immunol. 14, 1161832 (2023).
Article PubMed PubMed Central Google Scholar
Rodriguez-Meira, A. et al. Unravelling intratumoral heterogeneity through high-sensitivity single-cell mutational analysis and parallel RNA sequencing. Mol. Cell 73, 1292–1305.e8 (2019).
Article CAS PubMed PubMed Central Google Scholar
Verstovsek, S. et al. Safety and efficacy of INCB018424, a JAK1 and JAK2 inhibitor, in myelofibrosis. N. Engl. J. Med. 363, 1117–1127 (2010).
Article CAS PubMed PubMed Central Google Scholar
Hoss, F., Rolfes, V., Davanso, M. R., Braga, T. T. & Franklin, B. S. Detection of ASC speck formation by flow cytometry and chemical cross-linking. in Innate Immune Activation (eds De Nardo, D. & De Nardo, C. M.) 1714 149–165 (Springer New York, 2018).
Hasan, S. et al. JAK2V617F expression in mice amplifies early hematopoietic cells and gives them a competitive advantage that is hampered by IFNα. Blood 122, 1464–1477 (2013).
Article CAS PubMed Google Scholar
Hoggatt, J., Hoggatt, A. F., Tate, T. A., Fortman, J. & Pelus, L. M. Bleeding the laboratory mouse: Not all methods are equal. Exp. Hematol. 44, 132–137.e1 (2016).
Article PubMed Google Scholar
Jensen, M. K., De Nully Brown, P., Lund, B. V., Nielsen, O. J. & Hasselbalch, H. C. Increased circulating platelet-leukocyte aggregates in myeloproliferative disorders is correlated to previous thrombosis, platelet activation and platelet count: Platelet-leukocyte aggregates in myeloproliferative disorders. Eur. J. Haematol. 66, 143–151 (2001).
Article CAS PubMed Google Scholar
Adamiak, M. et al. Nlrp3 inflammasome signaling regulates the homing and engraftment of hematopoietic stem cells (HSPCs) by enhancing incorporation of CXCR4 receptor into membrane lipid rafts. Stem Cell Rev. Rep. 16, 954–967 (2020).
Article CAS PubMed PubMed Central Google Scholar
Morita, Y., Ema, H. & Nakauchi, H. Heterogeneity and hierarchy within the most primitive hematopoietic stem cell compartment. J. Exp. Med. 207, 1173–1182 (2010).
Article CAS PubMed PubMed Central Google Scholar
Pietras, E. M. et al. Chronic interleukin-1 exposure drives haematopoietic stem cells towards precocious myeloid differentiation at the expense of self-renewal. Nat. Cell Biol. 18, 23 (2016).
Article Google Scholar
Carrelha, J. et al. Hierarchically related lineage-restricted fates of multipotent haematopoietic stem cells. Nature 554, 106–111 (2018).
Article ADS CAS PubMed Google Scholar
Morcos, M. N. F. et al. Fate mapping of hematopoietic stem cells reveals two pathways of native thrombopoiesis. Nat. Commun. 13, 4504 (2022).
Article ADS CAS PubMed PubMed Central Google Scholar
Rodriguez-Fraticelli, A. E. et al. Clonal analysis of lineage fate in native haematopoiesis. Nature 553, 212–216 (2018).
Article ADS CAS PubMed PubMed Central Google Scholar
Finucane, O. M., Sugrue, J., Rubio-Araiz, A., Guillot-Sestier, M.-V. & Lynch, M. A. The NLRP3 inflammasome modulates glycolysis by increasing PFKFB3 in an IL-1β-dependent manner in macrophages. Sci. Rep. 9, 4034 (2019).
Article ADS PubMed PubMed Central Google Scholar
Yan, X. et al. A model of myelofibrosis and osteosclerosis in mice induced by overexpressing thrombopoietin (mpl ligand): reversal of disease by bone marrow transplantation. Blood 88, 402–409 (1996).
Article CAS PubMed Google Scholar
Prins, D. et al. The stem/progenitor landscape is reshaped in a mouse model of essential thrombocythemia and causes excess megakaryocyte production. Sci. Adv. 6, eabd3139 (2020).
Article ADS CAS PubMed PubMed Central Google Scholar
Psaila, B. et al. Single-cell analyses reveal megakaryocyte-biased hematopoiesis in myelofibrosis and identify mutant clone-specific targets. Mol. Cell 78, 477–492.e8 (2020).
Article CAS PubMed PubMed Central Google Scholar
Chuen, C. K. Y. et al. Interleukin-1β up-regulates the expression of thrombopoietin and transcription factors c-Jun, c-fos, GATA-1, and nf-E2 in megakaryocytic cells. J. Lab. Clin. Med. 143, 75–88 (2004).
Article CAS PubMed Google Scholar
McLemore, A. F. et al. Somatic gene mutations expose cytoplasmic DNA to co-opt the cGAS/STING/NLRP3 axis in myelodysplastic syndromes. JCI Insight 7, e159430 (2022).
Article PubMed PubMed Central Google Scholar
Liew, E. L. et al. Identification of AIM2 as a downstream target of JAK2V617F. Exp. Hematol. Oncol. 5, 2 (2015).
Article PubMed Google Scholar
Masters, S. L. et al. NLRP1 inflammasome activation induces pyroptosis of hematopoietic progenitor cells. Immunity 37, 1009–1023 (2012).
Article CAS PubMed PubMed Central Google Scholar
He, Y., Franchi, L. & Núñez, G. TLR agonists stimulate Nlrp3-dependent IL-1β production independently of the purinergic P2X7 receptor in dendritic cells and in vivo. J. Immunol. 190, 334–339 (2013).
Article CAS PubMed Google Scholar
O’Brien, M. et al. A bioluminescent caspase-1 activity assay rapidly monitors inflammasome activation in cells. J. Immunol. Methods 447, 1–13 (2017).
Article ADS PubMed Google Scholar
Kleppe, M. et al. Dual targeting of oncogenic activation and inflammatory signaling increases therapeutic efficacy in myeloproliferative neoplasms. Cancer Cell 33, 29–43.e7 (2018).
Article CAS PubMed Google Scholar
Bauernfeind, F. et al. Cutting edge: reactive oxygen species inhibitors block priming, but not activation, of the NLRP3 inflammasome. J. Immunol. 187, 613–617 (2011).
Article CAS PubMed Google Scholar
Christ, A. et al. Western diet triggers NLRP3-dependent innate immune reprogramming. Cell 172, 162–175.e14 (2018).
Article CAS PubMed PubMed Central Google Scholar
Czech, J. et al. JAK2V617F but not CALR mutations confer increased molecular responses to interferon-α via JAK1/STAT1 activation. Leukemia 33, 995–1010 (2019).
Article CAS PubMed Google Scholar
Körber, R.-M., Saenz, L. M., Wolf, D. & Teichmann, L. Supplementary 3’-mRNA sequencing dataset: Hematopoietic stem cells (HSC) and megakarocyte progenitors (MkP) from bone marrow of Jak2VF and Jak2VF;Nlrp3−/− mice. Zenodo https://doi.org/10.5281/ZENODO.16893730 (2025).

Download references

Acknowledgements

We thank HET (Haus für Experimentelle Therapie) for outstanding animal husbandry, Radek Skoda and Alexander Gerbaulet for helpful discussion and critical reading of the manuscript, and the GSG-MPN centers for patient samples. This study was funded by the Deutsche Krebshilfe (DKH, German Cancer Aid) Mildred Scheel Early Career Center grant 70113307 (R.M.K.) and the Deutsche Forschungsgemeinschaft (DFG, German Research Foundation) grant TRR237-369799452 (L.L.T.). It was further supported by the DFG grant EXC2151–390873048 (L.L.T.) under Germany’s Excellence Strategy, the Jose-Carreras-Leukämie Stiftung grant 16 R/2018 (D.W.), and in part by DFG grants 417911533 (THB) and 327211770 (SK) within the clinical research unit CRU344.

Funding

Open Access funding enabled and organized by Projekt DEAL.

Author information

These authors contributed equally: Dominik Wolf, Lino L. Teichmann.

Authors and Affiliations

Department of Medicine III, University Hospital Bonn, Bonn, Germany
Ruth-Miriam Koerber, Calvin Krollmann, Kevin Cieslak, Elisabeth Tregel, Maria L. Saenz, Peter Brossart & Lino L. Teichmann
Mildred Scheel School of Oncology, University Hospital Bonn, Medical Faculty, Bonn, Germany
Ruth-Miriam Koerber
Center for Integrated Oncology Aachen Bonn Cologne Düsseldorf (CIO ABCD), Bonn, Germany
Ruth-Miriam Koerber, Calvin Krollmann, Kevin Cieslak, Elisabeth Tregel, Maria L. Saenz, Ines Gütgemann, Peter Brossart & Lino L. Teichmann
Department of Hematology, Oncology, Hemostaseology, and Stem Cell Transplantation, Faculty of Medicine, RWTH Aachen University, Aachen, Germany
Tim H. Brümmendorf & Steffen Koschmieder
Center for Integrated Oncology Aachen Bonn Cologne Düsseldorf (CIO ABCD), Aachen, Germany
Tim H. Brümmendorf & Steffen Koschmieder
University Clinic for Hematology, Oncology, Haemostaseology and Palliative Care, Johannes Wesling Medical Center Minden, University of Bochum, Bochum, Germany
Martin Griesshammer
Institute of Pathology, University Hospital Bonn, Bonn, Germany
Ines Gütgemann
Institute of Molecular and Clinical Immunology, Otto-von-Guericke University of Magdeburg, Magdeburg, Germany
Conny K. Baldauf & Thomas Fischer
Institute of Innate Immunity, University Hospitals Bonn, Bonn, Germany
Carl Christian Kolbe & Eicke Latz
Deutsches Rheuma Forschungszentrum Berlin (DRFZ), Berlin, Germany
Eicke Latz
Internal Medicine V, Department of Hematology and Oncology, Comprehensive Cancer Center Innsbruck (CCCI), Tyrolean Cancer Research Institute (TKFI), Austrian Comprehensive Cancer Network (ACCN), Medical University of Innsbruck, Innsbruck, Austria
Dominik Wolf

Authors

Ruth-Miriam Koerber
View author publications
Search author on:PubMed Google Scholar
Calvin Krollmann
View author publications
Search author on:PubMed Google Scholar
Kevin Cieslak
View author publications
Search author on:PubMed Google Scholar
Elisabeth Tregel
View author publications
Search author on:PubMed Google Scholar
Maria L. Saenz
View author publications
Search author on:PubMed Google Scholar
Tim H. Brümmendorf
View author publications
Search author on:PubMed Google Scholar
Steffen Koschmieder
View author publications
Search author on:PubMed Google Scholar
Martin Griesshammer
View author publications
Search author on:PubMed Google Scholar
Ines Gütgemann
View author publications
Search author on:PubMed Google Scholar
Conny K. Baldauf
View author publications
Search author on:PubMed Google Scholar
Thomas Fischer
View author publications
Search author on:PubMed Google Scholar
Peter Brossart
View author publications
Search author on:PubMed Google Scholar
Carl Christian Kolbe
View author publications
Search author on:PubMed Google Scholar
Eicke Latz
View author publications
Search author on:PubMed Google Scholar
Dominik Wolf
View author publications
Search author on:PubMed Google Scholar
Lino L. Teichmann
View author publications
Search author on:PubMed Google Scholar

Contributions

R.M.K. and L.L.T. designed experiments, analyzed the data and wrote the manuscript. R.M.K., C.K., K.C., M.L.S., E.T. and C.K.B. performed experiments. C.C.K. performed the Luminex assay. T.H.B., S.K. and M.G. provided patient samples. I.G. helped with histology. P.B., E.L. and T.F. provided resources. D.W. and L.L.T. conceived and supervised the study. All authors had the opportunity to discuss the results and comment on the manuscript.

Corresponding authors

Correspondence to Dominik Wolf or Lino L. Teichmann.

Ethics declarations

Competing interests

R.M.K. received honoraria from Stemline. C.K. is an employee of AbbVie Deutschland GmbH & Co. KG. T.H.B. served as a consultant or invited speaker for Astra-Zeneca, Gilead, Janssen, Merck, Novartis and Pfizer and received research funding from Novartis and Pfizer. SK reports research grant/funding from Geron, Janssen, AOP Pharma, and Novartis; consulting fees from Pfizer, Incyte, Ariad, Novartis, AOP Pharma, Bristol Myers Squibb, Celgene, Geron, Janssen, CTI BioPharma, Roche, Bayer, GSK, Sierra Oncology, and PharmaEssentia; payment or honoraria from Novartis, BMS/Celgene, Pfizer; travel/accommodation support from Alexion, Novartis, Bristol Myers Squibb, Incyte, AOP Pharma, CTI BioPharma, Pfizer, Celgene, Janssen, Geron, Roche, AbbVie, GSK, Sierra Oncology, and Karthos; a patent issued for a BET inhibitor at RWTH Aachen University; advisory board activity for from Pfizer, Incyte, Ariad, Novartis, AOP Pharma, BMS, Celgene, Geron, Janssen, CTI BioPharma, Roche, Bayer, GSK, Sierra Oncology, and PharmaEssentia. MG reports speaker bureau and consultancy for AOP Orphan, Celgene, CTI, Novartis, and Shire. I.G. received funding from aTyr. E.L. is co-founder and consultant to IFM Therapeutics, Odyssey Therapeutics and a Stealth Biotech company. D.W. served as a consultant or invited speaker for Novartis, Roche, BMS, Gilead, Janssen, MSD, AOP Orphan and Pfizer and received research funding from Novartis, BMS, AOP Orphan and Pfizer. L.L.T. reports honoraria from AOP Orphan, Boehringer Ingelheim, BMS and Novartis; consultancy for Astellas, Blueprint, BMS, GSK, Jazz Pharmaceuticals, Pfizer, and Sobi. The remaining authors declare no competing financial interests.

Peer review

Peer review information

Nature Communications thanks the anonymous reviewers for their contribution to the peer review of this work. A peer review file is available.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Supplementary Information

Reporting Summary

Transparent Peer Review file

Source data

Source Data

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Koerber, RM., Krollmann, C., Cieslak, K. et al. NLRP3-induced systemic inflammation controls the development of JAK2V617F mutant myeloproliferative neoplasms. Nat Commun 16, 10591 (2025). https://doi.org/10.1038/s41467-025-65673-4

Download citation

Received: 14 March 2024
Accepted: 20 October 2025
Published: 26 November 2025
Version of record: 26 November 2025
DOI: https://doi.org/10.1038/s41467-025-65673-4