Introduction

Barrett’s esophagus (BE) is characterized by intestinal-type mucinous metaplasia of squamous (SQ) epithelial cells in the distal esophagus1. Patients with BE in particular are at a high risk of developing esophageal adenocarcinoma (EAC), an increasingly prevalent and refractory malignancy, often diagnosed at advanced stages where treatments become ineffective2,3. While risk factors for BE/EAC such as age, male gender, Caucasian ethnicity, obesity, gastroesophageal reflux disease (GERD), and diet have been previously suggested, they lack sufficient predictive power to guide effective clinical management of this disease4,5,6. Moreover, the co-opting genetic / molecular aberrations contributing to the onset and progression of BE remain elusive and complex7.

Prior studies from our group identified that up to 10% of patients with BE/EAC report a family history, indicating a genetic predisposition to the disease8,9,10,11,12. Our segregation analysis in familial clusters of the disease strongly suggested that familial BE (FBE) is consistent with dominant transmission of one or more incompletely penetrant major Mendelian alleles13. Moreover, we have identified genetic linkage of familial BE to distinct chromosomes and genomic loci8, suggesting that FBE is genetically complex. Using familial association and high-throughput genomic approaches in a large multi-generational index family, we subsequently discovered the first inherited autosomal dominant BE susceptibility variant (S631G) mapped to a highly-conserved Serine residue within the Ig-like domain in the V-set And Immunoglobulin Domain Containing 10 Like (VSIG10L) gene14.

Here we sought to determine the extent of VSIG10L susceptibility variants in a large cohort of BE/EAC familial kindreds. Furthermore, we characterized the expression of VSIG10L in esophageal mucosa, developed human-orthologous Vsig10l-mutant mice, and performed molecular and phenotypic studies to interrogate the pathogenicity of VSIG10L variants. Overall, our study identifies VSIG10L as a key molecule involved in maintaining esophageal homeostasis; defects in which enhance susceptibility to BE.

Results

Identification of familial BE/EAC-associated susceptibility variants in VSIG10L

In follow-up to our previous report14, here we determined the extent of VSIG10L susceptibility variants associated with the disease by targeted sequencing of VSIG10L coding regions in 684 blood DNA samples, banked from BE/EAC affected and unaffected relatives from 302 families, accrued through an active multi-center familial BE registry8,14,15. We found additional germline VSIG10L susceptibility variants including: a rare deleterious frameshift deletion (dbSNP: rs1185522503, Minor Allele Frequency16: 0.0001) in a 50 year old female diagnosed with BE; a private missense variant (GRCh37/hg19/chr19:51842243: A > A/G, p.V543A) in a male diagnosed with BE at age 61; and a rare in-frame deletion (dbSNP: rs370588522, Minor allele frequency16: 0.0027) in a male diagnosed with EAC at age 82. Together, our studies in familial clusters of the disease indicated a pathogenetic link between VSIG10L and BE/EAC predisposition.

VSIG10L expression is localized to suprabasal squamous cells of the esophagus

VSIG10L is predominantly expressed in SQ cells, and its gene product encodes a membrane-bound protein with immunoglobulin (Ig)-like domains14. Nonetheless, its function in the esophagus or in other SQ tissues is hitherto unknown. We accordingly first sought to determine its expression within the stratified esophageal SQ mucosa. Given the lack of optimized VSIG10L antibodies, we developed custom RNAscope-in situ hybridization probes and subsequently assessed its expression in representative human and porcine esophagus, as well as in human SQ epithelial cells (EPC2) grown as 3D-organotypes17,18. As shown in Fig. 1, we found VSIG10L RNA to be selectively and consistently expressed in suprabasal SQ cells, with no detectable expression in basal squamous cells, suggesting a possible role of VSIG10L in epithelial maturation.

Fig. 1: Localization of VSIG10L in esophageal squamous mucosa.
Fig. 1: Localization of VSIG10L in esophageal squamous mucosa.
Full size image

(Top row) H&E staining of representative human and porcine esophagus FFPE tissue sections, as well as normal esophageal squamous cell line EPC2 grown in 3-dimensional organotypic culture (3D-OTC), showing stratified esophageal squamous mucosa. Images are oriented with luminal side towards the top and basal squamous layer at the bottom. (Bottom row) Custom RNAscope-in situ hybridization (ISH) analyses of respective tissue sections revealing VSIG10L RNA selectively expressed and localized in suprabasal squamous epithelial cell layers (magenta dots), and absent in basal squamous cells. Magnified insets of regions (rectangular boxes) are shown within each of the respective panels, as necessary. All VSIG10L ISH analyses were optimized a priori, and were tested on four human and porcine biologic replicate tissue sections to ascertain reproducibility. Scale bar, 200 µM.

Esophageal organoids from VSIG10L-mutant patient show disrupted squamous maturation

We previously reported that EPC2 3D-organotypes engineered to express the VSIG10L-S631G FBE variant exhibit dysmaturation and loss of epithelial integrity, while ultrastructural assessments of esophageal mucosa from the VSIG10L S631G-mutant patient revealed loss of desmosomes and dilated intercellular spaces particularly within the suprabasal SQ cells14. To further explore the impact of VSIG10L on the developmental dynamics of esophageal SQ cells, we generated and assessed esophageal progenitor SQ organoids derived from pluripotent stem cells (hPSC) from the VSIG10L-S631G patient. Morphologically, organoids from the VSIG10L-S631G patient showed frequent disruption of SQ epithelial stratification and maturation, in stark contrast to the normal(anticipated) growth and differentiation of SQ organoids observed in the control subject grown under the same experimental conditions. Immunohistochemistry (IHC) assessments revealed that the single layer of cells in the abnormal glandular-appearing organoids in the mutant patient to be positive for p63 (basal SQ cell marker), albeit to varying degree, suggesting these may be predominantly basal-like SQ cells (Fig. 2). Additionally, unlike in the control subject, the spherical-appearing organoids from the mutant patient often showed loss of inward epithelial differentiation gradient, with strong p63-positivity in all the cells (Fig. 2), further suggesting a perturbation in SQ maturation. Together, these findings point to VSIG10L as an essential component involved in maintaining normal SQ maturation and architecture.

Fig. 2: Impaired SQ maturation and architecture of esophageal organoids derived from VSIG10L-mutant patient.
Fig. 2: Impaired SQ maturation and architecture of esophageal organoids derived from VSIG10L-mutant patient.
Full size image

Shown are serial sections of H&E staining and p63 (SQ marker) IHC of hPSC-derived esophageal SQ organoids from VSIG10L(S631G)-mutant BE patient, and a control subject. Respective magnified insets provided on the right show representative areas of the organoids. Note the disrupted morphology and SQ stratification of the organoids from VSIG10L(S631G)-mutant patient, compared to the anticipated normal architecture and stratification of esophageal SQ organoids observed in the control subject. Cells in the abnormal glandular-appearing organoids (blue arrows) in the mutant patient show variable nuclear p63 reactivity. Furthermore, note the lack of epithelial differentiation gradient with a near-all p63-positivity in the majority of spherical/solid organoids (red arrows) from the mutant patient; compared to the normal differentiation pattern of the spherical/solid organoids in the control subject (i.e. strong p63-positivity in the basal cells in the circumference and the gradual loss of p63-reactivity in the differentiated cells towards the center). H&E staining and p63 IHC were performed on duplicate organoid serial sections to ensure reproducibility. Scale bar, 250 µM.

Mice mutant for Vsig10l exhibit ultrastructural and molecular abnormalities in the squamous forestomach

Given our above and prior14 observations implying a potential role of VSIG10L in sustaining SQ homeostasis, we next sought to interrogate the pathogenicity of familial BE-associated VSIG10L variants, in vivo. Accordingly, we generated the following human-orthologous germline Vsig10l-mutant murine models on a C57Bl/6 J background: 1) Based on the human FBE variant (VSIG10L-S631G14), we generated mice carrying the orthologous Vsig10l-S516G missense mutation, mapping to the highly conserved Serine residue within the Ig-like domain14; and 2) Based on the deleterious frameshift variant (rs1185522503) identified in one of our familial BE kindreds mentioned above, we additionally generated mice that were null/knockout (KO) for Vsig10l.

First, similar to our observations in human and porcine tissues (Fig. 1), we found murine Vsig10l to be also selectively expressed in the subprabasal cells of the SQ mucosa (Fig. 3a). As BE typically develops in the distal portion of the esophagus contiguous with the gastro-esophageal (SQ-columnar) junction1, we next assessed for potential ultrastructural changes within the SQ mucosa of the forestomach in the Vsig10l-mutant mice, using Transmission Electron Microscopy (TEM). Both S516G and KO mice revealed a marked reduction in desmosomes in the suprabasal SQ cell layer where VSIG10L is expressed (Fig. 3b). Importantly, our findings in the Vsig10l-mutant mice are remarkably consistent with the ultrastructural changes we observed in the esophagus of familial BE patient carrying the orthologous germline VSIG10L S631G variant14, suggesting a potential role of VSIG10L in maintaining epithelial integrity that is conserved across species. To further understand the molecular programs impacted by Vsig10l disruption, we performed Spatial Transcriptomic Profiling (STP) using formalin-fixed and paraffin–embedded (FFPE) tissues derived from the SQ forestomach of representative wild type and Vsig10l-mutant mice (Fig. 3c). Subsequent gene set enrichment analysis of STP profiles revealed a significant disruption of cell structure and differentiation programs in the SQ mucosa of both S516G and KO mice (Fig. 3c). To orthogonally evaluate our TEM and STP findings, we assessed the expression of Desmogleins (Dsg1/3), members of the cadherin gene family and key components of desmosomes involved in cell-cell adhesion and epidermal cell differentiation19,20, in an independent set of wild type and Vsig10l-mutant mice. Immunohistochemistry (IHC) analyses of FFPE SQ tissues indeed showed a reduction of Dsg1 protein in S516G-mutant mice, with a more pronounced repression of both Dsg1 and Dsg3 proteins in the KO mice, compared to the wild type (Fig. 3d). Collectively, these findings add further support to the role of VSIG10L in maintaining SQ epithelial integrity and maturation.

Fig. 3: Perturbation of structural and differentiation programs in the SQ forestomach of Vsig10l-mutant mice.
Fig. 3: Perturbation of structural and differentiation programs in the SQ forestomach of Vsig10l-mutant mice.
Full size image

a H&E staining of squamous mucosa in 24-month old wild type and Vsig10l-mutant (S516G, KO) mice. Images are oriented with luminal side towards the top and sub-mucosal layer at the bottom. Scale bar, 200 µM. RNAscope-ISH of murine Vsig10l in corresponding serial sections revealing its selective localization in suprabasal cells (magenta dots), while absent in basal squamous cells. As anticipated, Vsig10l expression was absent in KO mice. Vsig10l ISH was performed in three mice per genotype to ensure reproducibility. b Transmission electron microscopy (TEM) analyses of squamous mucosa in wild type and Vsig10l-mutant mice. Note the marked reduction in desmosomes (yellow arrows, magnified view) in Vsig10l-mutant compared to wild-type mice. TEM assessments were performed in duplicates per genotype to ensure reproducibility. Scale bar (pink), 2 µM. c Shown at the top-left is H&E image and corresponding Spatial Transcriptomics Profiling (STP) cluster plot depicting distinct clusters in squamous forestomach, gastric mucosa, and squamo-columnar junction in a wild type mouse. Scale bar, 200 µM. Shown to the right is the t-SNE projection, along with a few exemplar genes representing the different cell types. For example, Cluster 2 is derived from SQ forestomach cells, whereas Cluster 4 from gastric cells. Shown to the right are UMAP plots demonstrating normalized Vsig10l expression across genotypes. Shown at the bottom is STP-based gene set enrichment analyses (GSEA) of differentially expressed genes (DEG) revealing a significant suppression of structural and differentiation programs in squamous mucosa of Vsig10l-mutant mice, compared to wild type. CC (cellular component); BP (Biologic process); MF (Molecular function). Gene sets with a false discovery rate (FDR) q-value of <0.05 were considered statistically significant. Source data are provided as a Source Data file. STP profiling was performed in duplicate tissue sections to ensure reproducibility. d IHC analyses of murine Desmogleins 1 and 3 (Dsg1,3) in SQ tissues, showing decreased Dsg1 protein levels in Vsig10l-mutant mice, with further pronounced loss of Dsg1&3 in KO mice, compared to wild type. Dsg1,3 IHC was performed in duplicate tissue sections to ensure reproducibility. Scale bar, 150 µM.

Of note, in analyzing the STP data, we explored whether Vsig10l disruption additionally leads to perturbations in downstream effectors/signaling pathways, using our in-house developed computational framework, InFlo18,21,22. While no significant changes in canonical signaling pathways or large signaling networks were observed, few individual sub-networks showed altered activities in the Vsig10l-mutant mice compared to wild type (Supplementary Fig. 1). While some of these differentially-activated components such as Notch, Bmp, Smad have been implicated in BE/EAC pathobiology23, characterizing their functional relationship with VSIG10L (direct or indirect) and the broader significance of such changes in these specific nodes/components require further in-depth investigations.

Vsig10l-mutant mice develop BE-like mucinous metaplasia lesions upon chronic exposure to reflux-associated injury

Since factors disrupting epithelial homeostasis can render the esophagus more susceptible to GERD injury and BE pathogenesis7,24,25, we posited Vsig10l-mutant mice may exhibit an inherent propensity to developing BE-like pathologies upon exposure to deoxycholate (DCA), a key bile acid involved in reflux injury and a risk factor for BE26,27,28,29. Accordingly, wild type and Vsig10l-mutant mice were fed either standard diet or diet supplemented with 0.2% DCA, and followed longitudinally for a period of up to 24 months. Mice were then sacrificed, and esophageal, forestomach contiguous with the SQ-columnar junction, and gastric tissues were harvested. Respective FFPE tissue sections were subsequently subjected to histopathological examination. Tissues were primarily assessed for the presence of BE-like lesions, hereafter referred to as Barrett’s-like mucinous metaplasia (BEMM), by a gastrointestinal pathologist (J.E.W) who was blinded to the sample genotypes. Subsequently, the incidences of BEMM lesions in mice were enumerated across respective heterozygous and homozygous Vsig10l genotypes. While no noticeable pathologies were observed in the standard diet group, the vast majority (70%–100%) of Vsig10l-mutant mice on DCA diet developed BEMM lesions at the SQ-columnar junction in the forestomach, significantly different from the infrequent diminutive lesions developing in ~20% of wild type mice (Fig. 4). Importantly, BEMM lesions developing in Vsig10l-mutant mice were also qualitatively quite distinct than those developing in wild type; i.e, BEMM lesions in the Vsig10l-mutant mice were more exacerbated and extensive, unlike the occasional and minor / restricted glandular changes observed in the wild type mice (Fig. 5). Beyond histomorphometric similarities, BEMM lesions in Vsig10l-mutant mice exhibited molecular features that are characteristic of human BE, including: induction of intestinal-type acidic mucins30,31,32; expression of BE-associated mucin, Mucin 6 (Muc6)33,34,35; induction of Trefoil Factor 3 (Tff3), a BE-associated trefoil protein and a marker of established intestinal columnar metaplasia and true goblet cells36,37; as well as SRY-Box Transcription Factor 9 (Sox9), a key transcription factor implicated in BE pathogenesis that drives columnar differentiation of esophageal SQ epithelium38 (Fig. 5). Also, similar to human BE, BEMM lesions in these mice were negative for the SQ marker, p63 (Fig. 5). We further note that no such abnormal lesions or gross histologic changes were apparent elsewhere in the esophagus proper in the Vsig10l-mutant mice. Collectively, these findings underscore the pathogenicity of FBE-associated VSIG10L susceptibility variants in facilitating BE development.

Fig. 4: Augmentation of Barrett’s-like Mucinous Metaplasia (BEMM) at the SQ-columnar junction in Vsig10l-mutant mice.
Fig. 4: Augmentation of Barrett’s-like Mucinous Metaplasia (BEMM) at the SQ-columnar junction in Vsig10l-mutant mice.
Full size image

FFPE tissue sections from 24-month old wild type, S516G, and KO mice on DCA diet were subjected to histopathological examination, where genotypes were blinded to the pathologist. The x-axis of the bar graph shows the different genotypes, including both heterozygous and homozygous for the S516G and KO mice, along with the number of mice in parenthesis available for histopathologic assessment. Y-axes represents the incidence percent of normal vs. BEMM phenotype (at the SQ-columnar junction) in respective genotypes. The provided P-values were estimated using a one-tailed Fisher’s Exact test, comparing wild type vs. respective Vsig10l-mutant genotypes. (#) indicates significant differences between wild type and indicated genotypes at P = 0.0125 following further Bonferroni multiple hypothesis testing correction. Source data are provided as a Source Data file.

Fig. 5: BEMM lesions in Vsig10l-mutant mice recapitulate the histologic and molecular characteristics of human BE.
Fig. 5: BEMM lesions in Vsig10l-mutant mice recapitulate the histologic and molecular characteristics of human BE.
Full size image

Histologic assessments of SQ-columnar junction from two representative mice (m1, m2), per respective genotypes, are shown. Green arrows indicate SQ-columnar junction. Note the BEMM lesions in Vsig10l-mutant mice are more pronounced, replacing a large portion of SQ-columnar junction and adjacent gastric mucosa, unlike the diminutive and restricted changes observed in wild type mice. Respective BE and SQ markers were assessed using IHC and AB-PAS (Alcian blue/Periodic Acid Schiff’s). BEMM glandular lesions containing abundant intestinal-type acidic mucins show intense blue staining, whereas neutral mucins associated with gastric foveolar epithelium stain magenta (AB-PAS). Also note the intense staining of Muc6 (dense cytoplasmic brown staining), Tff3 (dark brown intracellular staining with round to oval appearance), and Sox9 (nuclear staining), along with absence of p63 (squamous epithelial marker) within the BEMM lesions in Vsig10l-mutant mice. Histopathologic assessments were performed in all mice available for testing (from Fig. 4) per respective genotype in a blinded fashion. Subsequent IHC analyses were performed in four mice (biologic replicates) per respective genotype to ensure reproducibility. Scale bar, 250 µM.

Esophageal SQ mucosa from GERD patients reveal a loss of VSIG10L expression

As injury from chronic reflux is a key risk factor for the onset of BE4,5,6, we further sought to conversely determine whether GERD-associated injury to esophageal SQ mucosa can impact VSIG10L expression. Accordingly, we accrued a random set of snap-frozen distal esophageal SQ tissue biopsies from non-familial patients with GERD, and subsequently assessed VSIG10L RNA expression using real-time qPCR. Of note, erosive or ulcerative esophagitis cases were excluded from this analysis. Compared to a random cohort of non-GERD subjects, esophageal tissues from GERD patients showed a significantly lower VSIG10L expression (~3-fold, P = 0.008), while no such differences were observed in TP63 (SQ marker) RNA between the two cohorts (Fig. 6a). To further orthogonally assess VSIG10L expression in the context of GERD, we performed RNAscope-in situ hybridization in distal esophageal FFPE tissue sections, derived from an independent set of five GERD patients and two control subjects that were available for testing. In stark contrast to healthy / normal SQ epithelia, we found a profound reduction of VSIG10L expression or a near-all depletion of VSIG10L-positive differentiation gradient in the stratified SQ layer of GERD-associated reactive esophageal mucosa (Fig. 6b). As anticipated, we observed an expansion of basal-like immature SQ cells expressing p63 particularly in these reactive mucosal regions from GERD patients (Fig. 6b). Taken together, these findings provocatively suggest that GERD-associated disruption of VSIG10L dynamics in the esophageal mucosa may be one of the early molecular changes by which reflux injury impairs SQ homeostasis and potentially enhances the risk of further BE development.

Fig. 6: Chronic reflux injury suppresses VSIG10L expression in the distal esophagus.
Fig. 6: Chronic reflux injury suppresses VSIG10L expression in the distal esophagus.
Full size image

a Real time qPCR analyses of VSIG10L and TP63 RNA in distal esophageal squamous (SQ) biopsy tissues from patients without or with GERD. qPCR was performed in triplicate reactions per sample per gene, and B2M expression was used as an endogenous house-keeping control. Y-axes indicate fold-change (FC) in VSIG10L and TP63 expression in GERD and non-GERD samples, normalized to the average expression of the respective genes in the non-GERD samples. Each black dot overlaid on the bar graphs represents normalized qPCR value of individual sample. Error bars indicate mean ± s.d. Significant differences in expression levels between GERD vs. non-GERD were estimated using two-tailed non-parametric Mann-Whitney U test. Note the ~3-fold lower VSIG10L expression in GERD compared to non-GERD tissues. TP63, used as a control for squamous epithelial content in the biopsy tissues, showed no significant difference (n.s) between the two cohorts. Source data are provided as a Source Data file. b Distal esophageal FFPE tissue sections from two non-GERD subjects and five GERD patients (P1–P5) were subjected to H&E, VSIG10L ISH, and p63 IHC analyses. Control and GERD subjects were >18 yrs old, male (self-reported), and were of European ancestry, with the exception of GERD - P3 patient who is an African American Female (self-reported). GERD patients were on proton pump inhibitors or histamine-2 blockers. All images were oriented with luminal side towards the top and basal SQ cell layer at the bottom. Note the strong VSIG10L expression (magenta dots) in the subprabasal SQ cells in normal/healthy tissues from non-GERD control subjects. In contrast, note the marked reduction or depletion of VSIG10L-positive differentiated cells, concomitant with an expansion of basal-like p63-positive immature cells (brown nuclear staining), in GERD-associated reactive SQ mucosa. ISH and IHC assessments were performed on duplicate tissues sections from all control subjects and GERD patients to ensure technical reproducibility. Scale bar, 200 µM.

Discussion

The cellular origins of BE are likely multifaceted, with several sources including esophageal SQ cells being suggested as potential BE progenitors39,40. In line with this, prior genome-wide association and our familial studies have identified a pathogenetic correlation between genes involved in maintaining esophageal SQ integrity/maturation and risk of BE/EAC development14,41,42. Our prior14 and current studies on VSIG10L in human tissues, relevant ex vivo/in vitro models, and Vsig10l-mutant mice now provide strong evidence underscoring its essential role in maintaining SQ maturation and integrity, and per se, point to the likely pathogenic role of FBE-associated VSIG10L genetic variants. Further, our observation of BE-like pathologies occurring only in the presence of DCA in the Vsig10l-mutant mice suggest that disruption in SQ homeostasis caused by these mutations produce a risky field, and over time, in the presence of chronic GERD injury with concomitant reflux of bile acids, promote BE pathogenesis. Alternatively, inherited or acquired defects in VSIG10L may impair normal healing of reflux-associated injury to SQ mucosa in at-risk individuals, consequently facilitating BE predisposition. Taken together, our findings suggest a plausible hypothesis where a perturbation in SQ homeostasis, much like that observed in GERD, may be one of the key initial processes in the development of BE. In this regard, inherited defects in VSIG10L could disrupt epithelial homeostasis, and render the SQ mucosa more prone to reflux injury and/or abnormal healing following injury, thus enhancing risk of BE development (Fig. 7). In the absence of such inherent predisposition, homeostasis is often restored due to normal healing of the injured esophagus; however, in certain instances, GERD-induced injury to SQ mucosa, concomitant with acquired VSIG10L disruption and additional genetic/epigenetic alterations, could potentially hinder normal healing and promote BE development (Fig. 7).

Fig. 7: A hypothetical representation on the potential role of VSIG10L in BE pathobiology.
Fig. 7: A hypothetical representation on the potential role of VSIG10L in BE pathobiology.
Full size image

Chronic injury such as GERD can lead to disruption of SQ mucosa, proliferation of basal-like immature SQ cells, and inflammation; in a normal state, repair and healing of such injured epithelium regenerates esophageal SQ mucosa and restores homeostasis. However, inherited or acquired defects in VSIG10L can lead to impaired SQ homeostasis, and in conjunction with GERD, could compromise restoration of injured epithelia, and likely facilitate abnormal metaplastic healing and BE predisposition. Of note, it remains unclear (?) whether GERD induces hyperplasia of basal-like immature SQ cells which subsequently leads to loss of VSIG10L-positive differentiated cells, or whether GERD suppresses VSIG10L expression which then disrupts SQ maturation leading to expansion of basal-like SQ cells. Also, the above assumptions are based on the likely role of VSIG10L in maintaining SQ architecture and maturation, and there could be additional (yet to be determined) regulatory and functional aspects of VSIG10L that are involved in BE pathogenesis. Further comprehensive studies are warranted to ascertain these presumptions and to fully dissect the function of VSIG10L.

In regard to Barrett’s esophagus and related neoplasia, we would also like to emphasize that existing in vitro/ex vivo experimental models have significant conceptual and technical limitations that preclude mimicking the pathogenesis of a complex disorder like BE. Furthermore, unlike other common gastrointestinal cancers, there are certain limitations to consider when utilizing surrogate animal models for studying BE/EAC. First, contrary to humans, esophageal mucosa in mice are keratinized, lack submucosal glands, and the stratified SQ epithelium extends from esophagus into mouse forestomach43,44,45. These anatomical distinctions may pose challenges in fully capturing the complexity of human gastroesophageal (patho)biology in mice. In fact, the small number of murine BE models available to date do not robustly mimic human disease, and furthermore were not based on genetic defects pertinent to BE pathogenesis and predisposition in humans43,44,45. Second, it remains unclear why BEMM lesions occur exclusively at the SQ-columnar junction and not elsewhere in the esophagus. Our findings are also in line with the IL1β-mediated inflammatory murine model where pathologic changes were restricted to the SQ-columnar junction46. It is likely that the SQ-columnar (gastro-esophageal) junction may remain the primary site for reflux injury allowing the backflow of stomach acid resulting in metaplastic changes when compared to the esophagus, or that cellular heterogeneity in esophagus may underlie differential response to reflux injury along the length of esophagus compared to SQ-columnar junction. Prior studies have also proposed transitional cells at the SQ-columnar junction as a potential source of BE progenitors47. It is possible that these cells at the SQ-columnar transitional zone are inherently more plastic to intrinsic or extrinsic stresses, and future studies are indeed warranted to elucidate these lines of investigations. Third, while our familial studies show association of germline VSIG10L variants with risk of BE as well as EAC development14, we did not observe any cancers in the Vsig10l-mutant mice. This lack of a cancer phenotype is consistent with available animal models in this disease context43,44,45. It is possible that longer follow-up studies, additional genetic, epigenetic, mutagen, and/or dietary changes need to be considered to facilitate the development of cancer in mice. Also, VSIG10L remains largely uncharacterized, and our prior14 and current translational investigations were predominantly geared towards identifying VSIG10L susceptibility variants and determining their pathogenicity and biologic consequences, a critically-important step in ascertaining causality. Further comprehensive studies are indeed needed to fully decipher the biochemical and regulatory aspects of VSIG10L.

The discovery of pathogenic variants in genes such as APC and BRCA1/2 from studies of rare families have led to key insights into the molecular pathogenesis of colorectal and breast cancers. Similarly, our discovery of genes involved in BE/EAC predisposition14,48, such as VSIG10L, from studies of FBE families should provide critical molecular insights into metaplasia-dysplasia-cancer progression, identify targets for developing chemopreventive/therapeutic drugs, and enable development of genetic tests for early screening for BE/EAC susceptibility. Moreover, the human-orthologous Vsig10l-mutant murine models we developed here should provide a more relevant physiologic system to study disease pathogenesis as well as for interrogating potential dietary and/or chemical modulators associated with BE development, progression, and/or prevention.

Methods

Our research study complies with relevant ethical regulations. Written informed consent was obtained from all donors for use of their samples and clinical data in the present study. All human protocols were approved by University Hospitals Cleveland Medical Center Institutional Review Board (IRB) for human investigations (CASE 3207 CC301) and Duke GI Tissue Repository (protocol number; 00001662), adherent to the principles outlined in the Declaration of Helsinki. PBMC-derived human pluripotent stem cells from the VSIG10L S631G mutant patient and control subject were obtained under an IRB-approved protocol (CASE 3207 CC301) with written consent, and included MTA agreements where appropriate. Archived Porcine tissues were accessed through North Carolina State University (NCSU), approved by NCSU Institutional Animal Care and Use Committee-approved protocol (NCSU 13-116-B). All mouse studies were approved by Case Western Reserve University Institutional Animal care and Use Committee (IACUC), and conform to the ARRIVE 2.049 guidelines. A flow diagram illustrating all the experiments performed and reported in the current study is provided in Supplementary Fig. 2.

Familial patients and VSIG10L DNA sequencing

Probands with BE or EAC as well as unaffected controls were recruited and gave written informed consent for collection of biopsy tissues and blood for research as part of the Barrett’s Esophagus Translational Network (BETRNet) Consortium using a consent and biobanking protocol (protocol number, CASE 3207 CC30) approved by the Institutional Review Board for Human Investigation at University Hospitals Cleveland Medical Center and collaborating institutions8,12,13,14,15, adherent to the principles outlined in the Declaration of Helsinki. The observational study is registered at clinicaltrials.gov, NCT00288119. Study subjects were given a questionnaire that collects information about BE and EAC risk factors along with family history. Study subjects provide written consent to use banked biospecimens for genetic studies and other future research. Permission is also obtained from probands to contact their relatives. Histologic diagnosis for family members reported to have BE or EAC is confirmed by review of records whenever available. Family members who had no prior esophagogastroduodenoscopy (EGD) were offered screening. Blood or saliva is banked from probands and family members who are alive and consent to the study. Study subjects gave written consent and blood lymphocytes were collected, immortalized, and banked at the Rutgers University DNA Repository (RUCDR) as a source of germline DNA from all family members who had screening endoscopy. For deceased family members, permission is obtained from nearest living relatives to obtain formalin fixed paraffin embedded (FFPE) biopsy tissues from treating hospitals. Germline DNA was extracted from blood, immortalized lymphocytes, saliva, or FFPE tissues for subsequent sequencing. Targeted capture and DNA resequencing of VSIG10L exons in 684 samples, belonging to 302 families, was performed by Novogene (Sacramento, CA). Of the 684 subjects, 428 were men and 256 women (self-reported), mean age was 61.5 years (range; 14–100 yrs), and all familial BE subjects were of European ancestry. Only samples passing internal quality controls were included in the analysis. Raw 100-bp FASTQ reads were aligned to the human reference genome (hg19) using the Burrows-Wheeler Aligner (BWA-v0.7.17)50. Alignment quality was assessed with GATK Picard tools (v2.18.12), followed by pre-processing of BAM files with a custom script utilizing GATK51 to mark duplicates, recalibrate base quality scores, and realign indels. For variant calling, we used two independent callers; UnifiedGenotyper52 and HaplotypeCaller53 from the GATK Suite. Variant calls were filtered to exclude those with coverage below 30 reads or an alternate base frequency under 0.1. Filtered variants were annotated using Oncotator (v1.9.1.0)54, and were further analyzed for population-level allele frequencies using the ExAC55 and gnomAD (v4.1.0)56 databases. All rare/private variants were further manually reviewed using Integrative Genomics Viewer57. Lastly, selected variants were orthogonally confirmed in fresh DNA aliquots from respective samples using direct Sanger sequencing.

Porcine tissue procurement

Archival porcine esophageal tissue blocks of normal squamous epithelium were accessed for the VSIG10L localization assays. All porcine tissues were originally derived from Yorkshire crossbred pigs (Sus scrofa) of either sex, weighing approximately 35 kg, and cared for according to North Carolina State University Institutional Animal Care and Use Committee-approved protocol (NCSU 13-116-B) and as set forth in the Guide for the Care and Use of Laboratory Animals, published by the National Institutes of Health. Porcine tissues were collected by North Carolina State University Large Animal Models Core of the Center for Gastrointestinal Biology and Disease (CGIBD) under veterinary supervision58. For euthanasia, initial sedation was provided with xylazine-ketamine injection, and then animals were euthanized with pentobarbital (60 mg/kg IV) and clinically assessed by veterinary staff to confirm death prior to collection of esophageal tissues that were subsequently used for histologic analyses.

Generation of Vsig10l mutant mice

Vsig10l S516G missense mutant (orthologous to the human VSIG10L variant S631G14) and Vsig10l knockout (KO) (targeted deletion of Exon 1- Exon 10) mice were generated on a C57Bl/6 J (The Jackson Laboratory, Bar Harbor, ME) genetic background (Strain no:000664), using standard CRISPR-Cas9 methodology. Briefly, single guide RNAs (sgRNAs) for generating murine Vsig10l (Gene ID: 75690) S516G and KO were selected using the CRISPR design tool (http://crispr.mit.edu/)59. In the end, the following sgRNA sequences (5’-3’) were selected for the missense S516G mutant (CGACTACAGCTTAGCCAGGA on exon 6), and for the KO (upstream-ACCTGGGACAATGCAAGCTG; downstream-AGGACTGGACCCTAAGAGTG). Cleavage efficiency of the selected sgRNAs were confirmed using the Guide-it Complete sgRNA Screening System (TakaraBio USA Inc, San Jose, CA; cat. no. 632636), with C57Bl/6 J mouse genomic DNA as the template. PAGE-purified sgRNAs along with Cas9 protein (PNA Bio, CA) were microinjected into fertilized eggs and implanted into pseudopregnant females to generate mice with precise genomic edits at specific loci. For the S516G mutant, the following PAGE-purified donor ultramer was co-injected: 5’-CTCGGCAAGGACGGCCCCTGGCTCCAGGTGGTGGGGGCCGACTACAGCTTGGCCAAGATGGCCGAAAGCTCCTCATCAACAACTTCAGCCTGGATTGGGA. Tail DNA extracted from the pups were confirmed for genomic editing using the Illumina Miseq platform (San Diego, CA) for founder mice. F1 founder mice were selected following confirmation of germline transmission by backcrossing with wild type C57Bl/6 J mice. The above CRISPR-based Vsig10l mutant mice were generated in collaboration with the Transgenic and Targeting facility at Case Western Reserve University (CWRU). All animal studies were approved by Case Western Reserve University Institutional Animal care and Use Committee (IACUC), under the protocol number 2019-0082, and were handled in compliance with the 3Rs (Replacement, Reduction and Refinement) ethics guidelines. All wild type and Vsig10l mutant mice were housed in the CWRU animal core facility and maintained on a standard 12 h:12 h light-dark cycle, 70–74 °F temperature, and ~50% humidity. The Vsig10l-mutant mouse models developed here will be shared with other investigators upon request and following review by the corresponding author to ensure that distribution complies with ethical, institutional, and material-transfer guidelines.

Breeding and genotyping of Vsig10l mutant mice

Homozygous Vsig10l mutant mice (S516G and KO) were viable and exhibited fair breeding performances. Genotyping was performed using DNA isolated from tail digests. Briefly, mutant mice for S516G were genotyped using PCR-Sanger sequencing with primer sequences on Exon 6 (forward; TGCTGCTCCAGCCCATAGT, reverse; TGGACCTGAGAGAGGGTGATT, amplicon size of 361 bp). Vsig10l KO mice were genotyped using conventional PCR amplification with primer sequences upstream of Exon 1 (forward; TGGGCTTCTCCATACAACCTC) and downstream of Exon 10 (reverse; TGCCAACCACATTCATCCGT) resulting in an amplicon size of 401 bp for the deleted region. Genotypes of heterozygous mice (-/+) were confirmed using the above primers as well as PCR amplification of the wild type Exon 9 region (forward; GCTCACCCCACCAGCAAAAA, reverse; ACAGTGGGAGGCAACGACAC), resulting in 401 bp and 139 bp products. PCR conditions included initial denaturation at 95 °C for 4 min, followed by 40 cycles of 95 °C for 30 sec, 66 °C (S516G) or 58 °C (KO) annealing for 45 s, and 72 °C extension for 45 sec. All animal procedures were approved by CWRU in accordance with Institutional Animal care and Use Committee (IACUC) and followed the National Institutes of Health guidelines.

Animal diet and tissue harvest

Animals were fed either standard irradiated diet containing 12 kcal% fat with Palm Oil (Research Diet Inc, NJ; cat. no. 19102101), or standard irradiated diet containing 12 kcal% fat with Palm Oil supplemented with 0.2% Deoxycholic Acid (Millipore Sigma-Aldrich, cat no. D2510; Research Diet Inc; cat. no. 19102102) starting at 5 weeks of age and for a period of 24 months. Animals within each genotype were randomly assigned to the respective standard or standard plus DCA diet groups. The diets were stored in cold dry place. Mice were allowed to have ad libitum access to respective diets (replenished weekly), and drinking water was supplied through standard sipper tubes during the entire duration of the study. At the end of the study, esophagus and forestomach from each mouse were isolated, formalin-fixed (10% neutral buffer) and paraffin–embedded (FFPE) for subsequent histopathologic and molecular assessments. The overall sex distribution of the mice available for final analyses (N = 46) were 50% male and 50% female; wild type (50% male), Vsig10l S516G/+ (58% male), Vsig10l S516G/S516G (44% male), Vsig10l −/+ (57% male), Vsig10l −/− (38% male). As genetic predisposition can enhance BE/EAC risk in both men and women8,15,60, data from both male and female mice in respective genotypes were pooled for all analysis. All animal experiments were conducted in accordance with the ARRIVE 2.0 guidelines49.

EPC2 squamous 3D-Organotypic culture model

EPC2 human esophageal squamous esophageal cell line (EPC2), originally derived from a male non-BE patient14,18,61, was gifted to us by Dr. John P. Lynch MD, Ph.D at University of Pennsylvania. Briefly, EPC2 cells were grown in serum free keratinocyte-SFM media (Thermo Fisher scientific, Waltham, MA; cat no. 17005042), supplemented with Bovine Pituitary Extract (BPE, Thermo Fisher scientific; cat no. 13028-014) and human recombinant epidermal growth factor (rEGF, Thermo Fisher scientific; cat no. 10450-013), and maintained at 37 °C and 5% CO2. Cells were tested for authenticity using short tandem repeat genotyping and were screened periodically for mycoplasma contamination. EPC2 3D-organotypes were generated as follows: Transwell inserts were added to deep-well six-well plates. 3D collagen/Matrigel matrices (bottom and top layer in the transwell insert) were prepared on Day1. The bottom layer was prepared using 10X EMEM (BioWhittaker, Walkersville, MD; cat no. 12-684 F), Fetal Bovine serum (Hyclone, Logan, UT; cat no. SH30088.3), L-glutamine (Cellgro, Corning, NY; cat no. 25-005-CI), sodium bicarbonate (BioWhittaker; cat no. 17-613E) and high concentration (2.2 mg/ml) collagen rat tail (Corning; cat no. 354249). The reagents were mixed well and incubated at 37 °C for 20 min to let the matrix solidify. The top layer of the insert was prepared by mixing 10X EMEM, FBS, L-glutamine, Sodium bicarbonate, collagen, matrigel (Corning; cat no. 354234), and 7.5 × 104 human esophageal fibroblasts (ScienCell, Carlsbad, CA; cat. no. 2730), and then added to the bottom of the transwell. On Day7, media was changed to Dulbecco’s Modified Eagles Medium (Sigma-Aldrich, St. Louis, MO; cat no. 51441 C) and Ham’s F-12 (Gibco, Grand Island, NY; cat no. 11765-054) in a 3:1 ratio and added to the bottom and top of the transwell and incubated for 1 h at 37 °C. Media was then removed from the top and approximately 1.5 × 106 EPC2 cells were added as droplets. After a 2-hour incubation at 37 °C, Epidermalization I media was added to the plate supplemented with the following: DMEM, F-12, L-glutamine, Hydrocortisone (Sigma-Aldrich, cat no. H0888), ITES (500x) (Biowhittaker; cat no. 17839Z), O-phoshory-ethanolamine (Sigma-Aldrich; cat no. P0503), adenine (Sigma-Aldrich; cat no. A9795), progesterone (Sigma-Aldrich; cat no. P8783), triiodothyronine (Sigma-Aldrich; cat no. T5516), newborn calf serum chelated (Hyclone; cat no. SH3011802). On Day 11, media was removed and the Epidermalization II medium was added to the bottom of the plate only, allowing the epithelial cells to differentiate at the air-liquid interface. Epidermalization I and II media have similar components, except that no progesterone is added to Epidermalization II media. On day 17 organotype cultures were harvested by fixing in 10% formaldehyde (Thermo Fisher Scientific; cat.no. SF100-4), and later were paraffin-embedded for further histopathological analysis.

RNAscope In Situ Hybridization

RNAscope ISH was performed on 5 μM FFPE sections62 derived from human, porcine and mouse tissues, using the RNAscope 2.5 HD Single-plex Chromogenic Assay kit as per the manufacturer’s instructions (Advanced Cell Diagnostics, Newark, CA; cat. no. 322360). Briefly, 5 μM tissue/organoid sections were baked for 60 min at 60 °C, de-paraffinized in xylene for 5 min twice and rehydrated in 100% ethanol for 3 minutes and air dried for 5 min. The sections were then quenched with hydrogen peroxide for 10 minutes at room temperature and heat-induced RNA Scope antigen retrieval was carried out at 100-104°C for 15 minutes. Following antigen-retrieval, slides were rinsed quickly in distilled water at room temperature and dipped in 100% ethanol for 2 min and air dried for 5 min. The sections were covered with RNAscope protease plus, followed by incubation in a humidity-controlled oven for 25 min at 40 °C and rinsed in distilled water. Sections were then subjected to VSIG10L ISH with custom RNAscope-ISH probes, designed using Advanced Cell Diagnostics RNAscope probe design pipeline, against respective human (cat. no. 1086661-C1), pig (cat. no. 1161521-C1) or mouse (cat. no. 1088591-C1) species. ISH probe hybridization was carried out in a humidity-controlled oven for 120 min at 40 °C. Following hybridization, sections were washed in RNAscope 1X wash buffer atleast twice for 2 min at room temperature. Sections were subsequently processed for signal amplification using RNAscope amplification reagent 1 in a humidity-controlled oven for 30 min at 40°C. Following amplification, sections were rinsed with RNAscope 1X wash buffer atleast twice for 2 minutes at room temperature. The above step was repeated with amplification reagents 2, 3, and 4, followed by rinsing with RNAscope 1X wash buffer for each section. Sections were then incubated with amplification reagent 5 and 6 for 15-30 min at room temperature with intermittent rinsing using RNAscope 1X wash buffer atleast twice for 2 min at room temperature. Sections were then covered with Fast Red Chromagen (Advanced Cell Diagnostics; cat. no. 322360) by using a 60:1 dilution of Buffer Fast Red A: Chromagen Fast Red B for 3-5 minutes. After decanting the chromagen, 120 µl of 3,3’-Diaminobenzidine chromogen (DAB) mixture was added to each section and incubated at room temperature for 10 minutes. Sections were then rinsed in distilled water and stained with CAT Hematoxylin counter stain (Biocare Medical, Pacheco, CA; cat. no. CATHE-M) for 30 s, rinsed under running tap water for 30 s, followed by additional rinses in distilled water for 1 min atleast three times. Cell nuclei were stained with bluing reagent for one minute with TBST wash buffer and rinsed in running tap water for 30 s and dehydrated in Xylene, and cover slipped with Ecomount medium (Biocare Medical; cat. no. EM897L). Tissue/organoid sections were also stained for standard Hematoxylin and eosin (H&E) for histologic characterization in respective serial sections. Stained sections were visualized using EVOS M7000 imaging system (Thermo Fisher Scientific). All images were captured using identical settings on the EVOS M7000 imaging system, and each tissue section on a slide was imaged in its entirety using the M7000 image tile-stitching software function.

Electron microscopy

Esophageal tissues from euthanized mice were prepared for electron microscopy using the protocol previously described by us14,63,64. Briefly, tissues were fixed with triple aldehyde-DMSO fixative for 2 h at room temperature. The specimens were thoroughly rinsed in 0.1 M phosphate buffer, pH 7.4, then post-fixed for 2 h in an unbuffered 1:1 mixture of 2% osmium tetroxide and 3% potassium ferricyanide. After rinsing with distilled water, the specimens were soaked overnight in an acidified solution of 0.25% uranyl acetate. After another rinse in distilled water, they were dehydrated in ascending concentrations of ethanol, passed through propylene oxide, and embedded in Poly/Bed resin mixture. Thin sections were sequentially stained with acidified uranyl acetate followed by a modification of Sato’s triple lead stain and examined in a FEI Tecnai Spirit (T12) transmission electron microscope with a 4k × 4k Gatan US4000 CCD camera.

Spatial Transcriptomics

The Visium Spatial Gene Expression platform from 10x Genomics was used for spatial transcriptomic profiling (STP). Briefly, esophageal FFPE tissue sections (5 μM) from wild type and Vsig10l mutant mice (with DV200 ≥ 80%) were placed within a 6.5 mm2 field on a 10x Genomics gene expression slide that contains 5000 barcoded probes. Sections were deparaffinized via xylene immersion, ethanol to remove the solubilized paraffin, and then immersion in water to remove residual ethanol. The deparaffinized tissues were then stained with hematoxylin and eosin (H&E) to visualize tissue architecture. RNA sequestered by formalin fixation within the tissue is de-crosslinked by serial treatment with HCl at room temperature followed by heating at 70 °C in TE buffer pH 9.0 for 1 h. Next, cells within the tissue were permeabilized prior to RNA hybridization with whole transcriptome mouse probe panels (21k), consisting of RNA-templated ligation (RTL) probes that target the protein-coding transcriptome. Following targeted gene probe ligation, the poly-A tail from probes were then used as template for the on-surface probe priming. Probes were extended by the addition of a UMI, Spatial Barcode and partial Read 1, then released from the slide and collected for qPCR to optimize sample index PCR cycle number. Targeted gene products then underwent index PCR to ligate Illumina sequencing adapters and sample dual indices followed by final library cleanup by SPRI select size selection. Final libraries were assessed on a Tapestation 4200 and quantified by qPCR. Libraries were sequenced on Illumina NGS paired end sequencers at 25k reads/spot on an Illumina paired end, dual indexed flowcell in the format of 28x10x10×50. Data were then uploaded to analyses packages for visualization.

Gene Set Enrichment analyses (GSEA)

Spatial transcriptomics gene expression data from wild type and Vsig10l mutant mice were subjected to Gene Set Enrichment analyses (GSEA) using the fgsea package in R. This analyses aimed to pinpoint pathways and biological processes significantly enriched among the differentially expressed genes (DEGs) between the experimental groups: Wild type vs. S516G; Wild type vs. KO. Gene sets were sourced from multiple databases, including the Molecular Signatures Database (MSigDB), Gene Ontology (GO), KEGG, and Reactome, encompassing curated pathways and gene ontologies. The input for GSEA consisted of ranked gene lists based on log2 fold change values for differential expression between the aforementioned comparisons. For each analyses, GSEA calculated an enrichment score (ES) for each gene set, indicating the extent to which the genes within that set were overrepresented at the top or bottom of the ranked gene list. The significance of the ES was determined through permutation testing (1000 permutations), which yielded a normalized enrichment score (NES). We considered gene sets with a false discovery rate (FDR) q-value of <0.05 to be significantly enriched.

Immunohistochemistry

Immunohistochemical evaluation was performed using standard protocols and methods as previously described by our group18,22. Briefly, 5 μM mouse and human tissue/organoid sections were baked for 75 min at 60 °C followed by de-paraffinization in xylene and subsequent rehydration in series of graded ethanols (100%, 95%, 70%, respectively) and rinsed in distilled water. Heat-induced antigen retrieval was carried out in a pressure cooker in citrate solution (pH 6.0) at 123 °C for 30 s and endogenous peroxidase was quenched with 3% hydrogen peroxide for 8 min. Charged proteins and endogenous IgG was blocked in background sniper solution for 20 min. Slides were incubated with the primary Dsg1 (Abcam; cat. no. ab124798, 1:1000 dilution), Dsg3 (Thermo Fisher; cat. no. BS-6585R, 1:400 dilution), Muc6 (Thermo Fisher; cat. no. PA5-79706, 1:1500 dilution), Tff3 (Thermo Fisher; cat. no. 14-4758-82, 1:5000 dilution), Sox9 (Abcam; cat. no. ab185230, 1:1000 dilution), p63 (GeneTex, cat. no. GTX102425, 1:100 dilution), or CK7 (Abcam, cat. no. ab181598, 1:50,000) overnight at 4 °C. Detection of antibodies was achieved by incubating the tissue sections with anti-mouse or anti-rabbit horseradish peroxidase (HRP) conjugated polymers for 30 minutes. Sections were stained with 3,3’-Diaminobenzidine chromogen for 5 min to visualize the antigen-antibody binding, and hematoxylin was used as a nuclear counterstain. Stained sections were visualized using the EVOS M7000 imaging system (Thermo Fisher Scientific). In parallel, FFPE sections were subjected to standard Alcian blue/Periodic Acid Schiff’s stain procedure to evaluate the presence of mucins. Briefly, 5 μM esophageal and forestomach tissue sections were deparaffinized and hydrated with distilled water. Sections were then placed in Alcian Blue (AB) pH 2.5 stain solution for 30 min at room temperature, and rinsed with deionized water. Subsequently, sections were placed in Periodic acid solution (PAS) for 5 min at room temperature, rinsed with deionized water, followed by staining with Schiff’s reagent for 15 min and rinsed with deionized water. All sections were counter stained with hematoxylin 7211 for one minute, rinsed, and followed by staining with bluing reagent for one minute. Sections were dehydrated in anhydrous alcohol followed by clearing and mounting. The acidic mucosubstances appear blue in color and the neutral polysaccharides appear purple/magenta in color. All images were captured using identical settings on the EVOS M7000 imaging system, and each tissue section on a slide was imaged in its entirety using the M7000 image tile-stitching software function. As appropriate, IHC findings were assessed on a qualitative scale for the presence or absence of signal (yes or no) in a blinded fashion.

Human PSC-derived esophageal organoids

PBMC-derived human pluripotent stem cells (hPSC) were generated from the VSIG10L S631G mutant patient who had provided written consent under the protocol approved by the Institutional Review Board for Human Investigation at the University Hospitals Cleveland Medical Center14. The control BU3 hPSC line65, derived from a healthy male Caucasian, was purchased from Boston university stem cell core under an MTA agreement and approved informed consent. Esophageal progenitor cells (EPCs) were subsequently derived from the hPSCs as previously described66. Briefly, hPSCs were first cultured in mTeSR plus medium (Stemcell technologies, Vancouver, BC; cat. no. 85850) on 6-well plates coated with 100x diluted Matrigel. After 24 hours, the medium was replaced with Definitive Endoderm Medium plus supplements MR and CJ (StemCell Technologies; cat. no. 05110). After additional 24 hours of culture (day 2), the media was replaced and cells incubated in Definitive Endoderm (DE) medium plus supplement CJ. At day 3, the media was replaced again with fresh DE media plus supplement CJ. At day 4, Serum-Free Differentiation (SFD) Media was prepared as following: 375 ml of reconstituted Iscove’s DMEM (Corning, Corning, NY; cat. no. 15-016-CV), 125 ml of Ham’s F-12 (Corning; cat. no.10-080-CV), 5 ml of N2 (Thermo Fisher Scientific; cat. no. 17502048), 10 ml of B27 (Thermo Fisher Scientific; cat. no. 12587010), 3.3 ml of 7.5% Bovine Albumin Fraction V Solution (Thermo Fisher Scientific; cat. no. 15260037), 19.6 μl of 11.5 M monothioglycerol (Sigma-Aldrich, St. Louis, MO; cat. no. M6145), 500 μl of L-Ascorbic acid (Sigma-Aldrich; cat. no. A92902) and 1 ml of 50 mg/ml primocin (Invitrogen, Waltham, MA; cat. no. NC9141851). At day 4, the cells were passaged into new Matrigel-coated 6-well plates as clusters and cells were further induced by culturing in the SFD medium plus 10 μM SB431542 (Selleckchem, Houston, TX; cat. no. S1067), 200 ng/ml Noggin (R&D Systems, Minneapolis, MN; cat. no. 6057-NG),100 ng/ml EGF (Peprotech, Cranbury, NJ; cat. no. AF-100-15) and 10 μM Y-2763210 (Selleckchem; cat. no. S1049) for 24 hours and the SFD medium plus 10 μM SB431542, 200 ng/ml Noggin and 100 ng/ml EGF for another 48 hours (day 5-6). Cells were maintained at 5% O2/ 90% N2/ 5% CO2 from day 1–6. To induce esophageal progenitor cell differentiation, anterior cells were cultured from day 7 to day 16 in the SFD medium plus 10 μM SB431542, 200 ng/ml Noggin and 100 ng/ml EGF. From day 16 to day 24, cells were maintained in the SFD medium plus 100 ng/ml EGF. Cells were cultured at 95% air/ 5% CO2 from day 7 onwards. On day 24, the cells were sorted using FACS to obtain EPCs. To perform cell surface marker staining, cells were disassociated with Accutase added DNase (Thermo Fisher Scientific) and 10 μM Y-2763210 and stained with PE/Cyanine7 anti-human CD326 (EpCAM) antibody (BioLegend, San Diego, CA; cat. no. 324201) in FACS buffer (1× PBS, 2% FBS, added DNase and 10 μM Y-2763210) for 1 hour with live/dead staining dye SYTOX (Thermo Fisher Scientific; cat. no. S7020) to exclude dead cells. Stained cells were analyzed using BD FACS CariaII (BD Biosciences, Franklin Lakes, NJ) and sorted EPCAM-positive cells. Sorted hPSCc-derived EPCs were counted and seeded at 20,000 cells per 50 μL Geltrex (Thermo fisher Scientific; cat. no. A1413202) per one well of a 24-well plate, and the medium was added to after Geltrex solidified. The organoid culture medium included the SFD medium, supplemented with 10 μM Y27632, 10 μM SB431542, 10 μM GSK3 inhibitor (Stem cell technologies; cat. no. CHIR99021), 20 ng/ml FGF2 and 200 ng/ml EGF. hPSC-derived EPC 3D-organoids were subsequently FFPE embedded, sectioned, and used for analysis.

Semi-quantitative PCR analysis of VSIG10L in GERD vs. non-GERD biopsy tissues

Endoscopically-normal appearing mucosal biopsies were collected from the distal 5 cm of the squamous esophagus from control patients without BE or EAC during upper endoscopy who consented under the observational study biobanking protocol approved by the Institutional Review Board for Human Investigation of the University Hospitals Cleveland Medical Center9. Esophageal samples from Duke University hospitals were obtained from participants who enrolled in the GI Tissue Repository, and longitudinal observational study of patients presenting for endoscopic procedures who agreed to use of excess clinical samples approved by the Institutional Review Board for Human Investigation at Duke Universtiy Medical Center (protocol number; 00001662), adherent to the principles outlined in the Declaration of Helsinki. Archival samples from research participants were accessed through CWRU and Duke BioRepository & Precision Pathology Center (BRPC). Clinical data were collected and updated, including demographics, gastrointestinal symptoms, endoscopic and pathologic findings as previously described67. Chronic GERD was defined as the presence of at least weekly heartburn or regurgitation for at least five years as assessed by the Mayo gastroesophageal reflux questionnaire (GERQ)68. Erosive or ulcerative esophagitis cases were not included. Non-GERD was defined as either none or less than once a month heartburn or regurgitation for less than five years. All biopsy tissues were snap-frozen at the site of collection. Among the GERD subjects (n = 23), 77% were men and 23% were women (self-reported), and the mean age of the sampled cohort at the time of diagnosis was 54.7 years (range; 28-77 yrs). 92% of GERD subjects were of European ancestry and 8% Asians. All but 4 of the subjects with GERD were on proton pump inhibitors or histamine-2 blockers. For the non-GERD control cohort (n = 24), 73% were men and 27% were women (self-reported), and the mean age of the sampled cohort was 60.1 years (range; 41-80 yrs). 96% of non-GERD control subjects were of European ancestry and 4% African Americans. Total RNA was extracted from respective distal esophageal squamous biopsies using RNeasy Plus Mini kit (Qiagen, Germantown, MD; cat. no. 74134,). Subsequently, 0.5-1 μg of total RNA was reverse-transcribed using Superscript IV First-Strand Synthesis (Thermo Fisher Scientific; cat. no. 18091) according to the manufacturer’s protocol. qPCR of VSIG10L (Qiagen; cat. no. QT02451393), TP63 (Qiagen; cat. no. QT02424051), and beta-2-microglobulin (B2M) (Qiagen; cat. no. QT00088935) were performed using iQ SYBR Green Supermix (Bio-Rad Laboratories, Hercules, CA; cat. no. 170-8887) on the CFX96 system (Bio-Rad). TP63 was used as a control for SQ epithelial content in the biopsy tissues and B2M was used as an endogenous control for RNA. Each qPCR reaction was carried out in triplicates and the mean expression levels across the triplicates were normalized to the mean expression values of B2M using the ΔCt method. A two-tailed non-parametric Mann-Whitney U test was used to determine significant differences in expression between GERD vs non-GERD tissues.

Statistics & Reproducibility

Data analyses and pertinent statistical tests are outlined in respective Methods sub-sections above. Sample size estimations or randomization were not applicable for human genetic studies, as all individuals that were accrued were sequenced. The study focuses on identifying BE susceptibility variants in VSIG10L in affected families. Unaffected/healthy family relatives were sequenced where available. To assess the minor allele frequencies of the detected VSIG10L variants in families, large-scale population databases like gnomAD and ExAC were used. Results from gene expression studies in human samples were estimated using non-parametric tests. For animal studies, assuming 80% power and a significance level of 0.05, 6 mice in each group will enable detecting ≥50% metaplasia incidence (qualitative estimates) with a 95% CI of±28.1. For diet studies, respective age-matched genotype mice were randomly assigned to the standard or DCA diet groups, and dietary interventions were initiated at the same age across genotypes. Vsig10l-mutant genotypes were compared to respective wild type littermates in all instances. Results from animal expression studies were also estimated using non-parametric tests, and additional multiple testing corrections were performed for STP datasets where appropriate. Where appropriate, biologic/technical replicates were included in the experiments to confirm reproducibility of the results. As stated before, mouse genotypes were blinded for all subsequent histopathologic and electron microscopy assessments. No data were excluded for either human or animal studies.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.