VSIG10L is a major determinant of esophageal homeostasis and inherited predisposition to Barrett’s esophagus

Ravillah, Durgadevi; Singh, Salendra; Katabathula, Ramachandra M.; Kresak, Adam M.; Udhayakumar, Bhavatharini; Gupta, Rajesh; Brock, Wendy; Mitani, Yosuke; Jain, Vaibhav; Hocke, Emily; Gregory, Simon G.; Garman, Katherine S.; Gabre, Joel T.; Fujioka, Hisashi; Willis, Joseph E.; Chak, Amitabh; Guda, Kishore

doi:10.1038/s41467-026-68975-3

Download PDF

Article
Open access
Published: 29 January 2026

VSIG10L is a major determinant of esophageal homeostasis and inherited predisposition to Barrett’s esophagus

Nature Communications volume 17, Article number: 2167 (2026) Cite this article

4400 Accesses
48 Altmetric
Metrics details

Subjects

Abstract

The molecular underpinnings contributing to the onset of Barrett’s esophagus (BE) remain elusive. By studying familial clusters of the disease, here we identify a significant association between genetic variants in the V-set and Immunoglobulin Domain Containing 10 Like (VSIG10L) gene and BE predisposition. Using mammalian tissues and patient-derived organoids, we show VSIG10L is selectively expressed in the suprabasal squamous cells of the esophageal mucosa and is essential for epithelial maturation and homeostasis. Mice carrying human-orthologous germline mutations in Vsig10l exhibit loss of desmosomes, concomitant with disrupted epithelial differentiation programs, in the squamous mucosa. Upon long-term exposure to a bile acid (deoxycholate) supplemented diet, Vsig10l-mutant mice develop overt BE-like lesions in the forestomach. Furthermore, loss of esophageal VSIG10L expression is observed frequently in patients with chronic gastroesophageal reflux disease, a known risk factor for BE. Collectively, our study uncovers a fundamental link between VSIG10L, esophageal homeostasis, and BE predisposition.

MiRNA expression analysis from circulating exosomes in Barrett’s esophagus patients with visceral obesity

Article Open access 12 December 2025

Systematic analyses of GWAS summary statistics from UK Biobank identified novel susceptibility loci and genes for upper gastrointestinal diseases

Article 18 May 2023

Mechanisms and pathophysiology of Barrett oesophagus

Article 07 June 2022

Introduction

Barrett’s esophagus (BE) is characterized by intestinal-type mucinous metaplasia of squamous (SQ) epithelial cells in the distal esophagus¹. Patients with BE in particular are at a high risk of developing esophageal adenocarcinoma (EAC), an increasingly prevalent and refractory malignancy, often diagnosed at advanced stages where treatments become ineffective^2,3. While risk factors for BE/EAC such as age, male gender, Caucasian ethnicity, obesity, gastroesophageal reflux disease (GERD), and diet have been previously suggested, they lack sufficient predictive power to guide effective clinical management of this disease^4,5,6. Moreover, the co-opting genetic / molecular aberrations contributing to the onset and progression of BE remain elusive and complex⁷.

Prior studies from our group identified that up to 10% of patients with BE/EAC report a family history, indicating a genetic predisposition to the disease^8,9,10,11,12. Our segregation analysis in familial clusters of the disease strongly suggested that familial BE (FBE) is consistent with dominant transmission of one or more incompletely penetrant major Mendelian alleles¹³. Moreover, we have identified genetic linkage of familial BE to distinct chromosomes and genomic loci⁸, suggesting that FBE is genetically complex. Using familial association and high-throughput genomic approaches in a large multi-generational index family, we subsequently discovered the first inherited autosomal dominant BE susceptibility variant (S631G) mapped to a highly-conserved Serine residue within the Ig-like domain in the V-set And Immunoglobulin Domain Containing 10 Like (VSIG10L) gene¹⁴.

Here we sought to determine the extent of VSIG10L susceptibility variants in a large cohort of BE/EAC familial kindreds. Furthermore, we characterized the expression of VSIG10L in esophageal mucosa, developed human-orthologous Vsig10l-mutant mice, and performed molecular and phenotypic studies to interrogate the pathogenicity of VSIG10L variants. Overall, our study identifies VSIG10L as a key molecule involved in maintaining esophageal homeostasis; defects in which enhance susceptibility to BE.

Results

Identification of familial BE/EAC-associated susceptibility variants in VSIG10L

In follow-up to our previous report¹⁴, here we determined the extent of VSIG10L susceptibility variants associated with the disease by targeted sequencing of VSIG10L coding regions in 684 blood DNA samples, banked from BE/EAC affected and unaffected relatives from 302 families, accrued through an active multi-center familial BE registry^8,14,15. We found additional germline VSIG10L susceptibility variants including: a rare deleterious frameshift deletion (dbSNP: rs1185522503, Minor Allele Frequency¹⁶: 0.0001) in a 50 year old female diagnosed with BE; a private missense variant (GRCh37/hg19/chr19:51842243: A > A/G, p.V543A) in a male diagnosed with BE at age 61; and a rare in-frame deletion (dbSNP: rs370588522, Minor allele frequency¹⁶: 0.0027) in a male diagnosed with EAC at age 82. Together, our studies in familial clusters of the disease indicated a pathogenetic link between VSIG10L and BE/EAC predisposition.

VSIG10L expression is localized to suprabasal squamous cells of the esophagus

VSIG10L is predominantly expressed in SQ cells, and its gene product encodes a membrane-bound protein with immunoglobulin (Ig)-like domains¹⁴. Nonetheless, its function in the esophagus or in other SQ tissues is hitherto unknown. We accordingly first sought to determine its expression within the stratified esophageal SQ mucosa. Given the lack of optimized VSIG10L antibodies, we developed custom RNAscope-in situ hybridization probes and subsequently assessed its expression in representative human and porcine esophagus, as well as in human SQ epithelial cells (EPC2) grown as 3D-organotypes^17,18. As shown in Fig. 1, we found VSIG10L RNA to be selectively and consistently expressed in suprabasal SQ cells, with no detectable expression in basal squamous cells, suggesting a possible role of VSIG10L in epithelial maturation.

Fig. 1: Localization of VSIG10L in esophageal squamous mucosa. — **Fig. 1: Localization of *VSIG10L* in esophageal squamous mucosa.**

Esophageal organoids from VSIG10L-mutant patient show disrupted squamous maturation

We previously reported that EPC2 3D-organotypes engineered to express the VSIG10L-S631G FBE variant exhibit dysmaturation and loss of epithelial integrity, while ultrastructural assessments of esophageal mucosa from the VSIG10L S631G-mutant patient revealed loss of desmosomes and dilated intercellular spaces particularly within the suprabasal SQ cells¹⁴. To further explore the impact of VSIG10L on the developmental dynamics of esophageal SQ cells, we generated and assessed esophageal progenitor SQ organoids derived from pluripotent stem cells (hPSC) from the VSIG10L-S631G patient. Morphologically, organoids from the VSIG10L-S631G patient showed frequent disruption of SQ epithelial stratification and maturation, in stark contrast to the normal(anticipated) growth and differentiation of SQ organoids observed in the control subject grown under the same experimental conditions. Immunohistochemistry (IHC) assessments revealed that the single layer of cells in the abnormal glandular-appearing organoids in the mutant patient to be positive for p63 (basal SQ cell marker), albeit to varying degree, suggesting these may be predominantly basal-like SQ cells (Fig. 2). Additionally, unlike in the control subject, the spherical-appearing organoids from the mutant patient often showed loss of inward epithelial differentiation gradient, with strong p63-positivity in all the cells (Fig. 2), further suggesting a perturbation in SQ maturation. Together, these findings point to VSIG10L as an essential component involved in maintaining normal SQ maturation and architecture.

Fig. 2: Impaired SQ maturation and architecture of esophageal organoids derived from VSIG10L-mutant patient. — **Fig. 2: Impaired SQ maturation and architecture of esophageal organoids derived from *VSIG10L*-mutant patient.**

Mice mutant for Vsig10l exhibit ultrastructural and molecular abnormalities in the squamous forestomach

Given our above and prior¹⁴ observations implying a potential role of VSIG10L in sustaining SQ homeostasis, we next sought to interrogate the pathogenicity of familial BE-associated VSIG10L variants, in vivo. Accordingly, we generated the following human-orthologous germline Vsig10l-mutant murine models on a C57Bl/6 J background: 1) Based on the human FBE variant (VSIG10L-S631G¹⁴), we generated mice carrying the orthologous Vsig10l-S516G missense mutation, mapping to the highly conserved Serine residue within the Ig-like domain¹⁴; and 2) Based on the deleterious frameshift variant (rs1185522503) identified in one of our familial BE kindreds mentioned above, we additionally generated mice that were null/knockout (KO) for Vsig10l.

First, similar to our observations in human and porcine tissues (Fig. 1), we found murine Vsig10l to be also selectively expressed in the subprabasal cells of the SQ mucosa (Fig. 3a). As BE typically develops in the distal portion of the esophagus contiguous with the gastro-esophageal (SQ-columnar) junction¹, we next assessed for potential ultrastructural changes within the SQ mucosa of the forestomach in the Vsig10l-mutant mice, using Transmission Electron Microscopy (TEM). Both S516G and KO mice revealed a marked reduction in desmosomes in the suprabasal SQ cell layer where VSIG10L is expressed (Fig. 3b). Importantly, our findings in the Vsig10l-mutant mice are remarkably consistent with the ultrastructural changes we observed in the esophagus of familial BE patient carrying the orthologous germline VSIG10L S631G variant¹⁴, suggesting a potential role of VSIG10L in maintaining epithelial integrity that is conserved across species. To further understand the molecular programs impacted by Vsig10l disruption, we performed Spatial Transcriptomic Profiling (STP) using formalin-fixed and paraffin–embedded (FFPE) tissues derived from the SQ forestomach of representative wild type and Vsig10l-mutant mice (Fig. 3c). Subsequent gene set enrichment analysis of STP profiles revealed a significant disruption of cell structure and differentiation programs in the SQ mucosa of both S516G and KO mice (Fig. 3c). To orthogonally evaluate our TEM and STP findings, we assessed the expression of Desmogleins (Dsg1/3), members of the cadherin gene family and key components of desmosomes involved in cell-cell adhesion and epidermal cell differentiation^19,20, in an independent set of wild type and Vsig10l-mutant mice. Immunohistochemistry (IHC) analyses of FFPE SQ tissues indeed showed a reduction of Dsg1 protein in S516G-mutant mice, with a more pronounced repression of both Dsg1 and Dsg3 proteins in the KO mice, compared to the wild type (Fig. 3d). Collectively, these findings add further support to the role of VSIG10L in maintaining SQ epithelial integrity and maturation.

Fig. 3: Perturbation of structural and differentiation programs in the SQ forestomach of Vsig10l-mutant mice. — **Fig. 3: Perturbation of structural and differentiation programs in the SQ forestomach of *Vsig10l-*mutant mice.**

Of note, in analyzing the STP data, we explored whether Vsig10l disruption additionally leads to perturbations in downstream effectors/signaling pathways, using our in-house developed computational framework, InFlo^18,21,22. While no significant changes in canonical signaling pathways or large signaling networks were observed, few individual sub-networks showed altered activities in the Vsig10l-mutant mice compared to wild type (Supplementary Fig. 1). While some of these differentially-activated components such as Notch, Bmp, Smad have been implicated in BE/EAC pathobiology²³, characterizing their functional relationship with VSIG10L (direct or indirect) and the broader significance of such changes in these specific nodes/components require further in-depth investigations.

Vsig10l-mutant mice develop BE-like mucinous metaplasia lesions upon chronic exposure to reflux-associated injury

Since factors disrupting epithelial homeostasis can render the esophagus more susceptible to GERD injury and BE pathogenesis^7,24,25, we posited Vsig10l-mutant mice may exhibit an inherent propensity to developing BE-like pathologies upon exposure to deoxycholate (DCA), a key bile acid involved in reflux injury and a risk factor for BE^26,27,28,29. Accordingly, wild type and Vsig10l-mutant mice were fed either standard diet or diet supplemented with 0.2% DCA, and followed longitudinally for a period of up to 24 months. Mice were then sacrificed, and esophageal, forestomach contiguous with the SQ-columnar junction, and gastric tissues were harvested. Respective FFPE tissue sections were subsequently subjected to histopathological examination. Tissues were primarily assessed for the presence of BE-like lesions, hereafter referred to as Barrett’s-like mucinous metaplasia (BEMM), by a gastrointestinal pathologist (J.E.W) who was blinded to the sample genotypes. Subsequently, the incidences of BEMM lesions in mice were enumerated across respective heterozygous and homozygous Vsig10l genotypes. While no noticeable pathologies were observed in the standard diet group, the vast majority (70%–100%) of Vsig10l-mutant mice on DCA diet developed BEMM lesions at the SQ-columnar junction in the forestomach, significantly different from the infrequent diminutive lesions developing in ~20% of wild type mice (Fig. 4). Importantly, BEMM lesions developing in Vsig10l-mutant mice were also qualitatively quite distinct than those developing in wild type; i.e, BEMM lesions in the Vsig10l-mutant mice were more exacerbated and extensive, unlike the occasional and minor / restricted glandular changes observed in the wild type mice (Fig. 5). Beyond histomorphometric similarities, BEMM lesions in Vsig10l-mutant mice exhibited molecular features that are characteristic of human BE, including: induction of intestinal-type acidic mucins^30,31,32; expression of BE-associated mucin, Mucin 6 (Muc6)^33,34,35; induction of Trefoil Factor 3 (Tff3), a BE-associated trefoil protein and a marker of established intestinal columnar metaplasia and true goblet cells^36,37; as well as SRY-Box Transcription Factor 9 (Sox9), a key transcription factor implicated in BE pathogenesis that drives columnar differentiation of esophageal SQ epithelium³⁸ (Fig. 5). Also, similar to human BE, BEMM lesions in these mice were negative for the SQ marker, p63 (Fig. 5). We further note that no such abnormal lesions or gross histologic changes were apparent elsewhere in the esophagus proper in the Vsig10l-mutant mice. Collectively, these findings underscore the pathogenicity of FBE-associated VSIG10L susceptibility variants in facilitating BE development.

Fig. 4: Augmentation of Barrett’s-like Mucinous Metaplasia (BEMM) at the SQ-columnar junction in Vsig10l-mutant mice. — **Fig. 4: Augmentation of Barrett’s-like Mucinous Metaplasia (BEMM) at the SQ-columnar junction in *Vsig10l*-mutant mice.**

Fig. 5: BEMM lesions in Vsig10l-mutant mice recapitulate the histologic and molecular characteristics of human BE. — **Fig. 5: BEMM lesions in *Vsig10l*-mutant mice recapitulate the histologic and molecular characteristics of human BE.**

Esophageal SQ mucosa from GERD patients reveal a loss of VSIG10L expression

As injury from chronic reflux is a key risk factor for the onset of BE^4,5,6, we further sought to conversely determine whether GERD-associated injury to esophageal SQ mucosa can impact VSIG10L expression. Accordingly, we accrued a random set of snap-frozen distal esophageal SQ tissue biopsies from non-familial patients with GERD, and subsequently assessed VSIG10L RNA expression using real-time qPCR. Of note, erosive or ulcerative esophagitis cases were excluded from this analysis. Compared to a random cohort of non-GERD subjects, esophageal tissues from GERD patients showed a significantly lower VSIG10L expression (~3-fold, P = 0.008), while no such differences were observed in TP63 (SQ marker) RNA between the two cohorts (Fig. 6a). To further orthogonally assess VSIG10L expression in the context of GERD, we performed RNAscope-in situ hybridization in distal esophageal FFPE tissue sections, derived from an independent set of five GERD patients and two control subjects that were available for testing. In stark contrast to healthy / normal SQ epithelia, we found a profound reduction of VSIG10L expression or a near-all depletion of VSIG10L-positive differentiation gradient in the stratified SQ layer of GERD-associated reactive esophageal mucosa (Fig. 6b). As anticipated, we observed an expansion of basal-like immature SQ cells expressing p63 particularly in these reactive mucosal regions from GERD patients (Fig. 6b). Taken together, these findings provocatively suggest that GERD-associated disruption of VSIG10L dynamics in the esophageal mucosa may be one of the early molecular changes by which reflux injury impairs SQ homeostasis and potentially enhances the risk of further BE development.

Fig. 6: Chronic reflux injury suppresses VSIG10L expression in the distal esophagus. — **Fig. 6: Chronic reflux injury suppresses *VSIG10L* expression in the distal esophagus.**

Discussion

The cellular origins of BE are likely multifaceted, with several sources including esophageal SQ cells being suggested as potential BE progenitors^39,40. In line with this, prior genome-wide association and our familial studies have identified a pathogenetic correlation between genes involved in maintaining esophageal SQ integrity/maturation and risk of BE/EAC development^14,41,42. Our prior¹⁴ and current studies on VSIG10L in human tissues, relevant ex vivo/in vitro models, and Vsig10l-mutant mice now provide strong evidence underscoring its essential role in maintaining SQ maturation and integrity, and per se, point to the likely pathogenic role of FBE-associated VSIG10L genetic variants. Further, our observation of BE-like pathologies occurring only in the presence of DCA in the Vsig10l-mutant mice suggest that disruption in SQ homeostasis caused by these mutations produce a risky field, and over time, in the presence of chronic GERD injury with concomitant reflux of bile acids, promote BE pathogenesis. Alternatively, inherited or acquired defects in VSIG10L may impair normal healing of reflux-associated injury to SQ mucosa in at-risk individuals, consequently facilitating BE predisposition. Taken together, our findings suggest a plausible hypothesis where a perturbation in SQ homeostasis, much like that observed in GERD, may be one of the key initial processes in the development of BE. In this regard, inherited defects in VSIG10L could disrupt epithelial homeostasis, and render the SQ mucosa more prone to reflux injury and/or abnormal healing following injury, thus enhancing risk of BE development (Fig. 7). In the absence of such inherent predisposition, homeostasis is often restored due to normal healing of the injured esophagus; however, in certain instances, GERD-induced injury to SQ mucosa, concomitant with acquired VSIG10L disruption and additional genetic/epigenetic alterations, could potentially hinder normal healing and promote BE development (Fig. 7).

**Fig. 7: A hypothetical representation on the potential role of VSIG10L in BE pathobiology.**

In regard to Barrett’s esophagus and related neoplasia, we would also like to emphasize that existing in vitro/ex vivo experimental models have significant conceptual and technical limitations that preclude mimicking the pathogenesis of a complex disorder like BE. Furthermore, unlike other common gastrointestinal cancers, there are certain limitations to consider when utilizing surrogate animal models for studying BE/EAC. First, contrary to humans, esophageal mucosa in mice are keratinized, lack submucosal glands, and the stratified SQ epithelium extends from esophagus into mouse forestomach^43,44,45. These anatomical distinctions may pose challenges in fully capturing the complexity of human gastroesophageal (patho)biology in mice. In fact, the small number of murine BE models available to date do not robustly mimic human disease, and furthermore were not based on genetic defects pertinent to BE pathogenesis and predisposition in humans^43,44,45. Second, it remains unclear why BEMM lesions occur exclusively at the SQ-columnar junction and not elsewhere in the esophagus. Our findings are also in line with the IL1β-mediated inflammatory murine model where pathologic changes were restricted to the SQ-columnar junction⁴⁶. It is likely that the SQ-columnar (gastro-esophageal) junction may remain the primary site for reflux injury allowing the backflow of stomach acid resulting in metaplastic changes when compared to the esophagus, or that cellular heterogeneity in esophagus may underlie differential response to reflux injury along the length of esophagus compared to SQ-columnar junction. Prior studies have also proposed transitional cells at the SQ-columnar junction as a potential source of BE progenitors⁴⁷. It is possible that these cells at the SQ-columnar transitional zone are inherently more plastic to intrinsic or extrinsic stresses, and future studies are indeed warranted to elucidate these lines of investigations. Third, while our familial studies show association of germline VSIG10L variants with risk of BE as well as EAC development¹⁴, we did not observe any cancers in the Vsig10l-mutant mice. This lack of a cancer phenotype is consistent with available animal models in this disease context^43,44,45. It is possible that longer follow-up studies, additional genetic, epigenetic, mutagen, and/or dietary changes need to be considered to facilitate the development of cancer in mice. Also, VSIG10L remains largely uncharacterized, and our prior¹⁴ and current translational investigations were predominantly geared towards identifying VSIG10L susceptibility variants and determining their pathogenicity and biologic consequences, a critically-important step in ascertaining causality. Further comprehensive studies are indeed needed to fully decipher the biochemical and regulatory aspects of VSIG10L.

The discovery of pathogenic variants in genes such as APC and BRCA1/2 from studies of rare families have led to key insights into the molecular pathogenesis of colorectal and breast cancers. Similarly, our discovery of genes involved in BE/EAC predisposition^14,48, such as VSIG10L, from studies of FBE families should provide critical molecular insights into metaplasia-dysplasia-cancer progression, identify targets for developing chemopreventive/therapeutic drugs, and enable development of genetic tests for early screening for BE/EAC susceptibility. Moreover, the human-orthologous Vsig10l-mutant murine models we developed here should provide a more relevant physiologic system to study disease pathogenesis as well as for interrogating potential dietary and/or chemical modulators associated with BE development, progression, and/or prevention.

Methods

Our research study complies with relevant ethical regulations. Written informed consent was obtained from all donors for use of their samples and clinical data in the present study. All human protocols were approved by University Hospitals Cleveland Medical Center Institutional Review Board (IRB) for human investigations (CASE 3207 CC301) and Duke GI Tissue Repository (protocol number; 00001662), adherent to the principles outlined in the Declaration of Helsinki. PBMC-derived human pluripotent stem cells from the VSIG10L S631G mutant patient and control subject were obtained under an IRB-approved protocol (CASE 3207 CC301) with written consent, and included MTA agreements where appropriate. Archived Porcine tissues were accessed through North Carolina State University (NCSU), approved by NCSU Institutional Animal Care and Use Committee-approved protocol (NCSU 13-116-B). All mouse studies were approved by Case Western Reserve University Institutional Animal care and Use Committee (IACUC), and conform to the ARRIVE 2.0⁴⁹ guidelines. A flow diagram illustrating all the experiments performed and reported in the current study is provided in Supplementary Fig. 2.

Familial patients and VSIG10L DNA sequencing

Probands with BE or EAC as well as unaffected controls were recruited and gave written informed consent for collection of biopsy tissues and blood for research as part of the Barrett’s Esophagus Translational Network (BETRNet) Consortium using a consent and biobanking protocol (protocol number, CASE 3207 CC30) approved by the Institutional Review Board for Human Investigation at University Hospitals Cleveland Medical Center and collaborating institutions^{8,12,13,14,15}, adherent to the principles outlined in the Declaration of Helsinki. The observational study is registered at clinicaltrials.gov, NCT00288119. Study subjects were given a questionnaire that collects information about BE and EAC risk factors along with family history. Study subjects provide written consent to use banked biospecimens for genetic studies and other future research. Permission is also obtained from probands to contact their relatives. Histologic diagnosis for family members reported to have BE or EAC is confirmed by review of records whenever available. Family members who had no prior esophagogastroduodenoscopy (EGD) were offered screening. Blood or saliva is banked from probands and family members who are alive and consent to the study. Study subjects gave written consent and blood lymphocytes were collected, immortalized, and banked at the Rutgers University DNA Repository (RUCDR) as a source of germline DNA from all family members who had screening endoscopy. For deceased family members, permission is obtained from nearest living relatives to obtain formalin fixed paraffin embedded (FFPE) biopsy tissues from treating hospitals. Germline DNA was extracted from blood, immortalized lymphocytes, saliva, or FFPE tissues for subsequent sequencing. Targeted capture and DNA resequencing of VSIG10L exons in 684 samples, belonging to 302 families, was performed by Novogene (Sacramento, CA). Of the 684 subjects, 428 were men and 256 women (self-reported), mean age was 61.5 years (range; 14–100 yrs), and all familial BE subjects were of European ancestry. Only samples passing internal quality controls were included in the analysis. Raw 100-bp FASTQ reads were aligned to the human reference genome (hg19) using the Burrows-Wheeler Aligner (BWA-v0.7.17)⁵⁰. Alignment quality was assessed with GATK Picard tools (v2.18.12), followed by pre-processing of BAM files with a custom script utilizing GATK⁵¹ to mark duplicates, recalibrate base quality scores, and realign indels. For variant calling, we used two independent callers; UnifiedGenotyper⁵² and HaplotypeCaller⁵³ from the GATK Suite. Variant calls were filtered to exclude those with coverage below 30 reads or an alternate base frequency under 0.1. Filtered variants were annotated using Oncotator (v1.9.1.0)⁵⁴, and were further analyzed for population-level allele frequencies using the ExAC⁵⁵ and gnomAD (v4.1.0)⁵⁶ databases. All rare/private variants were further manually reviewed using Integrative Genomics Viewer⁵⁷. Lastly, selected variants were orthogonally confirmed in fresh DNA aliquots from respective samples using direct Sanger sequencing.

Porcine tissue procurement

Archival porcine esophageal tissue blocks of normal squamous epithelium were accessed for the VSIG10L localization assays. All porcine tissues were originally derived from Yorkshire crossbred pigs (Sus scrofa) of either sex, weighing approximately 35 kg, and cared for according to North Carolina State University Institutional Animal Care and Use Committee-approved protocol (NCSU 13-116-B) and as set forth in the Guide for the Care and Use of Laboratory Animals, published by the National Institutes of Health. Porcine tissues were collected by North Carolina State University Large Animal Models Core of the Center for Gastrointestinal Biology and Disease (CGIBD) under veterinary supervision⁵⁸. For euthanasia, initial sedation was provided with xylazine-ketamine injection, and then animals were euthanized with pentobarbital (60 mg/kg IV) and clinically assessed by veterinary staff to confirm death prior to collection of esophageal tissues that were subsequently used for histologic analyses.

Generation of Vsig10l mutant mice

Vsig10l S516G missense mutant (orthologous to the human VSIG10L variant S631G¹⁴) and Vsig10l knockout (KO) (targeted deletion of Exon 1- Exon 10) mice were generated on a C57Bl/6 J (The Jackson Laboratory, Bar Harbor, ME) genetic background (Strain no:000664), using standard CRISPR-Cas9 methodology. Briefly, single guide RNAs (sgRNAs) for generating murine Vsig10l (Gene ID: 75690) S516G and KO were selected using the CRISPR design tool (http://crispr.mit.edu/)⁵⁹. In the end, the following sgRNA sequences (5’-3’) were selected for the missense S516G mutant (CGACTACAGCTTAGCCAGGA on exon 6), and for the KO (upstream-ACCTGGGACAATGCAAGCTG; downstream-AGGACTGGACCCTAAGAGTG). Cleavage efficiency of the selected sgRNAs were confirmed using the Guide-it Complete sgRNA Screening System (TakaraBio USA Inc, San Jose, CA; cat. no. 632636), with C57Bl/6 J mouse genomic DNA as the template. PAGE-purified sgRNAs along with Cas9 protein (PNA Bio, CA) were microinjected into fertilized eggs and implanted into pseudopregnant females to generate mice with precise genomic edits at specific loci. For the S516G mutant, the following PAGE-purified donor ultramer was co-injected: 5’-CTCGGCAAGGACGGCCCCTGGCTCCAGGTGGTGGGGGCCGACTACAGCTTGGCCAAGATGGCCGAAAGCTCCTCATCAACAACTTCAGCCTGGATTGGGA. Tail DNA extracted from the pups were confirmed for genomic editing using the Illumina Miseq platform (San Diego, CA) for founder mice. F1 founder mice were selected following confirmation of germline transmission by backcrossing with wild type C57Bl/6 J mice. The above CRISPR-based Vsig10l mutant mice were generated in collaboration with the Transgenic and Targeting facility at Case Western Reserve University (CWRU). All animal studies were approved by Case Western Reserve University Institutional Animal care and Use Committee (IACUC), under the protocol number 2019-0082, and were handled in compliance with the 3Rs (Replacement, Reduction and Refinement) ethics guidelines. All wild type and Vsig10l mutant mice were housed in the CWRU animal core facility and maintained on a standard 12 h:12 h light-dark cycle, 70–74 °F temperature, and ~50% humidity. The Vsig10l-mutant mouse models developed here will be shared with other investigators upon request and following review by the corresponding author to ensure that distribution complies with ethical, institutional, and material-transfer guidelines.

Breeding and genotyping of Vsig10l mutant mice

Homozygous Vsig10l mutant mice (S516G and KO) were viable and exhibited fair breeding performances. Genotyping was performed using DNA isolated from tail digests. Briefly, mutant mice for S516G were genotyped using PCR-Sanger sequencing with primer sequences on Exon 6 (forward; TGCTGCTCCAGCCCATAGT, reverse; TGGACCTGAGAGAGGGTGATT, amplicon size of 361 bp). Vsig10l KO mice were genotyped using conventional PCR amplification with primer sequences upstream of Exon 1 (forward; TGGGCTTCTCCATACAACCTC) and downstream of Exon 10 (reverse; TGCCAACCACATTCATCCGT) resulting in an amplicon size of 401 bp for the deleted region. Genotypes of heterozygous mice (-/+) were confirmed using the above primers as well as PCR amplification of the wild type Exon 9 region (forward; GCTCACCCCACCAGCAAAAA, reverse; ACAGTGGGAGGCAACGACAC), resulting in 401 bp and 139 bp products. PCR conditions included initial denaturation at 95 °C for 4 min, followed by 40 cycles of 95 °C for 30 sec, 66 °C (S516G) or 58 °C (KO) annealing for 45 s, and 72 °C extension for 45 sec. All animal procedures were approved by CWRU in accordance with Institutional Animal care and Use Committee (IACUC) and followed the National Institutes of Health guidelines.

Animal diet and tissue harvest

Animals were fed either standard irradiated diet containing 12 kcal% fat with Palm Oil (Research Diet Inc, NJ; cat. no. 19102101), or standard irradiated diet containing 12 kcal% fat with Palm Oil supplemented with 0.2% Deoxycholic Acid (Millipore Sigma-Aldrich, cat no. D2510; Research Diet Inc; cat. no. 19102102) starting at 5 weeks of age and for a period of 24 months. Animals within each genotype were randomly assigned to the respective standard or standard plus DCA diet groups. The diets were stored in cold dry place. Mice were allowed to have ad libitum access to respective diets (replenished weekly), and drinking water was supplied through standard sipper tubes during the entire duration of the study. At the end of the study, esophagus and forestomach from each mouse were isolated, formalin-fixed (10% neutral buffer) and paraffin–embedded (FFPE) for subsequent histopathologic and molecular assessments. The overall sex distribution of the mice available for final analyses (N = 46) were 50% male and 50% female; wild type (50% male), Vsig10l S516G/+ (58% male), Vsig10l S516G/S516G (44% male), Vsig10l −/+ (57% male), Vsig10l −/− (38% male). As genetic predisposition can enhance BE/EAC risk in both men and women^8,15,60, data from both male and female mice in respective genotypes were pooled for all analysis. All animal experiments were conducted in accordance with the ARRIVE 2.0 guidelines⁴⁹.

EPC2 squamous 3D-Organotypic culture model

EPC2 human esophageal squamous esophageal cell line (EPC2), originally derived from a male non-BE patient^14,18,61, was gifted to us by Dr. John P. Lynch MD, Ph.D at University of Pennsylvania. Briefly, EPC2 cells were grown in serum free keratinocyte-SFM media (Thermo Fisher scientific, Waltham, MA; cat no. 17005042), supplemented with Bovine Pituitary Extract (BPE, Thermo Fisher scientific; cat no. 13028-014) and human recombinant epidermal growth factor (rEGF, Thermo Fisher scientific; cat no. 10450-013), and maintained at 37 °C and 5% CO₂. Cells were tested for authenticity using short tandem repeat genotyping and were screened periodically for mycoplasma contamination. EPC2 3D-organotypes were generated as follows: Transwell inserts were added to deep-well six-well plates. 3D collagen/Matrigel matrices (bottom and top layer in the transwell insert) were prepared on Day1. The bottom layer was prepared using 10X EMEM (BioWhittaker, Walkersville, MD; cat no. 12-684 F), Fetal Bovine serum (Hyclone, Logan, UT; cat no. SH30088.3), L-glutamine (Cellgro, Corning, NY; cat no. 25-005-CI), sodium bicarbonate (BioWhittaker; cat no. 17-613E) and high concentration (2.2 mg/ml) collagen rat tail (Corning; cat no. 354249). The reagents were mixed well and incubated at 37 °C for 20 min to let the matrix solidify. The top layer of the insert was prepared by mixing 10X EMEM, FBS, L-glutamine, Sodium bicarbonate, collagen, matrigel (Corning; cat no. 354234), and 7.5 × 104 human esophageal fibroblasts (ScienCell, Carlsbad, CA; cat. no. 2730), and then added to the bottom of the transwell. On Day7, media was changed to Dulbecco’s Modified Eagles Medium (Sigma-Aldrich, St. Louis, MO; cat no. 51441 C) and Ham’s F-12 (Gibco, Grand Island, NY; cat no. 11765-054) in a 3:1 ratio and added to the bottom and top of the transwell and incubated for 1 h at 37 °C. Media was then removed from the top and approximately 1.5 × 106 EPC2 cells were added as droplets. After a 2-hour incubation at 37 °C, Epidermalization I media was added to the plate supplemented with the following: DMEM, F-12, L-glutamine, Hydrocortisone (Sigma-Aldrich, cat no. H0888), ITES (500x) (Biowhittaker; cat no. 17839Z), O-phoshory-ethanolamine (Sigma-Aldrich; cat no. P0503), adenine (Sigma-Aldrich; cat no. A9795), progesterone (Sigma-Aldrich; cat no. P8783), triiodothyronine (Sigma-Aldrich; cat no. T5516), newborn calf serum chelated (Hyclone; cat no. SH3011802). On Day 11, media was removed and the Epidermalization II medium was added to the bottom of the plate only, allowing the epithelial cells to differentiate at the air-liquid interface. Epidermalization I and II media have similar components, except that no progesterone is added to Epidermalization II media. On day 17 organotype cultures were harvested by fixing in 10% formaldehyde (Thermo Fisher Scientific; cat.no. SF100-4), and later were paraffin-embedded for further histopathological analysis.

RNAscope In Situ Hybridization

RNAscope ISH was performed on 5 μM FFPE sections⁶² derived from human, porcine and mouse tissues, using the RNAscope 2.5 HD Single-plex Chromogenic Assay kit as per the manufacturer’s instructions (Advanced Cell Diagnostics, Newark, CA; cat. no. 322360). Briefly, 5 μM tissue/organoid sections were baked for 60 min at 60 °C, de-paraffinized in xylene for 5 min twice and rehydrated in 100% ethanol for 3 minutes and air dried for 5 min. The sections were then quenched with hydrogen peroxide for 10 minutes at room temperature and heat-induced RNA Scope antigen retrieval was carried out at 100-104°C for 15 minutes. Following antigen-retrieval, slides were rinsed quickly in distilled water at room temperature and dipped in 100% ethanol for 2 min and air dried for 5 min. The sections were covered with RNAscope protease plus, followed by incubation in a humidity-controlled oven for 25 min at 40 °C and rinsed in distilled water. Sections were then subjected to VSIG10L ISH with custom RNAscope-ISH probes, designed using Advanced Cell Diagnostics RNAscope probe design pipeline, against respective human (cat. no. 1086661-C1), pig (cat. no. 1161521-C1) or mouse (cat. no. 1088591-C1) species. ISH probe hybridization was carried out in a humidity-controlled oven for 120 min at 40 °C. Following hybridization, sections were washed in RNAscope 1X wash buffer atleast twice for 2 min at room temperature. Sections were subsequently processed for signal amplification using RNAscope amplification reagent 1 in a humidity-controlled oven for 30 min at 40°C. Following amplification, sections were rinsed with RNAscope 1X wash buffer atleast twice for 2 minutes at room temperature. The above step was repeated with amplification reagents 2, 3, and 4, followed by rinsing with RNAscope 1X wash buffer for each section. Sections were then incubated with amplification reagent 5 and 6 for 15-30 min at room temperature with intermittent rinsing using RNAscope 1X wash buffer atleast twice for 2 min at room temperature. Sections were then covered with Fast Red Chromagen (Advanced Cell Diagnostics; cat. no. 322360) by using a 60:1 dilution of Buffer Fast Red A: Chromagen Fast Red B for 3-5 minutes. After decanting the chromagen, 120 µl of 3,3’-Diaminobenzidine chromogen (DAB) mixture was added to each section and incubated at room temperature for 10 minutes. Sections were then rinsed in distilled water and stained with CAT Hematoxylin counter stain (Biocare Medical, Pacheco, CA; cat. no. CATHE-M) for 30 s, rinsed under running tap water for 30 s, followed by additional rinses in distilled water for 1 min atleast three times. Cell nuclei were stained with bluing reagent for one minute with TBST wash buffer and rinsed in running tap water for 30 s and dehydrated in Xylene, and cover slipped with Ecomount medium (Biocare Medical; cat. no. EM897L). Tissue/organoid sections were also stained for standard Hematoxylin and eosin (H&E) for histologic characterization in respective serial sections. Stained sections were visualized using EVOS M7000 imaging system (Thermo Fisher Scientific). All images were captured using identical settings on the EVOS M7000 imaging system, and each tissue section on a slide was imaged in its entirety using the M7000 image tile-stitching software function.

Electron microscopy

Esophageal tissues from euthanized mice were prepared for electron microscopy using the protocol previously described by us^14,63,64. Briefly, tissues were fixed with triple aldehyde-DMSO fixative for 2 h at room temperature. The specimens were thoroughly rinsed in 0.1 M phosphate buffer, pH 7.4, then post-fixed for 2 h in an unbuffered 1:1 mixture of 2% osmium tetroxide and 3% potassium ferricyanide. After rinsing with distilled water, the specimens were soaked overnight in an acidified solution of 0.25% uranyl acetate. After another rinse in distilled water, they were dehydrated in ascending concentrations of ethanol, passed through propylene oxide, and embedded in Poly/Bed resin mixture. Thin sections were sequentially stained with acidified uranyl acetate followed by a modification of Sato’s triple lead stain and examined in a FEI Tecnai Spirit (T12) transmission electron microscope with a 4k × 4k Gatan US4000 CCD camera.

Spatial Transcriptomics

The Visium Spatial Gene Expression platform from 10x Genomics was used for spatial transcriptomic profiling (STP). Briefly, esophageal FFPE tissue sections (5 μM) from wild type and Vsig10l mutant mice (with DV200 ≥ 80%) were placed within a 6.5 mm² field on a 10x Genomics gene expression slide that contains 5000 barcoded probes. Sections were deparaffinized via xylene immersion, ethanol to remove the solubilized paraffin, and then immersion in water to remove residual ethanol. The deparaffinized tissues were then stained with hematoxylin and eosin (H&E) to visualize tissue architecture. RNA sequestered by formalin fixation within the tissue is de-crosslinked by serial treatment with HCl at room temperature followed by heating at 70 °C in TE buffer pH 9.0 for 1 h. Next, cells within the tissue were permeabilized prior to RNA hybridization with whole transcriptome mouse probe panels (21k), consisting of RNA-templated ligation (RTL) probes that target the protein-coding transcriptome. Following targeted gene probe ligation, the poly-A tail from probes were then used as template for the on-surface probe priming. Probes were extended by the addition of a UMI, Spatial Barcode and partial Read 1, then released from the slide and collected for qPCR to optimize sample index PCR cycle number. Targeted gene products then underwent index PCR to ligate Illumina sequencing adapters and sample dual indices followed by final library cleanup by SPRI select size selection. Final libraries were assessed on a Tapestation 4200 and quantified by qPCR. Libraries were sequenced on Illumina NGS paired end sequencers at 25k reads/spot on an Illumina paired end, dual indexed flowcell in the format of 28x10x10×50. Data were then uploaded to analyses packages for visualization.

Gene Set Enrichment analyses (GSEA)

Spatial transcriptomics gene expression data from wild type and Vsig10l mutant mice were subjected to Gene Set Enrichment analyses (GSEA) using the fgsea package in R. This analyses aimed to pinpoint pathways and biological processes significantly enriched among the differentially expressed genes (DEGs) between the experimental groups: Wild type vs. S516G; Wild type vs. KO. Gene sets were sourced from multiple databases, including the Molecular Signatures Database (MSigDB), Gene Ontology (GO), KEGG, and Reactome, encompassing curated pathways and gene ontologies. The input for GSEA consisted of ranked gene lists based on log2 fold change values for differential expression between the aforementioned comparisons. For each analyses, GSEA calculated an enrichment score (ES) for each gene set, indicating the extent to which the genes within that set were overrepresented at the top or bottom of the ranked gene list. The significance of the ES was determined through permutation testing (1000 permutations), which yielded a normalized enrichment score (NES). We considered gene sets with a false discovery rate (FDR) q-value of <0.05 to be significantly enriched.

Immunohistochemistry

Immunohistochemical evaluation was performed using standard protocols and methods as previously described by our group^18,22. Briefly, 5 μM mouse and human tissue/organoid sections were baked for 75 min at 60 °C followed by de-paraffinization in xylene and subsequent rehydration in series of graded ethanols (100%, 95%, 70%, respectively) and rinsed in distilled water. Heat-induced antigen retrieval was carried out in a pressure cooker in citrate solution (pH 6.0) at 123 °C for 30 s and endogenous peroxidase was quenched with 3% hydrogen peroxide for 8 min. Charged proteins and endogenous IgG was blocked in background sniper solution for 20 min. Slides were incubated with the primary Dsg1 (Abcam; cat. no. ab124798, 1:1000 dilution), Dsg3 (Thermo Fisher; cat. no. BS-6585R, 1:400 dilution), Muc6 (Thermo Fisher; cat. no. PA5-79706, 1:1500 dilution), Tff3 (Thermo Fisher; cat. no. 14-4758-82, 1:5000 dilution), Sox9 (Abcam; cat. no. ab185230, 1:1000 dilution), p63 (GeneTex, cat. no. GTX102425, 1:100 dilution), or CK7 (Abcam, cat. no. ab181598, 1:50,000) overnight at 4 °C. Detection of antibodies was achieved by incubating the tissue sections with anti-mouse or anti-rabbit horseradish peroxidase (HRP) conjugated polymers for 30 minutes. Sections were stained with 3,3’-Diaminobenzidine chromogen for 5 min to visualize the antigen-antibody binding, and hematoxylin was used as a nuclear counterstain. Stained sections were visualized using the EVOS M7000 imaging system (Thermo Fisher Scientific). In parallel, FFPE sections were subjected to standard Alcian blue/Periodic Acid Schiff’s stain procedure to evaluate the presence of mucins. Briefly, 5 μM esophageal and forestomach tissue sections were deparaffinized and hydrated with distilled water. Sections were then placed in Alcian Blue (AB) pH 2.5 stain solution for 30 min at room temperature, and rinsed with deionized water. Subsequently, sections were placed in Periodic acid solution (PAS) for 5 min at room temperature, rinsed with deionized water, followed by staining with Schiff’s reagent for 15 min and rinsed with deionized water. All sections were counter stained with hematoxylin 7211 for one minute, rinsed, and followed by staining with bluing reagent for one minute. Sections were dehydrated in anhydrous alcohol followed by clearing and mounting. The acidic mucosubstances appear blue in color and the neutral polysaccharides appear purple/magenta in color. All images were captured using identical settings on the EVOS M7000 imaging system, and each tissue section on a slide was imaged in its entirety using the M7000 image tile-stitching software function. As appropriate, IHC findings were assessed on a qualitative scale for the presence or absence of signal (yes or no) in a blinded fashion.

Human PSC-derived esophageal organoids

PBMC-derived human pluripotent stem cells (hPSC) were generated from the VSIG10L S631G mutant patient who had provided written consent under the protocol approved by the Institutional Review Board for Human Investigation at the University Hospitals Cleveland Medical Center¹⁴. The control BU3 hPSC line⁶⁵, derived from a healthy male Caucasian, was purchased from Boston university stem cell core under an MTA agreement and approved informed consent. Esophageal progenitor cells (EPCs) were subsequently derived from the hPSCs as previously described⁶⁶. Briefly, hPSCs were first cultured in mTeSR plus medium (Stemcell technologies, Vancouver, BC; cat. no. 85850) on 6-well plates coated with 100x diluted Matrigel. After 24 hours, the medium was replaced with Definitive Endoderm Medium plus supplements MR and CJ (StemCell Technologies; cat. no. 05110). After additional 24 hours of culture (day 2), the media was replaced and cells incubated in Definitive Endoderm (DE) medium plus supplement CJ. At day 3, the media was replaced again with fresh DE media plus supplement CJ. At day 4, Serum-Free Differentiation (SFD) Media was prepared as following: 375 ml of reconstituted Iscove’s DMEM (Corning, Corning, NY; cat. no. 15-016-CV), 125 ml of Ham’s F-12 (Corning; cat. no.10-080-CV), 5 ml of N2 (Thermo Fisher Scientific; cat. no. 17502048), 10 ml of B27 (Thermo Fisher Scientific; cat. no. 12587010), 3.3 ml of 7.5% Bovine Albumin Fraction V Solution (Thermo Fisher Scientific; cat. no. 15260037), 19.6 μl of 11.5 M monothioglycerol (Sigma-Aldrich, St. Louis, MO; cat. no. M6145), 500 μl of L-Ascorbic acid (Sigma-Aldrich; cat. no. A92902) and 1 ml of 50 mg/ml primocin (Invitrogen, Waltham, MA; cat. no. NC9141851). At day 4, the cells were passaged into new Matrigel-coated 6-well plates as clusters and cells were further induced by culturing in the SFD medium plus 10 μM SB431542 (Selleckchem, Houston, TX; cat. no. S1067), 200 ng/ml Noggin (R&D Systems, Minneapolis, MN; cat. no. 6057-NG),100 ng/ml EGF (Peprotech, Cranbury, NJ; cat. no. AF-100-15) and 10 μM Y-2763210 (Selleckchem; cat. no. S1049) for 24 hours and the SFD medium plus 10 μM SB431542, 200 ng/ml Noggin and 100 ng/ml EGF for another 48 hours (day 5-6). Cells were maintained at 5% O2/ 90% N2/ 5% CO2 from day 1–6. To induce esophageal progenitor cell differentiation, anterior cells were cultured from day 7 to day 16 in the SFD medium plus 10 μM SB431542, 200 ng/ml Noggin and 100 ng/ml EGF. From day 16 to day 24, cells were maintained in the SFD medium plus 100 ng/ml EGF. Cells were cultured at 95% air/ 5% CO2 from day 7 onwards. On day 24, the cells were sorted using FACS to obtain EPCs. To perform cell surface marker staining, cells were disassociated with Accutase added DNase (Thermo Fisher Scientific) and 10 μM Y-2763210 and stained with PE/Cyanine7 anti-human CD326 (EpCAM) antibody (BioLegend, San Diego, CA; cat. no. 324201) in FACS buffer (1× PBS, 2% FBS, added DNase and 10 μM Y-2763210) for 1 hour with live/dead staining dye SYTOX (Thermo Fisher Scientific; cat. no. S7020) to exclude dead cells. Stained cells were analyzed using BD FACS CariaII (BD Biosciences, Franklin Lakes, NJ) and sorted EPCAM-positive cells. Sorted hPSCc-derived EPCs were counted and seeded at 20,000 cells per 50 μL Geltrex (Thermo fisher Scientific; cat. no. A1413202) per one well of a 24-well plate, and the medium was added to after Geltrex solidified. The organoid culture medium included the SFD medium, supplemented with 10 μM Y27632, 10 μM SB431542, 10 μM GSK3 inhibitor (Stem cell technologies; cat. no. CHIR99021), 20 ng/ml FGF2 and 200 ng/ml EGF. hPSC-derived EPC 3D-organoids were subsequently FFPE embedded, sectioned, and used for analysis.

Semi-quantitative PCR analysis of VSIG10L in GERD vs. non-GERD biopsy tissues

Endoscopically-normal appearing mucosal biopsies were collected from the distal 5 cm of the squamous esophagus from control patients without BE or EAC during upper endoscopy who consented under the observational study biobanking protocol approved by the Institutional Review Board for Human Investigation of the University Hospitals Cleveland Medical Center⁹. Esophageal samples from Duke University hospitals were obtained from participants who enrolled in the GI Tissue Repository, and longitudinal observational study of patients presenting for endoscopic procedures who agreed to use of excess clinical samples approved by the Institutional Review Board for Human Investigation at Duke Universtiy Medical Center (protocol number; 00001662), adherent to the principles outlined in the Declaration of Helsinki. Archival samples from research participants were accessed through CWRU and Duke BioRepository & Precision Pathology Center (BRPC). Clinical data were collected and updated, including demographics, gastrointestinal symptoms, endoscopic and pathologic findings as previously described⁶⁷. Chronic GERD was defined as the presence of at least weekly heartburn or regurgitation for at least five years as assessed by the Mayo gastroesophageal reflux questionnaire (GERQ)⁶⁸. Erosive or ulcerative esophagitis cases were not included. Non-GERD was defined as either none or less than once a month heartburn or regurgitation for less than five years. All biopsy tissues were snap-frozen at the site of collection. Among the GERD subjects (n = 23), 77% were men and 23% were women (self-reported), and the mean age of the sampled cohort at the time of diagnosis was 54.7 years (range; 28-77 yrs). 92% of GERD subjects were of European ancestry and 8% Asians. All but 4 of the subjects with GERD were on proton pump inhibitors or histamine-2 blockers. For the non-GERD control cohort (n = 24), 73% were men and 27% were women (self-reported), and the mean age of the sampled cohort was 60.1 years (range; 41-80 yrs). 96% of non-GERD control subjects were of European ancestry and 4% African Americans. Total RNA was extracted from respective distal esophageal squamous biopsies using RNeasy Plus Mini kit (Qiagen, Germantown, MD; cat. no. 74134,). Subsequently, 0.5-1 μg of total RNA was reverse-transcribed using Superscript IV First-Strand Synthesis (Thermo Fisher Scientific; cat. no. 18091) according to the manufacturer’s protocol. qPCR of VSIG10L (Qiagen; cat. no. QT02451393), TP63 (Qiagen; cat. no. QT02424051), and beta-2-microglobulin (B2M) (Qiagen; cat. no. QT00088935) were performed using iQ SYBR Green Supermix (Bio-Rad Laboratories, Hercules, CA; cat. no. 170-8887) on the CFX96 system (Bio-Rad). TP63 was used as a control for SQ epithelial content in the biopsy tissues and B2M was used as an endogenous control for RNA. Each qPCR reaction was carried out in triplicates and the mean expression levels across the triplicates were normalized to the mean expression values of B2M using the ΔCt method. A two-tailed non-parametric Mann-Whitney U test was used to determine significant differences in expression between GERD vs non-GERD tissues.

Statistics & Reproducibility

Data analyses and pertinent statistical tests are outlined in respective Methods sub-sections above. Sample size estimations or randomization were not applicable for human genetic studies, as all individuals that were accrued were sequenced. The study focuses on identifying BE susceptibility variants in VSIG10L in affected families. Unaffected/healthy family relatives were sequenced where available. To assess the minor allele frequencies of the detected VSIG10L variants in families, large-scale population databases like gnomAD and ExAC were used. Results from gene expression studies in human samples were estimated using non-parametric tests. For animal studies, assuming 80% power and a significance level of 0.05, 6 mice in each group will enable detecting ≥50% metaplasia incidence (qualitative estimates) with a 95% CI of±28.1. For diet studies, respective age-matched genotype mice were randomly assigned to the standard or DCA diet groups, and dietary interventions were initiated at the same age across genotypes. Vsig10l-mutant genotypes were compared to respective wild type littermates in all instances. Results from animal expression studies were also estimated using non-parametric tests, and additional multiple testing corrections were performed for STP datasets where appropriate. Where appropriate, biologic/technical replicates were included in the experiments to confirm reproducibility of the results. As stated before, mouse genotypes were blinded for all subsequent histopathologic and electron microscopy assessments. No data were excluded for either human or animal studies.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

All data supporting the findings of this study are available within the manuscript. Respective publicly-accessible databases (such as gnomAD and ExAC) were cited within the main text. Sharing of VSIG10L raw DNA sequencing data from familial subjects will be considered following formal written request by investigators to the corresponding author. All requests pertaining to the data in the current study will be processed in 3-5 weeks from the date of request. All data access requests will undergo in-depth review by University Hospitals Cleveland Medical Center Institutional Review Board (and by a genetic counselor) to ensure that distribution complies with ethical, institutional, and material-transfer guidelines, while ensuring strict confidentiality of the familial relationships. Source data are provided with this paper.

References

Stawinski, P. M., Dziadkowiec, K. N., Kuo, L. A., Echavarria, J., & Saligram, S. Barrett’s esophagus: an updated review. Diagnostics 13, 321 (2023).
Siegel, R. L., Kratzer, T. B., Giaquinto, A. N., Sung, H. & Jemal, A. Cancer statistics, 2025. CA Cancer J. Clin. 75, 10–45 (2025).
PubMed PubMed Central Google Scholar
Rubenstein, J. H. & Shaheen, N. J. Epidemiology, diagnosis, and management of esophageal adenocarcinoma. Gastroenterology 149, 302–317 e301 (2015).
Article PubMed PubMed Central Google Scholar
Shaheen, N. J., Falk, G. W., Iyer, P. G. & Gerson, L. B. American College of G. ACG Clinical Guideline: diagnosis and management of Barrett’s esophagus. Am. J. Gastroenterol. 111, 30–50; quiz 51 (2016).
Article CAS PubMed Google Scholar
American Gastroenterological, A., Spechler, S. J., Sharma, P., Souza, R. F., Inadomi, J. M. & Shaheen, N. J. American Gastroenterological Association medical position statement on the management of Barrett’s esophagus. Gastroenterology 140, 1084–1091 (2011).
Article Google Scholar
Spechler, S. J. Clinical practice. Barrett’s Esophagus. N. Engl. J. Med. 346, 836–842 (2002).
Article PubMed Google Scholar
Que, J., Garman, K. S., Souza, R. F. & Spechler, S. J. Pathogenesis and cells of origin of Barrett’s esophagus. Gastroenterology 157, 349–364 e341 (2019).
Article PubMed PubMed Central Google Scholar
Chak, A. et al. Familial aggregation of Barrett’s oesophagus, oesophageal adenocarcinoma, and oesophagogastric junctional adenocarcinoma in Caucasian adults. Gut 51, 323–328 (2002).
Article CAS PubMed PubMed Central Google Scholar
Chak, A. et al. Identification of Barrett’s esophagus in relatives by endoscopic screening. Am. J. Gastroenterol. 99, 2107–2114 (2004).
Article ADS PubMed Google Scholar
Juhasz, A. et al. Prevalence of Barrett esophagus in first-degree relatives of patients with esophageal adenocarcinoma. J. Clin. Gastroenterol. 45, 867–871 (2011).
Article PubMed PubMed Central Google Scholar
Sun, X. et al. Linkage and related analyses of Barrett’s esophagus and its associated adenocarcinomas. Mol. Genet Genom. Med 4, 407–419 (2016).
Article CAS Google Scholar
Sun, X. et al. Predicting Barrett’s esophagus in families: an esophagus translational research network (BETRNet) model fitting clinical data to a familial paradigm. Cancer Epidemiol. Biomark. Prev. 25, 727–735 (2016).
Article Google Scholar
Sun, X. et al. A segregation analysis of Barrett’s esophagus and associated adenocarcinomas. Cancer Epidemiol. Biomark. Prev. 19, 666–674 (2010).
Article Google Scholar
Fecteau, R. E. et al. Association between germline mutation in VSIG10L and familial barrett neoplasia. JAMA Oncol. 2, 1333–1339 (2016).
Article PubMed PubMed Central Google Scholar
Chak, A. et al. Familiality in Barrett’s esophagus, adenocarcinoma of the esophagus, and adenocarcinoma of the gastroesophageal junction. Cancer Epidemiol. Biomark. Prev. 15, 1668–1673 (2006).
Article Google Scholar
Karczewski, K. J. et al. The mutational constraint spectrum quantified from variation in 141,456 humans. Nature 581, 434–443 (2020).
Article ADS CAS PubMed PubMed Central Google Scholar
Harada, H. et al. Telomerase induces immortalization of human esophageal keratinocytes without p16INK4a inactivation. Mol. Cancer Res 1, 729–738 (2003).
CAS PubMed Google Scholar
Venkitachalam, S. et al. The ephrin B2 receptor tyrosine kinase is a regulator of proto-oncogene MYC and molecular programs central to Barrett’s neoplasia. Gastroenterology 163, 1228–1241 (2022).
Article CAS PubMed PubMed Central Google Scholar
Kowalczyk, A. P. & Green, K. J. Structure, function, and regulation of desmosomes. Prog. Mol. Biol. Transl. Sci. 116, 95–118 (2013).
Article CAS PubMed PubMed Central Google Scholar
Green, K. J. & Simpson, C. L. Desmosomes: new perspectives on a classic. J. Investig. Dermatol. 127, 2499–2515 (2007).
Article CAS PubMed Google Scholar
Dimitrova, N. et al. InFlo: a novel systems biology framework identifies cAMP-CREB1 axis as a key modulator of platinum resistance in ovarian cancer. Oncogene 36, 2472–2482 (2017).
Article CAS PubMed Google Scholar
Blum, A. E. et al. Systems biology analyses show hyperactivation of transforming growth factor-beta and JNK signaling pathways in esophageal cancer. Gastroenterology 156, 1761–1774 (2019).
Article CAS PubMed PubMed Central Google Scholar
Maslenkina K. et al. Signaling pathways in the pathogenesis of Barrett’s esophagus and esophageal adenocarcinoma. Int. J. Mol. Sci. 24, 9304 (2023).
Fitzgerald, R. C. Molecular basis of Barrett’s oesophagus and oesophageal adenocarcinoma. Gut 55, 1810–1820 (2006).
Article CAS PubMed PubMed Central Google Scholar
Tobey, N. A., Carson, J. L., Alkiek, R. A. & Orlando, R. C. Dilated intercellular spaces: a morphological feature of acid reflux–damaged human esophageal epithelium. Gastroenterology 111, 1200–1205 (1996).
Article CAS PubMed Google Scholar
Souza, R. F. From reflux esophagitis to esophageal adenocarcinoma. Dig. Dis. 34, 483–490 (2016).
Article PubMed PubMed Central Google Scholar
Masaoka, T. & Suzuki, H. Does bile reflux influence the progression of Barrett’s esophagus to adenocarcinoma? (Gastroenterology 2013;145:1300-1311). J. Neurogastroenterol. Motil. 20, 124–126 (2014).
Article PubMed Google Scholar
Quante, M., Abrams, J. A., Lee, Y. & Wang, T. C. Barrett esophagus: what a mouse model can teach us about human disease. Cell Cycle 11, 4328–4338 (2012).
Article CAS PubMed PubMed Central Google Scholar
Prichard, D. O. et al. Deoxycholic acid promotes development of gastroesophageal reflux disease and Barrett’s oesophagus by modulating integrin-alphav trafficking. J. Cell Mol. Med 21, 3612–3625 (2017).
Article CAS PubMed PubMed Central Google Scholar
Morales, T. G. & Sampliner, R. E. Barrett’s esophagus: update on screening, surveillance, and treatment. Arch. Intern Med 159, 1411–1416 (1999).
Article CAS PubMed Google Scholar
Chen, Y. Y. et al. Significance of acid-mucin-positive nongoblet columnar cells in the distal esophagus and gastroesophageal junction. Hum. Pathol. 30, 1488–1495 (1999).
Article CAS PubMed Google Scholar
Goldblum, J. R. Barrett’s esophagus and Barrett’s-related dysplasia. Mod. Pathol. 16, 316–324 (2003).
Article PubMed Google Scholar
Niv, Y. & Fass, R. The role of mucin in GERD and its complications. Nat. Rev. Gastroenterol. Hepatol. 9, 55–59 (2011).
Article PubMed Google Scholar
Arul, G. S. et al. Mucin gene expression in Barrett’s oesophagus: an in situ hybridisation and immunohistochemical study. Gut 47, 753–761 (2000).
Article CAS PubMed PubMed Central Google Scholar
Warson, C. et al. Barrett’s esophagus is characterized by expression of gastric-type mucins (MUC5AC, MUC6) and TFF peptides (TFF1 and TFF2), but the risk of carcinoma development may be indicated by the intestinal-type mucin, MUC2. Hum. Pathol. 33, 660–668 (2002).
Article CAS PubMed Google Scholar
Paterson, A. L., Gehrung, M., Fitzgerald, R. C. & O’Donovan, M. Role of TFF3 as an adjunct in the diagnosis of Barrett’s esophagus using a minimally invasive esophageal sampling device-the cytosponge(TM). Diagn. Cytopathol. 48, 253–264 (2020).
Article PubMed Google Scholar
Dunn, L. J., Jankowski, J. A. & Griffin, S. M. Trefoil factor expression in a human model of the early stages of Barrett’s esophagus. Dig. Dis. Sci. 60, 1187–1194 (2015).
Article CAS PubMed Google Scholar
Clemons, N. J. et al. Sox9 drives columnar differentiation of esophageal squamous epithelium: a possible role in the pathogenesis of Barrett’s esophagus. Am. J. Physiol. Gastrointest. Liver Physiol. 303, G1335–G1346 (2012).
Article CAS PubMed Google Scholar
Garman, K. S. Origin of Barrett’s epithelium: esophageal submucosal glands. Cell Mol. Gastroenterol. Hepatol. 4, 153–156 (2017).
Article PubMed PubMed Central Google Scholar
Rhee, H. & Wang, D. H. Cellular origins of Barrett’s esophagus: the search continues. Curr. Gastroenterol. Rep. 20, 51 (2018).
Article PubMed Google Scholar
Palles, C. et al. Polymorphisms near TBX5 and GDF7 are associated with increased risk for Barrett’s esophagus. Gastroenterology 148, 367–378 (2015).
Article CAS PubMed Google Scholar
Levine, D. M. et al. A genome-wide association study identifies new susceptibility loci for esophageal adenocarcinoma and Barrett’s esophagus. Nat. Genet. 45, 1487–1493 (2013).
Article CAS PubMed PubMed Central Google Scholar
Martinez-Uribe, O., Becker, T. C. & Garman, K. S. Promises and limitations of current models for understanding Barrett’s esophagus and esophageal adenocarcinoma. Cell Mol. Gastroenterol. Hepatol. 17, 1025–1038 (2024).
Article CAS PubMed PubMed Central Google Scholar
Kapoor, H., Lohani, K. R., Lee, T. H., Agrawal, D. K. & Mittal, S. K. Animal models of Barrett’s esophagus and esophageal adenocarcinoma-past, present, and future. Clin. Transl. Sci. 8, 841–847 (2015).
Article PubMed PubMed Central Google Scholar
Macke, R. A. et al. Barrett’s esophagus and animal models. Ann. N. Y. Acad. Sci. 1232, 392–400 (2011).
Article ADS PubMed PubMed Central Google Scholar
Quante, M. et al. Bile acid and inflammation activate gastric cardia stem cells in a mouse model of Barrett-like metaplasia. Cancer Cell 21, 36–51 (2012).
Article CAS PubMed PubMed Central Google Scholar
Jiang, M. et al. Transitional basal cells at the squamous-columnar junction generate Barrett’s oesophagus. Nature 550, 529–533 (2017).
Article ADS CAS PubMed PubMed Central Google Scholar
Garman, K. S. et al. Genetic Defect in Submucosal Gland-Associated Caveolin-3: A New Paradigm in Esophageal Adenocarcinoma Risk. Gastroenterology 165, 1561–1564.e3 (2023).
Percie du Sert, N. et al. The ARRIVE guidelines 2.0: updated guidelines for reporting animal research. PLoS Biol. 18, e3000410 (2020).
Article CAS PubMed PubMed Central Google Scholar
Li, H. & Durbin, R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 25, 1754–1760 (2009).
Article CAS PubMed PubMed Central Google Scholar
McKenna, A. et al. The genome analysis toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res 20, 1297–1303 (2010).
Article CAS PubMed PubMed Central Google Scholar
DePristo, M. A. et al. A framework for variation discovery and genotyping using next-generation DNA sequencing data. Nat. Genet. 43, 491–498 (2011).
Article CAS PubMed PubMed Central Google Scholar
Poplin, R. et al. Scaling accurate genetic variant discovery to tens of thousands of samples. bioRxiv 201178 (2018).
Ramos, A. H. et al. Oncotator: cancer variant annotation tool. Hum. Mutat. 36, E2423–E2429 (2015).
Article PubMed PubMed Central Google Scholar
Karczewski, K. J. et al. The ExAC browser: displaying reference data information from over 60 000 exomes. Nucleic Acids Res 45, D840–D845 (2017).
Article CAS PubMed Google Scholar
Gudmundsson, S. et al. Variant interpretation using population databases: lessons from gnomAD. Hum. Mutat. 43, 1012–1030 (2022).
Article PubMed Google Scholar
Robinson, J. T. et al. Integrative genomics viewer. Nat. Biotechnol. 29, 24–26 (2011).
Article CAS PubMed PubMed Central Google Scholar
Kruger, L. et al. Ductular and proliferative response of esophageal submucosal glands in a porcine model of esophageal injury and repair. Am. J. Physiol. Gastrointest. Liver Physiol. 313, G180–G191 (2017).
Article PubMed PubMed Central Google Scholar
Hsu, P. D. et al. DNA targeting specificity of RNA-guided Cas9 nucleases. Nat. Biotechnol. 31, 827–832 (2013).
Article CAS PubMed PubMed Central Google Scholar
Drovdlic, C. M. et al. Demographic and phenotypic features of 70 families segregating Barrett’s oesophagus and oesophageal adenocarcinoma. J. Med. Genet. 40, 651–656 (2003).
Article CAS PubMed PubMed Central Google Scholar
Kalabis, J. et al. Isolation and characterization of mouse and human esophageal epithelial cells in 3D organotypic culture. Nat. Protoc. 7, 235–246 (2012).
Article CAS PubMed PubMed Central Google Scholar
Ravillah, D. et al. Discovery and initial characterization of long intergenic noncoding RNAs associated with esophageal adenocarcinoma. Gastroenterology 165, 505–508.e507 (2023).
Article CAS PubMed PubMed Central Google Scholar
Fujioka, H., Tandler, B., Cohen, M., Koontz, D. & Hoppel, C. L. Multiple mitochondrial alterations in a case of myopathy. Ultrastruct. Pathol. 38, 204–210 (2014).
Article CAS PubMed Google Scholar
Fujioka, H. et al. Multiple muscle cell alterations in a case of encephalomyopathy. Ultrastruct. Pathol. 38, 13–25 (2014).
Article PubMed Google Scholar
Jacob, A. et al. Differentiation of human pluripotent stem cells into functional lung alveolar epithelial cells. Cell Stem Cell 21, 472–488.e410 (2017).
Article CAS PubMed PubMed Central Google Scholar
Zhang, Y. et al. 3D modeling of esophageal development using human PSC-derived basal progenitors reveals a critical role for notch signaling. Cell Stem Cell 23, 516–529.e515 (2018).
Article CAS PubMed PubMed Central Google Scholar
Abbas, G., Pennathur, A., Keeley, S. B., Landreneau, R. J. & Luketich, J. D. Laser ablation therapies for Barrett’s esophagus. Semin Thorac. Cardiovasc. Surg. 17, 313–319 (2005).
Article PubMed Google Scholar
Locke, G. R., Talley, N. J., Weaver, A. L. & Zinsmeister, A. R. A new questionnaire for gastroesophageal reflux disease. Mayo Clin. Proc. 69, 539–547 (1994).
Article CAS PubMed Google Scholar

Download references

Acknowledgements

This research was supported by Public Health Service (PHS) awards: P01 CA269019 (A.C., K.S.G., S.G.G., J.E.W., and K.G.); Case GI SPORE P50 CA150964 (K.G.), P30 CA043703 (K.G.); R01 DK118022 (K.S.G.); P30 DK034987 (K.S.G.); P30 CA014236 (S.G.G.); P30 DK097948 (A.C.); U01 CA271867 (A.C. and J.E.W.); The DeGregorio Family Foundation (K.G.), Torrey Coast Foundation GEMINI Network (K.G.), and The Gastric Cancer Foundation (K.G.). This work was also supported by the Animal Resource Center, Transgenic and Targeting core, Tissue Resources Core at the Case Western Reserve University, Molecular Genomics Core at Duke University, and Duke’s BioRepository & Precision Pathology Center (BRPC). We are grateful to the patients who opt to participate in our research. We thank our co-author, late Dr. Fujioka, who passed away recently, for his expert advice and help with electron microscopy studies that served as the foundation for understanding the biology of VSIG10L. We thank late Dr. Nathan A. Berger at Case Western Reserve University, who passed away recently, for expert scientific guidance and advice during the conceptualization phase of this study. We thank late Ms. Anne Baskin at Case Western Reserve University, who also passed away recently, for her technical assistance in animal husbandry. We thank Ms. Lakshmeswari Ravi for her technical input on the experimental methodologies used in this study. We thank the clinical gastroenterology providers who collect research samples from enrolled participants under their clinical care, especially Dr. Rahul Shimpi and Dr. Michael Feiler, as well as the Gastroenterology Clinical Research Unit staff at Duke. We thank Thomas C. Becker for performing lab-based assays in the Garman Lab to support this project.

Author information

Authors and Affiliations

Division of General Medical Sciences–Oncology, Case Comprehensive Cancer Center, Case Western Reserve University School of Medicine, Cleveland, OH, USA
Durgadevi Ravillah, Ramachandra M. Katabathula, Bhavatharini Udhayakumar & Kishore Guda
Center for Immunotherapy and Precision Immuno-Oncology (CITI), Lerner Research Institute, Cleveland Clinic, Cleveland, OH, USA
Salendra Singh
Department of Pathology, Case Western Reserve University School of Medicine, Cleveland, OH, USA
Adam M. Kresak, Joseph E. Willis & Kishore Guda
Digestive Health Research Institute, Case Western Reserve University School of Medicine, Cleveland, OH, USA
Rajesh Gupta, Wendy Brock, Amitabh Chak & Kishore Guda
Herbert Irving Comprehensive Cancer Center, Division of Digestive and Liver diseases, Vagelos College of Physicians and Surgeons, Columbia University Irving Medical Center, New York, USA
Yosuke Mitani & Joel T. Gabre
Duke Molecular Physiology Institute, Duke University School of Medicine, Durham, NC, USA
Vaibhav Jain, Emily Hocke & Simon G. Gregory
The Preston Robert Tisch Brain Tumor Center, Duke University School of Medicine, Durham, NC, USA
Simon G. Gregory
Department of Neurosurgery, Duke University School of Medicine, Durham, NC, USA
Simon G. Gregory
Division of Gastroenterology, Department of Medicine, Duke University, Durham, NC, USA
Katherine S. Garman
Cryo-Electron Microscopy Core Facility, Case Western Reserve University School of Medicine, Cleveland, OH, USA
Hisashi Fujioka
Division of Gastroenterology and Hepatology, Case Western Reserve University School of Medicine, Cleveland, OH, USA
Amitabh Chak

Authors

Durgadevi Ravillah
View author publications
Search author on:PubMed Google Scholar
Salendra Singh
View author publications
Search author on:PubMed Google Scholar
Ramachandra M. Katabathula
View author publications
Search author on:PubMed Google Scholar
Adam M. Kresak
View author publications
Search author on:PubMed Google Scholar
Bhavatharini Udhayakumar
View author publications
Search author on:PubMed Google Scholar
Rajesh Gupta
View author publications
Search author on:PubMed Google Scholar
Wendy Brock
View author publications
Search author on:PubMed Google Scholar
Yosuke Mitani
View author publications
Search author on:PubMed Google Scholar
Vaibhav Jain
View author publications
Search author on:PubMed Google Scholar
Emily Hocke
View author publications
Search author on:PubMed Google Scholar
Simon G. Gregory
View author publications
Search author on:PubMed Google Scholar
Katherine S. Garman
View author publications
Search author on:PubMed Google Scholar
Joel T. Gabre
View author publications
Search author on:PubMed Google Scholar
Hisashi Fujioka
View author publications
Search author on:PubMed Google Scholar
Joseph E. Willis
View author publications
Search author on:PubMed Google Scholar
Amitabh Chak
View author publications
Search author on:PubMed Google Scholar
Kishore Guda
View author publications
Search author on:PubMed Google Scholar

Contributions

Study concept and design (D.R., A.C., and K.G.); Acquisition of data (D.R., A.M.K., B.U., R.G., W.B., Y.M., V.J., E.H., K.S.G., S.G.G., J.T.G., H.K., A.C., and K.G.); Analysis and interpretation of data (D.R., S.S., R.M.K., V.J., S.G.G., J.T.G., H.K., J.E.W., A.C., and K.G.); Drafting of the manuscript (D.R.); Critical revision of the manuscript (A.C. and K.G.); Statistical analysis (R.M.K.); Obtained funding (A.C. and K.G.); Administrative, technical, or material support (W.B., R.G., A.C., and K.G.); Study supervision (K.G.).

Corresponding author

Correspondence to Kishore Guda.

Ethics declarations

Competing interests

The authors declare no competing interests.

Peer review

Peer review information

Nature Communications thanks the anonymous, reviewers for their contribution to the peer review of this work. A peer review file is available.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Supplementary Information (download PDF )

Reporting Summary (download PDF )

Transparent Peer Review file (download PDF )

Source data

Source Data (download XLSX )

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

About this article

Cite this article

Ravillah, D., Singh, S., Katabathula, R.M. et al. VSIG10L is a major determinant of esophageal homeostasis and inherited predisposition to Barrett’s esophagus. Nat Commun 17, 2167 (2026). https://doi.org/10.1038/s41467-026-68975-3

Download citation

Received: 12 May 2025
Accepted: 09 January 2026
Published: 29 January 2026
Version of record: 04 March 2026
DOI: https://doi.org/10.1038/s41467-026-68975-3