RETRACTED ARTICLE: Mitochondrial mechanotransduction through MIEF1 coordinates the nuclear response to forces

Romani, Patrizia; Benedetti, Giada; Cusan, Martina; Arboit, Mattia; Cirillo, Carmine; Wu, Xi; Rouni, Georgia; Kostourou, Vassiliki; Aragona, Mariaceleste; Giampietro, Costanza; Grumati, Paolo; Martello, Graziano; Dupont, Sirio

doi:10.1038/s41556-024-01527-3

Download PDF

Article
Open access
Published: 21 October 2024

RETRACTED ARTICLE: Mitochondrial mechanotransduction through MIEF1 coordinates the nuclear response to forces

Nature Cell Biology volume 26, pages 2046–2060 (2024)Cite this article

28k Accesses
39 Citations
74 Altmetric
Metrics details

Subjects

This article was retracted on 16 July 2025

This article has been updated

Abstract

Tissue-scale architecture and mechanical properties instruct cell behaviour under physiological and diseased conditions, but our understanding of the underlying mechanisms remains fragmentary. Here we show that extracellular matrix stiffness, spatial confinements and applied forces, including stretching of mouse skin, regulate mitochondrial dynamics. Actomyosin tension promotes the phosphorylation of mitochondrial elongation factor 1 (MIEF1), limiting the recruitment of dynamin-related protein 1 (DRP1) at mitochondria, as well as peri-mitochondrial F-actin formation and mitochondrial fission. Strikingly, mitochondrial fission is also a general mechanotransduction mechanism. Indeed, we found that DRP1- and MIEF1/2-dependent fission is required and sufficient to regulate three transcription factors of broad relevance—YAP/TAZ, SREBP1/2 and NRF2—to control cell proliferation, lipogenesis, antioxidant metabolism, chemotherapy resistance and adipocyte differentiation in response to mechanical cues. This extends to the mouse liver, where DRP1 regulates hepatocyte proliferation and identity—hallmark YAP-dependent phenotypes. We propose that mitochondria fulfil a unifying signalling function by which the mechanical tissue microenvironment coordinates complementary cell functions.

Distinct fission signatures predict mitochondrial degradation or biogenesis

Article 05 May 2021

Mitochondrial fission links ECM mechanotransduction to metabolic redox homeostasis and metastatic chemotherapy resistance

Article 14 February 2022

Mitochondrial fission drives neuronal metabolic burden to promote stress susceptibility in male mice

Article 20 November 2023

Main

Cells have the striking ability to measure the spatial and mechanical constraints imposed by their surroundings. Seemingly different constraints are sensed through a similar mechanism, based on the measurement of extracellular forces and deformations by active contraction of the actomyosin cytoskeleton^1,2. In line with this model, any extrinsic or intrinsic condition associated with decreased actomyosin tension leads to similar biological responses. This mechanosensitive process, depending on the specific cell type, can regulate multiple cell behaviours in the context of tissue homeostasis, regeneration and disease^3,4,5,6,7. In the face of a single force-sensing mechanism, multiple pathways and transcription factors can be regulated by extracellular forces⁸. It remains unclear whether any common regulatory mechanism exists downstream of actomyosin, which would coordinate distinct pathways into a unified and coherent mechanotransduction response.

An emerging theme is the potential for organelles, including mitochondria, to sense and transduce forces⁹. It was recently observed that cells cultured on a soft extracellular matrix (ECM) display increased mitochondrial fission^10,11,12. Mitochondrial morphology is controlled by fission, which depends on the cytoplasmic GTPase Dynamin-related protein 1 (DRP1; also known as DNM1L), and by fusion, which depends on the mitochondrial GTPases Mitofusin 1 (MFN1), MFN2 and Optic atrophy 1 (refs. ^13,14). Mitochondrial morphology is regulated to match the cellular metabolic demands or facilitate the structural rearrangements of mitochondria and the cell. Reflecting the importance of these processes, genes that regulate mitochondrial dynamics are found to be mutated in patients affected by neuropathies and neurodegenerative diseases¹⁵. In this Article, we sought to better explore the link between mitochondrial dynamics and the mechanical cell microenvironment.

Results

Extracellular forces induce mitochondrial elongation

We started this study by testing how general the regulation of mitochondrial morphology is in response to extracellular forces and constraints. Mitochondrial shortening was observed in different cell types in response to a soft ECM (Fig. 1a–c), direct inhibition of actomyosin players (Fig. 1d,e) and inducible knockout (KO) of Talin1 (Fig. 1f)¹⁶, in line with the role of integrin adhesions in mechanosensing, whereas there were no apparent effects upon depletion of Piezo1/2 mechanosensitive ion channels (Fig. 1g and Extended Data Fig. 1a). Mitochondrial shortening was also observed by culturing cells on small fibronectin microprinted islands and at high density (Fig. 1h–j)—conditions associated with a reduction of actomyosin tension^17,18,19,20. These changes in mitochondrial morphology were reversible; when we enabled cell spreading by wounding a dense monolayer, this restored mitochondrial elongation (Fig. 1j). Moreover, the application of laminar fluid shear stresses of different magnitudes to endothelial cells induced mitochondrial shortening at a physiological wall shear stress (WSS) of 1.4 Pa (14 dyn cm⁻²) and elongation at a WSS of 4 Pa characteristic of areas prone to atherogenesis²¹ (Fig. 1k). This is in line with ref. ²² and with a shear stress set point typical of endothelial mechanotransduction responses²³. Finally, stretching of dense immortalized keratinocytes also led to mitochondrial elongation (Fig. 1l), and coherent mitochondrial remodelling^24,25 was observed in vivo upon mouse skin expansion (Fig. 1m), which activates the mechanosensitive Yes-associated protein 1 (YAP) factor for compensatory tissue growth²⁶. These results were validated by an orthogonal quantification method (Extended Data Fig. 1b–g). Collectively, this indicates that extracellular forces broadly regulate mitochondrial dynamics in vitro and in vivo, with mitochondrial shortening occurring upon decreased actomyosin tension (soft or small ECM, dense cells and low WSS), as confirmed by monitoring Rho-associated protein kinase 1 and 2 (ROCK) activity (Extended Data Fig. 1h–o).

**Fig. 1: Forces induce mitochondrial elongation.**

Mitochondrial fission regulates SREBP1/2 mechanotransduction

Prompted by such widespread connection between mitochondria and forces, we explored the possibility that mitochondrial fission regulates other downstream responses in addition to Nuclear factor erythroid 2-related factor 2 (NRF2)¹⁰. This possibility was also suggested by an analysis of gene expression in D2.0R cells, where we observed a substantial group of genes that were regulated on soft ECM in a DRP1-dependent but NRF2-independent manner (632/5,683 DRP1-dependent genes and 179/5,683 NRF2-dependent genes) (Supplementary Table 1). Hence, we analysed DRP1-dependent genes further.

Among the genes downregulated by DRP1 inhibition on soft ECM, we noticed the presence of enzymes related to lipid metabolism (Extended Data Fig. 2a). This suggested a link between mitochondrial fission and mechanical regulation of Sterol regulatory element-binding proteins 1 and 2 (SREBP1/2)^27,28. Supporting this idea, DRP1 inactivation or its inhibition by Drpitor1a and MDIVI1 (mitochondrial division inhibitor 1) (refs. ^29,30,31) prevented accumulation of the SREBP cleavage-activating protein (SCAP) chaperone to the Golgi apparatus and of the SREBP2 transcription factor to the nucleus in different cell types and in response to multiple experimental conditions associated with decreased actomyosin tension (Fig. 2a–g). Importantly, DRP1 inhibition was also sufficient to prevent activation of established SREBP1/2 target genes (Fig. 2h) and the accumulation of lipid droplets and cholesterol (Fig. 2,i,j), indicating effective inhibition of lipid metabolism. Inhibition of DRP1 was instead unable to prevent SREBP2 activation in response to non-mechanical inputs (Extended Data Fig. 2b–e)^27,32,33, indicating that mitochondrial fission mediates the SREBP1/2 response to mechanical inputs.

**Fig. 2: DRP1 is required for the mechanoregulation of SREBP1/2 and lipogenesis.**

Mitochondrial fission regulates YAP/TAZ mechanotransduction

We then turned our attention to genes upregulated by DRP1 inhibition on soft ECM. In this case, we observed some known target genes of YAP and Translational coactivator with PDZ-binding motif (TAZ; also known as WWTR1) (Extended Data Fig. 3a)^34,35,36. Strikingly, inhibition of DRP1 prevented YAP inhibition in response to soft ECM and decreased actomyosin tension in different cell types (Fig. 3a–d and Extended Data Fig. 3b–d). Extending the relevance of these findings, inhibition of DRP1 prevented YAP inhibition in small and dense cells (Fig. 3e,f and Extended Data Fig. 3e) and had comparable effects to stretching in dense skin cells (Extended Data Fig. 3f), indicating that the response of YAP to mechanics and density occurs via the same mechanism^20,37. Moreover, inhibition of DRP1 prevented YAP inhibition in endothelial cells subjected to physiological shear stress (Fig. 3g,h). In contrast, inhibition of DRP1 did not prevent YAP inhibition by the NF2 moesin-ezrin-radixin like tumour suppressor (Extended Data Fig. 3g,h)^38,39, suggesting that mitochondrial fission broadly mediates YAP/TAZ regulation downstream of mechanical cues.

**Fig. 3: DRP1 is required for the mechanoregulation of YAP/TAZ, proliferation and cell fate.**

Strikingly, inhibition of DRP1 was also sufficient to resume DNA replication on soft ECM, in dense cells and small cells (Fig. 3i–k and Extended Data Fig. 3i,j), in line with rescued YAP–TAZ activity and with a mechanical checkpoint driving contact inhibition of proliferation^20,37. As a final test, we challenged the function of DRP1 in mouse liver, where physiological low tissue tension acts as a gatekeeper of YAP–TAZ activity^40,41. As shown in Fig. 3l,m, expression of dominant-negative DRP1 in mouse adult hepatocytes was sufficient to trigger ectopic expression of cholangiocyte markers and DNA replication, similar to the expression of constitutively active TAZ. DRP1 is thus broadly required for the regulation of YAP/TAZ responses by mechanical cues in vitro and in vivo.

In the above experiments, inhibition of DRP1 did not rescue ROCK activity or cell morphology (Extended Data Figs. 1k–m and 3k,l), placing DRP1 downstream of actomyosin. Hence, DRP1 mediates the regulation of SREBP1/2 and YAP/TAZ in response to mechanical cues. DRP1 also mediates the regulation of mitochondrial reactive oxygen species (mtROS) and NRF2 by mechanical cues¹⁰, but inhibition of ROS did not rescue YAP or SREBP2 (Extended Data Fig. 3m,o). This suggests that DRP1 regulates three distinct transcription factors by different mechanisms. For simplicity, we refer to this global process as mitochondrial mechanotransduction (MIME).

General workings of MIME

We next sought to better understand the nature and extent of MIME. We first focused on its temporal dynamics. Mitochondrial fission in response to ROCK–Myosin light chain kinase (MLCK) inhibitors was observed between 15 and 30 min (Fig. 4a), indicating an early response. This is coherent with fission acting upstream of the regulation of mtROS, YAP and SCAP–SREBP2, which occur within 1–2 h by the same treatment^10,27,37. Moreover, adding or removing the DRP1 inhibitor at different time points indicated that fission continuously transduces a reversible signal downstream of actomyosin tension (Fig. 4b). This fast and reversible regulation also made it unlikely that MIME is mediated by a very general and indirect mechanism (for example, regulation of proliferation).

By using dilutions of the Drpitor1a DRP1 inhibitor, we observed that the rescue of nuclear YAP closely mirrored the efficacy of the compound at elongating mitochondria, indicating a dose-dependent response (Extended Data Fig. 4a–d). On soft ECM, DRP1 inhibition mainly rescued intermediate mitochondria, suggesting that the number of punctate mitochondria or the fission process per se is associated with the regulation of YAP. Along the same idea, deep ρ⁰ cells devoid of mitochondrial DNA and largely missing mitochondria altogether (Fig. 4c and Extended Data Fig. 4e)⁴² displayed normal localization of YAP and SCAP–SREBP2 on stiff ECM but failed to regulate them on soft ECM (Fig. 4d–f). Overall, this suggests that mitochondria support fission-dependent signalling that inhibits YAP and activates SREBP2.

We then tested whether any alteration of mitochondrial morphology regulates MIME. Increased fission by uncoupling of the electron transport chain⁴³ was not associated with inhibition of YAP (Fig. 4g and Extended Data Fig. 4f). Similarly, triggering fission by increasing cytoplasmic calcium⁴⁴ or via the ActuAtor system⁴⁵ was not sufficient to regulate YAP or SREBP2 (Fig. 4h–j and Extended Data Fig. 4g,h). In contrast, blocking mitochondrial fusion by inactivation of MFN1 (refs. ^46,47) caused YAP inhibition and SREBP2 activation under stiff and sparse conditions (Fig. 4k,l and Extended Data Fig. 4i–l). Of note, these effects were rescued by DRP1 inhibition (Fig. 4k,l and Extended Data Fig. 4j) and we observed increased recruitment of DRP1 at mitochondria upon loss of MFN1 (Extended Data Fig. 4m,n), suggesting that loss of MFN1 leads to increased fission. Finally, inhibition of YAP was observed upon knockdown of the pro-fusion and anti-fission Phospholipase D family member 6 (PLD6) enzyme (also known as mitoPLD) (Fig. 4m and Extended Data Fig. 4o,p)^48,49. This indicated that some fission events trigger MIME signalling, whereas others do not.

Collectively, these data suggest that activation of the DRP1 fission factor at mitochondria triggers a metabolic or signalling event that regulates YAP/TAZ, SREBP1/2 and NRF2. This event may be physically coincident with the formation of DRP1 fission foci or induced secondarily by shortened mitochondria.

MIME depends on MIEF1/2

The observation that MIME is only associated with some fission events indicated specificity, which we sought to understand at the molecular level. DRP1 can be recruited to mitochondria by the mitochondrial Fission 1 protein (FIS1), Mitochondrial fission factor (MFF) and Mitochondrial elongation factors 1 and 2 (MIEF1/2; also known as MID51 and MID49, respectively)¹³. We previously implicated MIEF1/2 in mtROS generation on soft ECM¹⁰, prompting us to test their role in MIME signalling. First, MIEF1/2 were required for increased fission on soft ECM (Fig. 5a). Second, MIEF1/2 were required for NRF2 target gene activation, cystine uptake and increased resistance of cells to oxidative stress (Fig. 5b–e and Extended Data Fig. 5a), indicating that they are required for the mechanical regulation of antioxidant metabolism. Third, we extended the MIEF1/2 requirement to the regulation of SREBP2 and YAP localization (Fig. 5f,g and Extended Data Fig. 5b,c). Of note, this included Mief1 Mief2 Mff KO mouse embryonic fibroblasts (MEFs)⁵⁰ that were insensitive to the mechanical regulation of SREBP2 and YAP (Fig. 5h,i and Extended Data Fig. 5d). This indicates that MIME signalling depends on the MIEF1/2 factors. Moreover, as MIEF1/2 are only found at mitochondria¹³, this strengthens the idea that these regulations occur at or through mitochondria.

**Fig. 5: MIME depends on the MIEF1/2 fission factors.**

MIEF1/2 promote peri-mitochondrial F-actin and DRP1 activity

MIEF1/2 form heteromeric co-filaments together with DRP1 (ref. ⁵¹). These filaments constrict thanks to the GTPase activity of DRP1, leading to mitochondrial fission. Another player assisting fission is peri-mitochondrial F-actin⁵². We thus explored the relationship between these players in the context of mechanoregulated mitochondrial fission. MIEF1 forms discrete puncta along mitochondria that co-localize with DRP1 (Fig. 6a), in agreement with the co-filament model, and these puncta are enhanced on soft ECM (Fig. 6b). As for the requirements, MIEF1/2 knockdown reduces the number of DRP1 puncta on soft ECM (Fig. 6c). We also observed that DRP1 inhibition reduces the number of MIEF1 puncta (Fig. 6d), suggesting reciprocal stabilization during fission. We next monitored peri-mitochondrial F-actin, which co-localizes with DRP1 puncta¹⁰, and found that it depends on both MIEF1/2 and DRP1 activity (Fig. 6e). This is in line with the observation that MIEF1/2 overexpression can trigger peri-mitochondrial F-actin formation^50,53. Conversely, inhibition of the actin-related protein 2/3 (ARP2/3) complex prevents the formation of peri-mitochondrial F-actin^10,54 and decreases the number of both MIEF1 and DRP1 puncta (Fig. 6c–e). Overall, these results suggest a role for MIEF1/2 as both DRP1 receptors and promoters of peri-mitochondrial F-actin. Moreover, they suggest a mutually reinforcing role of MIEF1/2, DRP1 and F-actin in response to low actomyosin tension.

**Fig. 6: MIEF1/2 regulate the formation of peri-mitochondrial F-actin and DRP1 foci.**

Actomyosin tension promotes MIEF1 phosphorylation

While developing this study, we started a parallel project by performing phosphoproteomics in response to ROCK–MLCK inhibition. As expected, we observed differential phosphorylation of many cytoskeletal and adhesion proteins (Supplementary Table 1). Phosphorylation of MIEF1 at a peptide encompassing serines 55 and 59, which was reduced upon ROCK–MCLK inhibition, immediately caught our attention (Fig. 7a). The same phosphopeptide was similarly regulated in fibroblasts by ECM stiffness and in hypercontractile hearts of patients with hypertrophic cardiomyopathy (Fig. 7b). Using immunoblotting, we observed an electrophoretic mobility shift of wild-type (WT) MIEF1 upon ROCK–MCLK inhibition and a similar shift was observed with a mutated variant of MIEF1 precluding phosphorylation (S55/59A; SA variant) (Fig. 7c), consistent with reduced phosphorylation. This was validated by developing affinity-purified antisera for the detection of reduced phosphorylation of endogenous MIEF1 upon ROCK–MLCK inhibition (Fig. 7d,e).

**Fig. 7: Actomyosin tension inhibits fission by promoting MIEF1 phosphorylation.**

Using immunofluorescence, we found that a mutated variant of MIEF1 mimicking constitutive phosphorylation (S55/59E; SE variant) remains evenly distributed on the mitochondrial surface and is unable to form foci, irrespective of actomyosin tension (Fig. 7f). The SA non-phosphorylated variant instead forms a higher number of DRP1-positive fission puncta under stiff and sparse conditions, approximating the effects of ROCK–MLCK inhibition on WT MIEF1 (Fig. 7f–h). This suggests that phosphorylated MIEF1 is deficient at forming fission foci. We then depleted MCF10A-RAS cells of MIEF1/2 and reconstituted the expression of small interfering RNA (siRNA)-insensitive MIEF1 variants to compare their activity in a null background. WT and SA MIEF1 restore mitochondrial fission in response to ROCK–MLCK inhibition, whereas the SE variant is less active (Fig. 7i and Extended Data Fig. 6a,b). Conversely, simple overexpression of the SA variant is sufficient to promote fission under stiff and sparse conditions (Fig. 7j). Overall, this indicates that high actomyosin tension limits fission by promoting MIEF1 phosphorylation.

MIEF1 phosphorylation mediates MIME signalling

We next tested the relevance of MIEF1 phosphorylation for downstream responses. In a striking parallel with the effects on mitochondrial morphology, the SE variant was less able to rescue the regulation of SREBP2 and YAP upon ROCK–MLCK inhibition (Fig. 8a,b and Extended Data Fig. 7a–d), whereas expression of the SA variant was sufficient to trigger SREBP2 activation and YAP inhibition (Fig. 8c,d and Extended Data Fig. 7e,f). Similar data were obtained with Mief1 Mief2 Mff KO MEFs (Extended Data Fig. 7g,h), indicating that this mechanism is conserved and excluding a role for Mff. Moreover, coherent results were obtained by monitoring the expression of NRF2, SREBP1/2 and YAP/TAZ target genes in response to ECM stiffness (Fig. 8e) and by monitoring cystine uptake (Fig. 8f)—a downstream readout of NRF2 activity¹⁰. These data indicate that MIEF1 phosphorylation is required and sufficient to regulate three transcriptional responses to mechanical cues.

**Fig. 8: MIEF1 phosphorylation mediates MIME.**

The regulation of YAP by forces was previously linked to nuclear deformation and nuclear pore complexes⁵⁵. In line with this, nuclear compression activates YAP on soft ECM (Fig. 8g and Extended Data Fig. 8a,b), as in ref. ⁵⁶. However, inhibition of linker of nucleoskeleton and cytoskeleton (LINC) complexes—essential players in nuclear mechanotransduction⁵⁷—and the proposed mediators of nuclear pore complex regulation in response to forces has a marginal effect on YAP (Extended Data Fig. 8c–f). Conversely, compression leads to mitochondrial elongation (Fig. 8h and Extended Data Fig. 8g) and is unable to activate YAP when mitochondrial elongation is prevented by expression of the SA variant or MFN1 knockdown (Fig. 8i and Extended Data Fig. 8h–k). This indicates that MIME also accounts for YAP regulation by compression and highlights an interesting difference in the way cells perceive spatial confinements: a confinement that limits actomyosin without gross nuclear deformation (small, soft or dense) activates fission, whereas a confinement that deforms the nucleus (compression) inhibits fission, which may have relevance for other responses^58,59,60.

As a final test, we explored the role of MIME in the context of adipogenic differentiation—a process requiring the concerted regulation of proliferation, metabolism and cell fate—and an established response to mechanical cues^{17,37,61,62,63}. As shown in Fig. 8j–l and Extended Data Fig. 9a–d, DRP1 and MIEF1/2 are required for the expression of adipogenic markers and the activation of lipogenic metabolism in response to a small cell geometry and cell density. Knockdown of NRF2 or the SCAP SREBP1/2 chaperone or activation of TAZ are individually sufficient to block differentiation (Fig. 8m,n and Extended Data Fig. 9e–h), suggesting a division of labour between these transcription factors downstream of fission. Finally, expression of the SA variant triggers differentiation in sparse and unconfined cells (Fig. 8o), indicating that MIEF1 phosphorylation mediates the coordinated regulation of three transcription factors and the differentiation of adipogenic cells in response to mechanical cues.

Discussion

These data unveil the backbone of a general pathway by which cells respond to forces, which we have termed MIME. Extracellular forces, tissue confinements, nuclear deformation and intracellular actomyosin tension converge on the regulation of mitochondrial dynamics. In turn, fission coordinates the activity of three transcription factors with complementary functions, including YAP/TAZ. This was observed in several cell types in vitro, is regulated in mice during the process of compensatory skin growth and in patients with heart disease and is relevant in vitro and in vivo for cell fate homeostasis. We thus propose that mitochondria fulfil a unifying mechanotransduction information-processing system role⁶⁴ to match cell proliferation, cell metabolism and cell identity with tissue-scale organization and mechanical properties.

MIME is centred on phosphorylation of the MIEF1 fission factor, which limits fission when cells develop high actomyosin tension. MIEF1-mediated fission occurs in response to physiological tissue inputs and mostly regulates non-mitochondrial processes. MIME is thus different from other fission mechanisms in terms of upstream stimuli, molecular mechanism^65,66,67,68 and downstream effects^69,70. The quest is now open to identify the other players of this pathway, including the upstream MIEF1 kinase(s) and downstream molecular mechanism(s) by which mitochondrial fission regulates YAP/TAZ, SREBP1/2 and mtROS/NRF2. It also remains to be understood whether MIME regulates other mitochondrial functions.

This work opens avenues of research in many directions. For example, changes in mitochondrial morphology have been observed during the transition of mouse embryos from the blastocyst to the gastrula stage, or during induced pluripotent stem cell reprogramming^71,72, and knockout of fission and fusion factors in mouse tissues revealed unexpected roles in stem cell self-renewal and differentiation^73,74,75,76. Therefore, MIME might contribute to the physiological responses of tissues to environmental forces and could play a role in the development of pathologies associated with altered tissue mechanics, including fibrosis, atherosclerosis, cancer and ageing.

Methods

The research in this work complies with all of the relevant ethical regulations. Animal experiments were authorized by the Italian Ministry of Health.

Plasmids and reagents

Mito-RFP was kindly provided by L. Scorrano. Mito-Clover was kindly provided by D. De Stefani. Myc-tagged SCAP was kindly provided by Y. Chen. ActuAtor plasmids were kindly provided by T. Inoue and H. Nakamura. GFP-NESPRIN1-KASH and GFP-NESPRIN2-KASH plasmids were kindly provided by P. Roca-Cusachs. siRNA-insensitive human haemagglutinin (HA)-tagged human MIEF1 coding sequences (NM_019008.6; WT, S55/59A and S55/59E isoforms) were purchased from Integrated DNA Technologies and cloned into transient mammalian expression vectors. All plasmid preparations used for transfection were endotoxin free and sequence verified.

The compounds used (source and concentration) were: DRPITOR1a (AGVdiscovery; 2 µM)³¹, MDIVI1 (M0199; Sigma–Aldrich; 10 µM), Y27632 (1683; Axon; 20 µM); ML7 (I2764; Sigma–Aldrich; 20 µM), FASUDIL (HA-1077; Santa Cruz Biotechnology (STCB); 20 µM), BLEBBISTATIN (B0560; Sigma–Aldrich; 20 µM), SMIFH2 (S4826; Sigma–Aldrich; 10 µM), CK869 (C9124; Sigma–Aldrich; 30 µM), Rapamycin (553210; Sigma–Aldrich; 100 nM), Cisplatin (sc-200896; STCB; 5 µM); As2O3 (202673; Sigma–Aldrich; 5 µM), MitoTEMPO (SML0737; Sigma–Aldrich; 15 µM), NAC (A0737; Sigma–Aldrich; 5 mM), TROLOX (10011659; Cayman; 10 µM), Ionomycin (I0634; Sigma–Aldrich; 0.3 µM), FCCP (C2759; Sigma–Aldrich; 10 µM) and U18666A (sc-203306; SCBT; 3 µM).

Cell cultures

MCF10A and MCF10AneoT (MCF10A-RAS) human mammary epithelial cells were cultured in DMEM/F-12, 5% heat-inactivated horse serum, 10 µg ml⁻¹ insulin (Sigma–Aldrich), 20 ng ml⁻¹ human epidermal growth factor (PeproTech), 100 ng ml⁻¹ cholera toxin (Sigma–Aldrich) and 0.5 µg ml⁻¹ hydrocortisone (Sigma–Aldrich). Univocal identification was based on exon PCR sequencing to identify coding point mutations present in MCF10AneoT (MAP3K12 A662D), MCF10AT1 (also known as MCF10AT1k or MCF10A MII; PCSK5 M452I) and MCF10CA1a cells (also known as MCF10A MIV; PCSK5 M452I and PIK3CA H1047R)⁷⁹. D2.0R mouse metastatic breast cancer cells, primary MEFs and mouse 3T3L1 preadipocyte cells were cultured in DMEM and 10% heat-inactivated foetal bovine serum. MEFs and 3T3L1 cells were expanded in a low-oxygen (5%) incubator. In experiments comparing KO and WT MEFs, both originated from the same laboratory. All other cells were kept at an ambient oxygen concentration with 5% CO₂. ρ⁰ cells were obtained by culturing cells in 50 ng ml⁻¹ ethidium bromide, 50 µg ml⁻¹ uridine and 1 mM pyruvate for 3 weeks. Stable cell lines expressing Mito-Clover, TAZ4SA, WT and SE MIEF1 were obtained by retroviral infection followed by antibiotic selection. Stable short hairpin RNA (shRNA) expression was obtained by lentiviral infections. Stable doxycycline-inducible WT and SA MIEF1 expression was obtained by stably expressing pBCAG Tet3G and pBTRE-MIEF1 WT or pBTRE-MIEF1 SA in MCF10-RAS cells. To induce the expression of WT or SA MIEF1, cells were treated with 1 µg ml⁻¹ doxycycline for 24 h. Primary human umbilical vein endothelial cells (HUVECs; neonatal, pooled donors; C-12203, PromoCell) were cultured in Endothelial Cell Growth Medium (C-22010; PromoCell) and used with three to four passages in vitro. Primary mouse lung endothelial cells were isolated, cultured and treated as in ref. ¹⁶. Adipogenic differentiation was induced by culturing 3T3L1 cells for 3 d in differentiation medium (insulin (I9278; Sigma–Aldrich; 10 µg ml⁻¹), 3-isobutyl-1-methylxanthine (I5879; Sigma–Aldrich; 0.5 mM) and dexamethasone (D4902; Sigma–Aldrich; 1 µM) and then for 5 d in maintenance medium (insulin; 10 µg ml⁻¹). Differentiated adipocytes were scored after 7 d from induction. Drpitor1a (0.5 µM) was added only with the differentiation medium, indicating an early requirement. Glutamine was added to a final concentration of 1 mM to all media. General media, serum and supplements were from Thermo Fisher Scientific. Cell lines were routinely cultured without antibiotics and tested with an N-GARDE Mycoplasma kit (EMK090020; Euroclone) to exclude contaminations.

Mechanical stimulations

Stiff (Young’s modulus, E = ~15 kPa) and soft (E = 0.5 ~kPa) fibronectin-coated polyacrylamide hydrogels were assembled in house using standard protocols⁴⁰. For selected experiments, we used commercial collagen I-coated polyacrylamide hydrogels of E = ~50 kPa and E = ~0.2 kPa (Matrigen). Matrigel (BD Biosciences) was diluted 2% in 1× phosphate-buffered saline (PBS) to coat stiff tissue culture dishes (E = ~ 1 GPa), whereas it was used pure and gelled at 37 °C to obtain thick and soft substrata (E = ~250 Pa). Compression was obtained using the one-well static cell confiner (4Dcell) with 6 µm micropillars adapted on Softview collagen I-coated polyacrylamide hydrogels mounted on glass-bottom dishes (Matrigen). In all of these experiments, cells were completely isolated or contacted few neighbouring cells, and all cells were included in the analyses.

For cell density studies, MCF10A-RAS and 3T3L1 cells were seeded at 3,000 cells per cm² (low density) and 100,000 cells per cm² (high density) and HaCaT cells were seeded at 5,000 cells per cm² and 150,000 cells per cm² and cultured for 3 d to induce quantitative YAP inhibition. Tonic uniaxial stretching was achieved by plating dense cells onto a super clear 0.25 mm silicone sheet (HT6240GK; MVQ Silicones) mounted in a Brick Strex device⁸⁰. The mounted apparatus was sterilized with ultraviolet light before coating of the silicone with fibronectin and plating. Cells and culture medium were contained by attaching a 30-mm-wide, 12-mm-high, 3-mm-thick three-dimensionally printed plastic ring (Protolabs) with high-vacuum silicone grease (Dow Corning). At 72 h, cells were slowly stretched to 200% that of the initial apparatus length. Cells were fixed for immunofluorescence analyses while stretched.

The fibronectin micropatterned glass slides were from Cytoo (PADO1-SQRS or PADO2-SQ17 custom masks; freely available to any customer upon request).

Flow experiments were performed in a custom-designed parallel plate flow chamber as previously described⁸¹. To fabricate the substrates that fit into the flow chamber, a 126 × 70 mm² rectangle was cut from 120-μm-thick cyclic olefin copolymer foil (Ibidi) and patches with dimensions of 30 mm × 15 mm were cut from the centre of the substrate. The surfaces were cleaned with 70% ethanol, treated with oxygen plasma (80 W for 60 s; 1 ± 0.2 mbar) to increase their hydrophilicity and finally coated with glutaraldehyde cross-linked gelatin (104070; Merck Millipore) to increase cell adhesion⁸². HUVECs were seeded at a high initial density (450 cells per mm²) and grown under static conditions for 72 h to generate mature monolayers⁸¹. The flow rates were selected to reach the target WSS values, in accordance with the following equation: τ = 6Qμ/WH², where τ is the WSS, Q is the volumetric flow rate, μ is the dynamic viscosity of water at 37 °C, W is the width of the chamber and H is the height of the chamber. Specifically, cells were conditioned for 18 h with flows yielding nominal WSSs of 1.4 and 4.0 Pa. At the end of each experiment, the cells were fixed and immunofluorescence staining was performed. Images of actin immunostainings were used to quantify cell orientation. Confocal Z-stacks were first projected with maximum intensity onto a single tiff image. From these images, the orientation distributions of actin were calculated using the ImageJ 1.54h plugin OrientationJ⁸³. For each group (flow or static) in each independent experiment, ten fields of view were analysed and the results were pooled together to obtain the final orientation distribution. Finally, the orientation values were simplified to the range between 0 and 90° due to symmetry.

Transfections and RNA interference

Cell transfections were carried out with TransIT-LT1 (Mirus Bio), Lipofectamine 3000 (Thermo Fisher Scientific) or Lipofectamine RNAiMAX (Thermo Fisher Scientific). siRNAs were selected among FlexiTube GeneSolution (package of four) siRNA sets (Qiagen) and reordered after validation as dTdT-overhanging 19-nucleotide RNA duplexes (Thermo Fisher Scientific). The siRNA sequences were as follows: AACAAAGUCUCAGUAUUAC (hDRP1); CGGCTTTCCAAGCCTAATA (hMFN1 1); GGCGATTACTGCAATCTTT (hMFN1 2); GGUGCGUCGUGAGAAUCCA (hMIEF1 1); GUAUGAGCGUGACAAACAU (hMIEF1 2); GGUGCCUGAUGGUAGGUAU (hMIEF2 1); GCUGAGAGAAGGUGACUUA (hMIEF2 2); GCGUCUUCCUUAGCCAUUA (hPIEZO1 1); GCCUUGUAUGCACCGUCAA (hPIEZO1 2); CGACGGAAAUGGUUUGUUU (hPIEZO2 1); GCGCCGUGACUGACGUGUA (hPIEZO2 2); GCCUGUCCUUGGGUAGUAA (hPLD6 1); GCAACUACAUGGCCCUCAA (hPLD6 2); CGGUUAGAACAAGAGGUAA (hROCK1 1); AGCUCGAAUUACAUCUUUA (hROCK1 2); GCTACAUAUGGAGCUUAAA (hROCK2 1); and GCACUUGUAUAAAGCCAUA (hROCK2 2). AllStars Negative Control siRNA (Qiagen) was used. shRNAs were selected among five different pre-designed pLKO-1 vectors (Sigma–Aldrich) stably integrated in D2.0R cells by lentiviral infection and puromycin (50 µg ml⁻¹) selection. The shRNA sequences were as follows: CGGUGGUGCUAGGAUUUGUUA (mDrp1 A (shDrp1a); TRCN0000321169); GGCAAUUGAGCUAGCGUAUAU (mDrp1 B (shDrp1b); TRCN0000012606); CCAAAGCUAGUAUAGCAAUAA (mNfe2l2 A (shNrf2a); TRCN0000054658); CUUGAAGUCUUCAGCAUGUUA (mNfe2l2 B (shNrf2b); TRCN0000054659); CAUCAUGAAUGUCCCUGGUUU (mMief1 A; TRCN0000192183); CCUGACACUAGAAGUUCAGUA (mMief1 B; TRC000192487); CCUCUUGGCUAAUGCUCGAUU (mMief2 A; TRCN0000201929); UCUCUAUGGGCCACGAAUUAC (mMief2 B; TRCN0000251424); GCGUACAUCCAACAGAUAUUU (mScap1 A (shScapa); TRCN0000341892); CCAUGGCGACAUTACCTTGTA (mScap1 B (shScapb); TRCN0000341892); and TTCTCCGAACGUGUCACGU (control (shCO)).

Flow cytometry

Staining for FITC-cystine uptake was carried out by incubating cells in a plate at the end of the experiments with the indicated reagents in full medium without phenol red (FITC-cystine; 5 µM; 30 min). After trypsinization and a brief wash in 1× Hanks’ Balanced Salt Solution, quantification was run on live cells in 1× Hanks’ Balanced Salt Solution (Ca and Mg free). Analysis was carried out on an LSRFortessa X-20 cell analyzer (BD Biosciences). Cells were gated based on side scatter pulse area versus forward scatter pulse area (to eliminate cell debris) and side scatter pulse width (to eliminate cell doublets). FITC-cystine was measured using a FITC-A filter. The median fluorescence intensity was measured for each independent biological sample, based on at least 3 × 10⁴ gated events.

Survival assays

Cells were seeded in 96-well plates with the indicated coatings (5,000 MCF10A-RAS cells per well and 4,000 D2.0R cells per well), in parallel with standards in the linear range of detection (8,000, 4,000, 2,000, 1,000, 500 or 250 cells per well). Where pertinent, siRNA transfection was performed in bulk the day before seeding. At 24 h after seeding, culture medium was renewed by adding the indicated chemicals or corresponding amounts of vehicle. MCF10A-RAS cells were in glucose-free medium. After 48 h of treatment, cells were washed with 1× PBS and incubated with resazurin (R7017; Sigma–Aldrich; 100 µM) in culture medium, then incubated at 37 °C for 2 h. Fluorescence at 544/590 nm was measured on live cells by checking that the signal was in the temporal linear range. Absolute cell numbers were then calculated based on the standard curve after background subtraction (medium without cells). Relative survival was calculated as the percentage of remaining cells compared with control cells (100%).

EdU incorporation assays

Cells were incubated for 1 h with 5-ethynyl-2′-deoxyuridine (EdU; A10044; Invitrogen) before fixation with 4% formaldehyde for 15 min at room temperature, followed by a 0.5% Triton X-100 permeabilization step. Cells were then processed and analysed according to the manufacturer’s instructions for the Click-iT EdU Cell Proliferation Kit for Imaging (C10338; Invitrogen).

Quantitative PCR

Total RNA was isolated using commercial kits with DNAse treatment (Norgen Biotek). Complementary DNA (cDNA) synthesis was carried out with M-MLV Reverse Transcriptase (Thermo Fisher Scientific) and Oligo(dT) primers. Quantitative PCR reactions were assembled with FastStart SYBR Green Master mix (Roche) and run on a QuantStudio 6 thermal cycler (Thermo Fisher Scientific). GAPDH expression levels were used to normalize gene expression between samples based on eff(gene)^{−ΔCt(gene)}/eff(GAPDH)^{−ΔCt(GAPDH)}, where eff is the primer amplification efficiency experimentally determined from three consecutive fivefold dilutions of one control sample of cDNA, centred on the dilution used for all of the other samples. Gene expression levels for each biological sample were quantified as the mean between three technical replicates.

The primer sequences for human genes were as follows: GTTGACTCCCCTTCCTGGTG and CTTCCAACTCTTCCCCGGAC (ACSS2); ACTTGGGCCGGTATTTCTTC and TGGGCTAGAAGTGTCTTCAGAT (ANKRD1); AGGAGTGGGTGTGTGACGA and CCAGGCAGTTGGCTCTAATC (CTGF (CCN2)); CCTTGTGGACAGCCAGTGTA and ACTTGGGCCGGTATTTCTTC (CYR61 (CCN1)); GGAGGAGTGTAAACAGCGCT and TTGGCAAACACACCCTCCTT (FASN); GCCAGTTTGTGCAGTTCCAG and GGTGGCCGAATCTTCCTTCA (FTH1); CTCCTGCACCACCAACTGCT and GGGCCATCCACAGTCTTCTG (GAPDH); TGCAGCAAACATTGTCACCG and CACCACCCACCGTTCCTATC (HMGCR); AGTCTTCGCCCCTGTCTACT and GCTGGTGTGTAGGGGATGAC (HMOX1); ACAGTCCAGGCACAGATGTC and AAGCCGCTCATTCACCTTGT (MFN1); GGTTCATTGACAGGGCCACT and GATCAGTTTCTGCAGGCCCT (MIEF1 (MID51)); ATTCGGGGAAAAGGAGCTGG and TCGAAGGTGGAGGAGTCTGT (MIEF2 (MID49)); GCACTGATCGTACTGGCTCA and CCACCACCTCCCATCCTTTC (NQO1); TTCCCCAAGTACATCCGTGC and CAGCTCGATGACCCACCATT (PIEZO1); TCTATGCCATGATCCACGCC and AGCTGGCACCCTTGAATCTC (PIEZO2); AGGGAAGATGTGAGTGTGCG and CAAGGACAGGCTGCTGAAGA (PLD6); GGTCGGTCGGTTGGGGTATTT and GCCCTAAACCTCACTTGGCTG (ROCK1); and GCCGCCGTTGCCATATTAAAG and ACCCACTTGTGCTGCTCTTTC (ROCK2).

The primer sequences for mouse genes were as follows: GCCAGTCATGCCGAAGATGA and AGTGCCATCTCTGCCATCAC (AdipoQ); CAGGTGGTGGGATTGGAGAC and CGGGCAGACAGTTTTCTTGC (Drp1); TGGGCGTGGAATTCGATGAA and ACATTCCACCACCAGCTTGT (Fabp4); ATCCTGCACCACCAACTGCT and GGGCCATCCACAGTCTTCT (Gapdh); CGAGCGCTCCATTCATCTCT and GCTGCTTCTCTTGCCTCTGA (Lpl); TCATGCATACCTGGGGAGGA and AGCCACCTACAACACATCGG (Mid49); TGCTACCCTGGCTGTAAAGC and CTCTCAGCAGGCTCAGTTCC (Mid51); AACAGAACGGCCCTAAAGCA and CCAGGACTCACGGGAACTTC (Nfe2l2); and GCTCGGCTTAATGGTTCCCT and CTGTGATGGGCTTCTGGTGT (Scap1).

Immunofluorescence and proximity ligation assay

Immunofluorescence was performed as in refs. ^10,27 with minor modifications: 15 min with 1.5 mg ml⁻¹ glycine in PBS before permeabilization to reduce the background; and blocking in 10% bovine serum albumin (BSA). Images were acquired sequentially with a Zeiss LSM 900 Airyscan, a Leica STELLARIS confocal microscope equipped with a charge-coupled device camera using ZEN 2 (version 3.9) or Leica LAS X (version 4.1.1) software. Typical acquisition settings for immunofluorescence were: image size = 1,024 × 1,024 pixels; acquisition mode = xyz; pixel size = 0.15 mm; image depth = 8 bits; acquisition speed = 5/10 (average = 2); and objective = Plan-Apochromat 40×/1.40 oil or 63×/1.40 oil DIC M27. For multichannel acquisitions, we used a 405/488/555/639 main beam splitter. Raw images (saved in .czi or .lif format) were opened in ImageJ for analysis.

For HUVEC assays, confocal microscopy was performed at room temperature using an automated Nikon Ti spinning disk confocal microscope (Nikon) equipped with an Andor DU-888 camera (Oxford Instruments) and a pE-100 LED illumination system (CoolLED) with violet (405 nm laser diode), blue (488 nm; Argon), yellow (561 nm; solid state) and red (633 nm; HeNe) excitation laser lines. For comparison purposes, different sample images were acquired under constant acquisition settings. Image acquisition was performed using a 40×/1.3 NA oil immersion objective (CFI Plan Fluor 40× Oil; Nikon). Fluorescent Z-stacks of the emitted signals were acquired by selecting the optical filters based on the respective emission.

For mitochondrial morphology analysis, cells were fixed for 10 min at 4 °C with 4% formic acid and washed with cold PBS before permeabilization, followed by immunofluorescence staining for the mitochondrial marker TOMM20. Images were acquired as above or with the Operetta automated imaging system. Two objective methods were used to quantify mitochondrial morphology: (1) a machine-learning approach measuring the percentage area of punctate, intermediate or filamentous mitochondria⁸⁴; or (2) a mitochondrial fragmentation count⁸⁵. Punctate, intermediate or filamentous mitochondria were classified manually by their morphology initially, followed by the application of a machine-learning algorithm (Columbus 2.9). The percentage area of these categories was calculated in each cell and the average distribution of the categories among different treatment groups was compared. The initial training was repeated for each cell type based on positive controls (DRP1 inhibition and FCCP treatment), due to basal differences in the mitochondrial network. The mitochondrial fragmentation count was calculated as the total number of mitochondria divided by the total area of mitochondria per cell.

For the proximity ligation assay (Duolink Proximity Ligation Assay) we followed the manufacturer’s instructions (DUO92102; Sigma–Aldrich) with minor modifications: cells were fixed in 4% formic acid for 10 min at 4 °C. After a brief wash, cells were incubated for 15 min with 1.5 mg ml⁻¹ glycine in PBS before permeabilization and then blocked for 1 h at room temperature with Duolink Blocking Solution (Sigma–Aldrich). Primary antibodies were then incubated with 2% goat serum at 4 °C overnight. The primary antibodies used for the F-actin proximity ligation assay were TOMM20 (PA5-52843; Thermo Fisher Scientific) and biotin-labelled phalloidin (P8716; Sigma–Aldrich), together with an anti-biotin antibody (sc-53179; STCB).

Immunoblotting

Cells were harvested in HPO buffer (50 mM HEPES (pH 7.5), 100 mM NaCl, 50 mM KCl, 1% Triton X-100, 0.5% NP-40, 5% glycerol and 2 mM MgCl₂) by sonication. Extracts were boiled in Laemli buffer (250 mM Tris-HCl (pH 6.8), 10% SDS, 50% glycerol and 0.5% BBP), loaded in NuPAGE Novex Bis-Tris acrylamide gels (Invitrogen) and transferred onto a nitrocellulose or polyvinylidene fluoride membrane in a wet transfer apparatus (Thermo Fisher Scientific) with buffer containing 50 mM Tris, 200 mM glycine, 1% SDS and 20% methanol). If possible, the membrane was cut horizontally to probe different antibodies in parallel on the same membrane. The membrane was washed in Tris-buffered saline (pH 7.5) (Tris with NaCl), 0.05% Tween-20 was added and then blocking was performed for 1 h at room temperature with 5% nonfat dry milk (Bio-Rad) or BSA (8076.4; Carl Roth). Primary antibodies were incubated overnight at 4 °C with 1% BSA blocking, except for Mid49 and Mid51, which were incubated for 1 h at 37 °C. Secondary antibodies were incubated for 1 h at room temperature. The horseradish peroxidase (HRP) signal was detected with Immobilon Crescendo Western HRP substrate (WBLVR0500; Merck Millipore) or Immobilon Forte Western HRP substrate (WBLUF0500; Merck Millipore) reagent in an ImageQuant 800 imaging system (Amersham).

Antibodies

The primary antibodies used were as follows: DRP1 (611113; BD Biosciences; 1:300; punctated immunofluorescence staining co-localizing with mitochondrial markers and disappearing upon Driptor1a treatment); FLAG (14793; Cell Signaling Technologies; 1:500); GAPDH (MAB374; Millipore; 1:20,000); green fluorescent protein (GFP; ab13970; Abcam; 1:500; immunofluorescence signal detected only in GFP-expressing cells); GM130 (610822; BD Biosciences; 1:100; immunofluorescence signal co-localizes with other Golgi markers); HA (ab9110; Abcam; 1:4,000; western blot signal detected only in HA-expressing cells); MIEF1 (20164-1-AP; Proteintech; 1:1,000; western blot signal lost in KO cells); MIEF2 (20718-1-AP; Proteintech; 1:1,000; western blot signal lost in KO cells); MFN1 (13798-1-AP; Proteintech; 1:1,000; western blot signal lost in KO cells); Myc (sc-789; STCB; 1:100); NF2 (sc-331; STCB; 1:200; western blot signal lost in KO cells); SREBP2 (10007663; CaymanChem; 1:200; immunofluorescence signal at the endoplasmic reticulum, Golgi or nucleus, depending on extracellular lipids); TOMM20 (PA5-52843 (Thermo Fisher Scientific) and sc-17764 (STCB); 1:500; immunofluorescence signal co-localizes with other mitochondrial markers); and YAP/TAZ (sc-101199; STCB; 1:200; western blot signal lost upon siRNA knockdown; immunofluorescence nucleo-cytoplasmic signals regulated by established inputs). The secondary antibodies used (1:1,000) were as follows: Alexa-488 anti-mouse (A21202; Thermo Fisher Scientific); Alexa-568 anti-rabbit (A11036; Thermo Fisher Scientific); Alexa-568 anti-mouse IgG1 (A21124; Thermo Fisher Scientific); Alexa-647 anti-mouse IgG2b (A21242; Thermo Fisher Scientific); anti-rabbit-HRP (A0545; Sigma–Aldrich); and anti-mouse-HRP (RPN4201V; GE Healthcare). Where indicated, cell extracts were subjected to immunoprecipitation with anti-HA (ab9110; Abcam) or anti-MIEF1 (sc-514135; STCB) antibodies. Custom-made rabbit (Innovagen; 1:1,000) and chick (Davids Biotechnologie; 1:2,000) polyclonal anti-human phosphorylated MIEF1 was developed by peptide immunization and subsequent positive (phosphopeptide) and negative (non-phosphopeptide) affinity purifications. Validation was based on enzyme-linked immunosorbent assay tests on peptides and on immunoblotting on immunoprecipitated WT and SA variant MIEF1 proteins.

For the HUVEC assays, the following primary antibodies were used: rabbit monoclonal anti-AIF antibody [E20] - mitochondrial marker (ab32516; Abcam 1:100) and mouse monoclonal anti-YAP (63.7) (sc-101199; Santa Cruz Biotechnology; 1:200). The secondary antibodies used were goat anti-mouse Alexa Fluor 555 (A28180; Thermo Fisher Scientific; 1:400) and goat anti-rabbit Alexa Fluor 647 (A27040; Thermo Fisher Scientific; 1:400). Cell nuclei were counterstained with DAPI (62248; Thermo Fisher Scientific; 1:1,000) and actin fibres with phalloidin (Alexa Fluor 555 Phalloidin; A34055; Thermo Fisher Scientific; 1 µM).

RNA sequencing

Library generation used the QuantSeq 3′ mRNA-Seq Library Prep kit (Lexogen) with Oligo(dT) priming. Sequencing was performed on NextSeq 500 Illumina instruments and based on at least 5 million reads (75 bp single end) per sample. The reads were trimmed using BBDuk (BBMap version 37.87) with the parameters indicated in the Lexogen data analysis protocol. After trimming, reads were aligned to the Mus musculus genome (GRCm38.p6) using STAR (version 2.7.6a). The gene expression levels were quantified using featureCounts (version 2.0.1). Genes were sorted to remove those that had a total number of counts below ten in at least three samples. All RNA sequencing analyses were carried out in the R environment (version 4.0.0) with Bioconductor (version 3.7). We computed differential expression analysis using the DESeq2 R package (version 1.28.1). Normalization to counts per million was performed exploiting the cpm function from the edgeR package (version 3.32.0).

Protein mass spectrometry

All of the experiments were performed in a labelling-free setting. Cells were lysed in 6 M guanidine and 100 mM Tris-HCl (pH 7.5) buffer supplemented with protease (11873580001; Roche) and phosphatase (P5726; Sigma–Aldrich) inhibitors. Samples were sonicated in a Bioruptor at 2 × 30 s, 4 °C and high amplitude. From each sample, 1 mg was treated with a final concentration of 10 mM tris(2-carboxyethyl)phosphine and 40 mM chloroacetamide at 95 °C for 10 min. Protein lysates were precipitated by methanol/chloroform using four volumes of ice-cold methanol, one volume of chloroform and three volumes of water. The mixture was centrifuged at 20,000g for 30 min and the upper aqueous phase was removed, then three volumes of ice-cold methanol were added. Proteins were pelleted by centrifugation, washed twice with two volumes of ice-cold methanol and air dried. Each pellet was resuspended in 50 ml 10 mM Tris-HCl (pH 8) and 8 M urea at room temperature. Proteins were digested with trypsin (ratio = 1:100) and Lys-C (ratio = 1:200) overnight at 37 °C on a mixer. The digestion reaction was acidified using 0.5% trifluoroacetate and peptides were purified using Sep-Pak tC18 cartridges (Waters; 50 mg), then lyophilized. Phosphopeptides were enriched using a High-Select TiO₂ Phosphopeptide Enrichment Kit (A32993; Thermo Fisher Scientific).

Instruments for liquid chromatography with tandem mass spectrometry (MS/MS) analysis consisted of a NanoLC 1200 coupled via a nano-electrospray ionization source to a quadrupole-based Q Exactive HF benchtop mass spectrometer (Thermo Fisher Scientific). Peptide separation was carried out according to hydrophobicity on a home-made chromatographic column (inner diameter = 75 mm; tip = 8 µm; bed = 500 mm (packed with Reprosil-Pur C18-AQ); particle size = 1.9 mm; pore size = 120 Å) using a binary buffer system consisting of solutions A (0.1% formic acid) and B (80% acetonitrile and 0.1% formic acid). Runs of 140 min after loading were used for the proteome samples, with a constant flow rate of 250 nl min⁻¹. After sample loading, runs started with a discontinuous gradient from 5–90% buffer B.

For Q Exactive HF, mass spectrometry spectra were acquired using 3 × 10⁶ as an automatic gain control target, with a maximum injection time of 20 ms and 120,000 resolution at 200 m/z. The mass spectrometer operated in data-dependent Top20 mode with subsequent acquisition of higher-energy collisional dissociation fragmentation MS/MS spectra of the top 20 most intense peaks. The resolution for MS/MS spectra was set to 15,000 at 200 m/z, with an automatic gain control target of 1 × 10⁵, a maximum injection time of 20 ms and an isolation window of 1.6 Th. The intensity threshold was set at 2.0 × 10⁴ and dynamic exclusion at 30 s.

All of the experiments were performed in at least three independent biological replicates. All acquired raw files were processed using MaxQuant (version 1.6.2.10) and the implemented Andromeda search engine. For protein assignment, spectra were correlated with the UniProt human database (version 2021), including a list of common contaminants. Searches were performed with tryptic specifications and default settings for mass tolerances for mass spectrometry and MS/MS spectra. Carbamidomethyl at cysteine residues was set as a fixed modification, whereas oxidations at methionine, acetylation at the amino terminus and phosphorylation (at serines, threonines and tyrosines) were defined as variable modifications. The minimum peptide length was set to seven amino acids and the false discovery rate for proteins and peptide spectrum matches was set to 1%. The match-between-run feature with a time window of 1 min was used. For further analysis, Perseus software (version 1.6.2.3) was used and first filtered for contaminants and reverse entries, as well as proteins that were only identified by a modified peptide. The label-free quantification ratios were logarithmized, grouped and filtered for the minimum valid number (a minimum of three in at least one group). Missing values were replaced by random numbers that were drawn from a normal distribution. Two sample t-tests were performed using a false discovery rate of 0.05.

Mice

Hydrodynamic tail vein injection was used to transduce hepatocytes of 4- to 6-week-old BALB/C male mice with exogenous DNA. 50 μg piggyBac transposon plasmid DNA together with 10 μg hyperactive piggyBac transposase plasmid DNA (hyPBase) were diluted in sterile Ringer’s solution in a volume corresponding to 10% of the bodyweight (on average, 18–22 g) and injected via the tail vein for a maximum time of 8–10 s. piggyBac plasmids were obtained by subcloning the cDNAs of interest (HA-tagged DRP1 DN or FLAG-tagged mTAZ 4SA) in a piggyBac plasmid with a cytomegalovirus promoter. For EdU labelling, mice were injected with 12.5 mg kg⁻¹ EdU (A10044; Molecular Probes) in sterile 1× PBS 16 h before tissue sampling. Mice were euthanized after 15 d and the abdominal contents were exposed. Transcardiac perfusion (29-gauge needle) with cold 1× PBS (10–20 ml) was performed to reduce blood contaminants. The liver was removed and placed in a clean petri dish with 1× PBS on ice. The liver tissue was either prefixed in 4% paraformaldehyde (A6 staining) or directly embedded in OCT (CK19 staining) and stored at −80 °C for subsequent immunofluorescence analyses. Every mouse was analysed by scoring six independent tissue sections. Mice were kept in standard cages with a limit of five mice per cage, with ad libitum feeding and drinking at an average temperature of 19–24 °C and with 12 h light/12 h dark cycles. Animal experiments were performed according to our institutional guidelines as approved by the University Animal Welfare Commission (OPBA) and authorized by the Ministry of Health (945/2015-PR and 54/2015-PR). Reporting was according to the ARRIVE guidelines.

Statistics and reproducibility

All of the data are based on multiple experiments with independent biological replicates, as specified in the figure captions, with the exception of RNA sequencing and proteomics, where independent biological replicates from a single experiment were used. Experiments were carried out by thawing a new aliquot of cells deriving from the same original stock. All values were pooled between experiments. No method was used to predetermine sample size, but our sample sizes are similar to those reported in previous publications^{10,20,27,28,37,40,41}. No samples or experiments were excluded. The experiments were not blinded or randomized. Most results were qualitatively replicated across different cell lines and with independent reagents and techniques providing consistent results. Key results were replicated by another fellow in the laboratory.

Experimental data are presented as means and single points or means and s.d. Statistical significance was determined by unpaired two-tailed Student’s t-test or Dunnet’s test for multiple comparisons with a single control (Prism 9). The data distribution was assumed to be normal, but this was not formally tested.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

Annotation of proteomics was based on UniProt human database (version 2021). RNA sequencing raw data have been deposited in the Gene Expression Omnibus with the accession code GSE189803. The results of DESeq2 analysis are provided in Supplementary Table 1. Proteomic raw data have been deposited in the PRIDE repository (PXD040502) and the results of the differential analysis are provided in Supplementary Table 1. Source data are provided with this paper. All of the other data supporting the findings of this study are available from the corresponding author upon reasonable request.

Change history

16 July 2025
This article has been retracted. Please see the Retraction Notice for more detail: https://doi.org/10.1038/s41556-025-01734-6

References

Iskratsch, T., Wolfenson, H. & Sheetz, M. P. Appreciating force and shape—the rise of mechanotransduction in cell biology. Nat. Rev. Mol. Cell Biol. 15, 825–833 (2014).
Article CAS PubMed PubMed Central Google Scholar
Janmey, P. A., Fletcher, D. A. & Reinhart-King, C. A. Stiffness sensing by cells. Physiol. Rev. 100, 695–724 (2020).
Article CAS PubMed Google Scholar
Discher, D. E. et al. Matrix mechanosensing: from scaling concepts in 'omics data to mechanisms in the nucleus, regeneration, and cancer. Annu. Rev. Biophys. 46, 295–315 (2017).
Article CAS PubMed PubMed Central Google Scholar
Mohammadi, H. & Sahai, E. Mechanisms and impact of altered tumour mechanics. Nat. Cell Biol. 20, 766–774 (2018).
Article CAS PubMed Google Scholar
Humphrey, J. D. & Schwartz, M. A. Vascular mechanobiology: homeostasis, adaptation, and disease. Annu. Rev. Biomed. Eng. 23, 1–27 (2021).
Article CAS PubMed PubMed Central Google Scholar
De Belly, H., Paluch, E. K. & Chalut, K. J. Interplay between mechanics and signalling in regulating cell fate. Nat. Rev. Mol. Cell Biol. 23, 465–480 (2022).
Article PubMed Google Scholar
Romani, P., Valcarcel-Jimenez, L., Frezza, C. & Dupont, S. Crosstalk between mechanotransduction and metabolism. Nat. Rev. Mol. Cell Biol. 22, 22–38 (2021).
Article CAS PubMed Google Scholar
Dupont, S. & Wickström, S. A. Mechanical regulation of chromatin and transcription. Nat. Rev. Genet. 23, 624–643 (2022).
Article CAS PubMed Google Scholar
Phuyal, S., Romani, P., Dupont, S. & Farhan, H. Mechanobiology of organelles: illuminating their roles in mechanosensing and mechanotransduction.Trends Cell Biol. 33, 1049–1061 (2023).
Article CAS PubMed Google Scholar
Romani, P. et al. Mitochondrial fission links ECM mechanotransduction to metabolic redox homeostasis and metastatic chemotherapy resistance. Nat. Cell Biol. 24, 168–180 (2022).
Article CAS PubMed PubMed Central Google Scholar
Chen, K., Wang, Y., Deng, X., Guo, L. & Wu, C. Extracellular matrix stiffness regulates mitochondrial dynamics through PINCH-1- and kindlin-2-mediated signalling. Curr. Res. Cell Biol. 2, 100008 (2021).
Article CAS Google Scholar
Papalazarou, V. et al. The creatine–phosphagen system is mechanoresponsive in pancreatic adenocarcinoma and fuels invasion and metastasis. Nat. Metab. 2, 62–80 (2020).
Article CAS PubMed PubMed Central Google Scholar
Giacomello, M., Pyakurel, A., Glytsou, C. & Scorrano, L. The cell biology of mitochondrial membrane dynamics. Nat. Rev. Mol. Cell Biol. 21, 204–224 (2020).
Article CAS PubMed Google Scholar
Fenton, A. R., Jongens, T. A. & Holzbaur, E. L. F. Mitochondrial dynamics: shaping and remodeling an organelle network. Curr. Opin. Cell Biol. 68, 28–36 (2021).
Article CAS PubMed Google Scholar
Chan, D. C. Mitochondrial dynamics and its involvement in disease. Annu. Rev. Pathol. Mech. Dis. 15, 235–259 (2020).
Article CAS Google Scholar
Nikolopoulou, P. et al. Talin regulates steady-state tensional homeostasis to drive vascular morphodynamics and cancer. Preprint at bioRxiv https://doi.org/10.1101/2022.08.03.502607 (2022).
McBeath, R., Pirone, D. M., Nelson, C. M., Bhadriraju, K. & Chen, C. S. Cell shape, cytoskeletal tension, and RhoA regulate stem cell lineage commitment. Dev. Cell 6, 483–495 (2004).
Article CAS PubMed Google Scholar
Chen, C. S., Alonso, J. L., Ostuni, E., Whitesides, G. M. & Ingber, D. E. Cell shape provides global control of focal adhesion assembly. Biochem. Biophys. Res. Commun. 307, 355–361 (2003).
Article CAS PubMed Google Scholar
Fu, J. et al. Mechanical regulation of cell function with geometrically modulated elastomeric substrates. Nat. Methods 7, 733–736 (2010).
Article CAS PubMed PubMed Central Google Scholar
Aragona, M. et al. A mechanical checkpoint controls multicellular growth through YAP/TAZ regulation by actin-processing factors. Cell 154, 1047–1059 (2013).
Article CAS PubMed Google Scholar
Dhawan, S. S. et al. Shear stress and plaque development.Expert Rev. Cardiovasc. Ther. 8, 545–556 (2014).
Article Google Scholar
Coon, B. G. et al. A mitochondrial contribution to anti-inflammatory shear stress signaling in vascular endothelial cells. J. Cell Biol. 221, e202109144 (2022).
Article PubMed PubMed Central Google Scholar
Baeyens, N. et al. Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point. eLife 4, e04645 (2015).
Article PubMed PubMed Central Google Scholar
Song, M., Mihara, K., Chen, Y., Scorrano, L. & Dorn, G. W. Mitochondrial fission and fusion factors reciprocally orchestrate mitophagic culling in mouse hearts and cultured fibroblasts. Cell Metab. 21, 273–286 (2015).
Article CAS PubMed PubMed Central Google Scholar
Simpson, C. L. et al. NIX initiates mitochondrial fragmentation via DRP1 to drive epidermal differentiation. Cell Rep. 34, 108689 (2021).
Article CAS PubMed PubMed Central Google Scholar
Aragona, M. et al. Mechanisms of stretch-mediated skin expansion at single-cell resolution. Nature 584, 268–273 (2020).
Article CAS PubMed PubMed Central Google Scholar
Romani, P. et al. Extracellular matrix mechanical cues regulate lipid metabolism through Lipin-1 and SREBP. Nat. Cell Biol. 21, 338–347 (2019).
Article CAS PubMed Google Scholar
Bertolio, R. et al. Sterol regulatory element binding protein 1 couples mechanical cues and lipid metabolism. Nat. Commun. 10, 1326 (2019).
Article PubMed PubMed Central Google Scholar
Cassidy-Stone, A. et al. Chemical inhibition of the mitochondrial division dynamin reveals its role in Bax/Bak-dependent mitochondrial outer membrane permeabilization. Dev. Cell 14, 193–204 (2008).
Article CAS PubMed PubMed Central Google Scholar
Bordt, E. A. et al. The putative Drp1 inhibitor mdivi-1 is a reversible mitochondrial complex I inhibitor that modulates reactive oxygen species. Dev. Cell 40, 583–594.e6 (2017).
Article CAS PubMed PubMed Central Google Scholar
Wu, D. et al. Identification of novel dynamin-related protein 1 (Drp1) GTPase inhibitors: therapeutic potential of Drpitor1 and Drpitor1a in cancer and cardiac ischemia-reperfusion injury. FASEB J. 34, 1447–1464 (2020).
Article CAS PubMed Google Scholar
Brown, M. S., Radhakrishnan, A. & Goldstein, J. L. Retrospective on cholesterol homeostasis: the central role of Scap. Annu. Rev. Biochem. 87, 783–807 (2018).
Article CAS PubMed Google Scholar
Takashima, K. et al. COPI-mediated retrieval of SCAP is crucial for regulating lipogenesis under basal and sterol-deficient conditions. J. Cell Sci. 128, 2805–2815 (2015).
CAS PubMed Google Scholar
Enzo, E. et al. Aerobic glycolysis tunes YAP/TAZ transcriptional activity. EMBO J. 34, 1349–1370 (2015).
Article CAS PubMed PubMed Central Google Scholar
Santinon, G., Enzo, E. & Dupont, S. The sweet side of YAP/TAZ. Cell Cycle 14, 2543–2544 (2015).
Article CAS PubMed PubMed Central Google Scholar
Santinon, G. et al. dNTP metabolism links mechanical cues and YAP/TAZ to cell growth and oncogene-induced senescence. EMBO J. 37, e97780 (2018).
Article PubMed PubMed Central Google Scholar
Dupont, S. et al. Role of YAP/TAZ in mechanotransduction. Nature 474, 179–183 (2011).
Article CAS PubMed Google Scholar
Hamaratoglu, F. et al. The tumour-suppressor genes NF2/Merlin and Expanded act through Hippo signalling to regulate cell proliferation and apoptosis. Nat. Cell Biol. 8, 27–36 (2006).
Article CAS PubMed Google Scholar
Kim, N.-G. & Gumbiner, B. M. Cell contact and Nf2/Merlin-dependent regulation of TEAD palmitoylation and activity. Proc. Natl Acad. Sci. USA 116, 9877–9882 (2019).
Article CAS PubMed PubMed Central Google Scholar
Pocaterra, A. et al. F-actin dynamics regulates mammalian organ growth and cell fate maintenance. J. Hepatol. 71, 130–142 (2019).
Article CAS PubMed Google Scholar
Pocaterra, A. et al. Fascin1 empowers YAP mechanotransduction and promotes cholangiocarcinoma development. Commun. Biol. 4, 763 (2021).
Article CAS PubMed PubMed Central Google Scholar
Chandel, N. S. & Schumacker, P. T. Cells depleted of mitochondrial DNA (ρ⁰) yield insight into physiological mechanisms. FEBS Lett. 454, 173–176 (1999).
Article CAS PubMed Google Scholar
Ishihara, N., Jofuku, A., Eura, Y. & Mihara, K. Regulation of mitochondrial morphology by membrane potential, and DRP1-dependent division and FZO1-dependent fusion reaction in mammalian cells. Biochem. Biophys. Res. Commun. 301, 891–898 (2003).
Article CAS PubMed Google Scholar
Chakrabarti, R. et al. INF2-mediated actin polymerization at the ER stimulates mitochondrial calcium uptake, inner membrane constriction, and division. J. Cell Biol. 217, 251–268 (2018).
Article CAS PubMed PubMed Central Google Scholar
Nakamura, H. et al. ActuAtor, a Listeria-inspired molecular tool for physical manipulation of intracellular organizations through de novo actin polymerization. Cell Rep. 42, 113089 (2023).
Article CAS PubMed PubMed Central Google Scholar
Eura, Y., Ishihara, N., Yokota, S. & Mihara, K. Two mitofusin proteins, mammalian homologues of FZO, with distinct functions are both required for mitochondrial fusion. J. Biochem. 134, 333–344 (2003).
Article CAS PubMed Google Scholar
Chen, H. et al. Mitofusins Mfn1 and Mfn2 coordinately regulate mitochondrial fusion and are essential for embryonic development. J. Cell Biol. 160, 189–200 (2003).
Article CAS PubMed PubMed Central Google Scholar
Choi, S.-Y. et al. A common lipid links Mfn-mediated mitochondrial fusion and SNARE-regulated exocytosis. Nat. Cell Biol. 8, 1255–1262 (2006).
Article CAS PubMed Google Scholar
Adachi, Y. et al. Coincident phosphatidic acid interaction restrains Drp1 in mitochondrial division. Mol. Cell 63, 1034–1043 (2016).
Article CAS PubMed PubMed Central Google Scholar
Osellame, L. D. et al. Cooperative and independent roles of the Drp1 adaptors Mff, MiD49 and MiD51 in mitochondrial fission. J. Cell Sci. 129, 2170–2181 (2016).
Article CAS PubMed PubMed Central Google Scholar
Kalia, R. et al. Structural basis of mitochondrial receptor binding and constriction by DRP1. Nature 558, 401–405 (2018).
Article CAS PubMed PubMed Central Google Scholar
Fung, T. S., Chakrabarti, R. & Higgs, H. N. The multiple links between actin and mitochondria. Nat. Rev. Mol. Cell Biol. 24, 651–667 (2023).
Article CAS PubMed PubMed Central Google Scholar
Palmer, C. S. et al. Adaptor proteins MiD49 and MiD51 can act independently of Mff and Fis1 in Drp1 recruitment and are specific for mitochondrial fission. J. Biol. Chem. 288, 27584–27593 (2013).
Article CAS PubMed PubMed Central Google Scholar
Li, S. et al. Transient assembly of F-actin on the outer mitochondrial membrane contributes to mitochondrial fission. J. Cell Biol. 208, 109–123 (2015).
Article CAS PubMed PubMed Central Google Scholar
Elosegui-Artola, A. et al. Force triggers YAP nuclear entry by regulating transport across nuclear pores. Cell 171, 1397–1410.e14 (2017).
Article CAS PubMed Google Scholar
Aureille, J. et al. Nuclear envelope deformation controls cell cycle progression in response to mechanical force. EMBO Rep. 20, e48084 (2019).
Article PubMed PubMed Central Google Scholar
Guilluy, C. et al. Isolated nuclei adapt to force and reveal a mechanotransduction pathway in the nucleus. Nat. Cell Biol. 16, 376–381 (2014).
Article CAS PubMed PubMed Central Google Scholar
Niethammer, P. Components and mechanisms of nuclear mechanotransduction. Annu. Rev. Cell Dev. Biol. 37, 233–256 (2021).
Article CAS PubMed PubMed Central Google Scholar
Miroshnikova, Y. A. & Wickström, S. A. Mechanical forces in nuclear organization.Cold Spring Harb. Perspect. Biol. 14, a039685 (2022).
Article CAS PubMed PubMed Central Google Scholar
Alraies, Z. et al. Cell shape sensing licenses dendritic cells for homeostatic migration to lymph nodes.Nat. Immunol. 25, 1193–1206 (2024).
Article CAS PubMed PubMed Central Google Scholar
Sordella, R., Jiang, W., Chen, G.-C., Curto, M. & Settleman, J. Modulation of Rho GTPase signaling regulates a switch between adipogenesis and myogenesis. Cell 113, 147–158 (2003).
Article CAS PubMed Google Scholar
Hong, J.-H. et al. TAZ, a transcriptional modulator of mesenchymal stem cell differentiation. Science 309, 1074–1078 (2005).
Article CAS PubMed Google Scholar
Tang, Y. et al. MT1-MMP-dependent control of skeletal stem cell commitment via a β1-integrin/YAP/TAZ signaling axis. Dev. Cell 25, 402–416 (2013).
Article CAS PubMed PubMed Central Google Scholar
Picard, M. & Shirihai, O. S. Mitochondrial signal transduction. Cell Metab. 34, 1620–1653 (2022).
Article CAS PubMed PubMed Central Google Scholar
Cereghetti, G. M. et al. Dephosphorylation by calcineurin regulates translocation of Drp1 to mitochondria. Proc. Natl Acad. Sci. USA 105, 15803–15808 (2008).
Article CAS PubMed PubMed Central Google Scholar
Fung, T. S., Ji, W.-K., Higgs, H. N. & Chakrabarti, R. Two distinct actin filament populations have effects on mitochondria, with differences in stimuli and assembly factors. J. Cell Sci. 132, jcs234435 (2019).
Article CAS PubMed PubMed Central Google Scholar
Pangou, E. et al. A PKD–MFF signaling axis couples mitochondrial fission to mitotic progression. Cell Rep. 35, 109129 (2021).
Article CAS PubMed Google Scholar
Henschke, S. et al. Food perception promotes phosphorylation of MFFS131 and mitochondrial fragmentation in liver. Science 384, 438–446 (2024).
Article CAS PubMed Google Scholar
Ng, M. Y. W., Wai, T. & Simonsen, A. Quality control of the mitochondrion. Dev. Cell 56, 881–905 (2021).
Article CAS PubMed Google Scholar
Dayalan Naidu, S. & Dinkova-Kostova, A. T. Regulation of the mammalian heat shock factor 1. FEBS J. 284, 1606–1627 (2017).
Article CAS PubMed Google Scholar
Pernaute, B. et al. DRP1 levels determine the apoptotic threshold during embryonic differentiation through a mitophagy-dependent mechanism. Dev. Cell 57, 1316–1330.e7 (2022).
Article CAS PubMed PubMed Central Google Scholar
Bakare, A. B. et al. MitoCellPhe reveals mitochondrial morphologies in single fibroblasts and clustered stem cells. Am. J. Physiol. Cell Physiol. 321, C735–C748 (2021).
Article CAS PubMed PubMed Central Google Scholar
Khacho, M. et al. Mitochondrial dynamics impacts stem cell identity and fate decisions by regulating a nuclear transcriptional program. Cell Stem Cell 19, 232–247 (2016).
Article CAS PubMed Google Scholar
Baker, N. et al. The mitochondrial protein OPA1 regulates the quiescent state of adult muscle stem cells. Cell Stem Cell 29, 1315–1332.e9 (2022).
Article CAS PubMed PubMed Central Google Scholar
Hong, X. et al. Mitochondrial dynamics maintain muscle stem cell regenerative competence throughout adult life by regulating metabolism and mitophagy. Cell Stem Cell 29, 1298–1314.e10 (2022).
Article CAS PubMed Google Scholar
Bean, C. et al. The mitochondrial protein Opa1 promotes adipocyte browning that is dependent on urea cycle metabolites. Nat. Metab. 3, 1633–1647 (2021).
Article CAS PubMed Google Scholar
Mattner, L. F. et al. Phosphoproteomics of cellular mechanosensing reveals NFATC4 as a regulator of myofibroblast activity. Preprint at bioRxiv https://doi.org/10.1101/2023.02.13.528335 (2023).
Moore, J. et al. Multi-omics profiling of hypertrophic cardiomyopathy reveals altered mechanisms in mitochondrial dynamics and excitation–contraction coupling. Int. J. Mol. Sci. 24, 4724 (2023).
Article CAS PubMed PubMed Central Google Scholar
Maguire, S. L. et al. Three-dimensional modelling identifies novel genetic dependencies associated with breast cancer progression in the isogenic MCF10 model. J. Pathol. 240, 315–328 (2016).
Article CAS PubMed PubMed Central Google Scholar
Mäntylä, E. & Ihalainen, T. O. Brick Strex: a robust device built of LEGO bricks for mechanical manipulation of cells. Sci. Rep. 11, 18520 (2021).
Article PubMed PubMed Central Google Scholar
Wu, X. et al. A free-form patterning method enabling endothelialization under dynamic flow. Biomaterials 273, 120816 (2021).
Article CAS PubMed Google Scholar
Orsenigo, F. et al. Phosphorylation of VE-cadherin is modulated by haemodynamic forces and contributes to the regulation of vascular permeability in vivo. Nat. Commun. 3, 1208 (2012).
Article PubMed Google Scholar
Rezakhaniha, R. et al. Experimental investigation of collagen waviness and orientation in the arterial adventitia using confocal laser scanning microscopy. Biomech. Model. Mechanobiol. 11, 461–473 (2012).
Article CAS PubMed Google Scholar
Chen, K.-H. et al. Epigenetic dysregulation of the dynamin-related protein 1 binding partners MiD49 and MiD51 increases mitotic mitochondrial fission and promotes pulmonary arterial hypertension: mechanistic and therapeutic implications. Circulation 138, 287–304 (2018).
Article CAS PubMed PubMed Central Google Scholar
Rehman, J. et al. Inhibition of mitochondrial fission prevents cell cycle progression in lung cancer. FASEB J. 26, 2175–2186 (2012).
Article CAS PubMed PubMed Central Google Scholar

Download references

Acknowledgements

We are deeply indebted to S. Archer for sharing the Drpitor1a compound. We thank staff at the Mass Spectrometry core at the Telethon Institute of Genetics and Medicine for proteomic analyses; D. De Stefani for the Mito-Clover plasmid; M. Ryan, S. Manley and H. Perreten for the Dnm1l KO and Mief1 Mief2 Mff KO MEFs; B. Gumbiner for the NF2 KO MCF10A cells; T. Inoue and H. Nakamura for the ActuAtor plasmids; L. Scorrano and A. Maracani for the Mfn1 KO MEFs; B. Burke and Y. Loon for the Sun1-2 KO MEFs; P. Roca-Cusachs for the NESPRIN-KASH plasmids; C. Blanpain for consenting to the use of mouse skin transmission electron microscopy; and Jean-David Durussel for lending bricks for the stretching apparatus. Funding was provided by Worldwide Cancer Research (grant 21-0156), the AIRC Foundation (Investigator Grants 21392 and 28940), the CARIPARO Foundation (Ricerca Scientifica di Eccellenza 2023; Mitochondrial drugs to cure mechanotransduction disease (MINDED)), the Italian Ministry of University and Research (grants 2022T9RM8A and P2022CE7SP) and the National Recovery and Resilience Plan (funded by NextGenerationEU Mission 4, Component 2, Investment 1.3; CUP B73C22001250006 MechanoMet) (to S.D.); 2020, 2021 and 2022 Veronesi Foundation fellowships and AIRC MFAG 27453 (to P.R.); 2023 and 2024 Veronesi Foundation fellowships (to M.C.); a Giovanni Armenise–Harvard Foundation Award and European Research Council Starting Grant MetEpiStem (to G.M.); Telethon Foundation grant TMPGMFU22TT and AIRC MFAG 24856 (to P.G.); and Swiss National Science Foundation grant 205321_188828 (to C.G.). M. Aragona acknowledges that the Novo Nordisk Foundation Center for Stem Cell Medicine is supported by a Novo Nordisk Foundation grant (NNF21CC0073729). The Hellenic Foundation for Research and Innovation grant HFRI-FM17-2644 was awarded to V.K.

Author information

Authors and Affiliations

Department of Molecular Medicine, University of Padova, Padova, Italy
Patrizia Romani, Giada Benedetti, Martina Cusan & Sirio Dupont
Department of Biology, University of Padova, Padova, Italy
Mattia Arboit & Graziano Martello
Telethon Institute of Genetics and Medicine, Pozzuoli, Italy
Carmine Cirillo & Paolo Grumati
Department of Mechanical and Process Engineering, ETH Zurich, Zurich, Switzerland
Xi Wu & Costanza Giampietro
Institute for Bioinnovation, Biomedical Sciences Research Centre “Alexander Fleming”, Athens, Greece
Georgia Rouni & Vassiliki Kostourou
Novo Nordisk Foundation Center for Stem Cell Medicine (ReNEW), University of Copenhagen, Copenhagen, Denmark
Mariaceleste Aragona
Swiss Federal Laboratories for Materials Science and Technology, Dübendorf, Switzerland
Costanza Giampietro
Department of Clinical Medicine and Surgery, Federico II University, Naples, Italy
Paolo Grumati

Authors

Patrizia Romani
View author publications
Search author on:PubMed Google Scholar
Giada Benedetti
View author publications
Search author on:PubMed Google Scholar
Martina Cusan
View author publications
Search author on:PubMed Google Scholar
Mattia Arboit
View author publications
Search author on:PubMed Google Scholar
Carmine Cirillo
View author publications
Search author on:PubMed Google Scholar
Xi Wu
View author publications
Search author on:PubMed Google Scholar
Georgia Rouni
View author publications
Search author on:PubMed Google Scholar
Vassiliki Kostourou
View author publications
Search author on:PubMed Google Scholar
Mariaceleste Aragona
View author publications
Search author on:PubMed Google Scholar
Costanza Giampietro
View author publications
Search author on:PubMed Google Scholar
Paolo Grumati
View author publications
Search author on:PubMed Google Scholar
Graziano Martello
View author publications
Search author on:PubMed Google Scholar
Sirio Dupont
View author publications
Search author on:PubMed Google Scholar

Contributions

P.R. carried out most of the experiments and quantified and analysed the data with help from M.C. and G.B. M. Arboit performed RNA sequencing analysis with support from G.M. C.C. performed protein mass spectrometry analysis with support from P.G. X.W. performed the HUVEC flow experiments with support from C.G. G.R. performed the experiments with Talin1 KO mouse endothelial cells with support from V.K. M. Aragona provided the electron microscopy images of expanded mouse skin. S.D. conceptualized, coordinated and supervised the project and wrote the manuscript.

Corresponding author

Correspondence to Sirio Dupont.

Ethics declarations

Competing interests

The authors declare no competing interests.

Peer review

Peer review information

Nature Cell Biology thanks the anonymous reviewers for their contribution to the peer review of this work. Peer reviewer reports are available.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Reporting Summary

Peer Review File

Supplementary Table 1

Raw data and differential analyses of RNA sequencing and phosphoproteomics.

Cite this article

Romani, P., Benedetti, G., Cusan, M. et al. RETRACTED ARTICLE: Mitochondrial mechanotransduction through MIEF1 coordinates the nuclear response to forces. Nat Cell Biol 26, 2046–2060 (2024). https://doi.org/10.1038/s41556-024-01527-3

Download citation

Received: 18 July 2023
Accepted: 12 September 2024
Published: 21 October 2024
Version of record: 21 October 2024
Issue date: December 2024
DOI: https://doi.org/10.1038/s41556-024-01527-3

This article is cited by

Mechanical regulation of metabolism, epigenetics, and their interplay
- Hoonsik Nam
- Gyusang Yu
- Sungmin Nam
npj Biomedical Innovations (2026)
Biomechanics of the tumor extracellular matrix and regulatory T cells: regulatory mechanisms and potential therapeutic targets
- Wen-Bo Huang
- Heng-zhou Lai
- Feng-Ming You
Cell Communication and Signaling (2025)
Mechanical forces in the tumor microenvironment: roles, pathways, and therapeutic approaches
- Yanli Zhang
- Qi Fu
- Min Zhang
Journal of Translational Medicine (2025)
Extracellular matrix dynamics in tumor immunoregulation: from tumor microenvironment to immunotherapy
- Qin Hu
- Yifei Zhu
- Guoren Zhou
Journal of Hematology & Oncology (2025)
AIM2 activation mediated by RIPK1/3-dependent mitochondrial DNA release drives Aβ1−40-Induced retinal pigment epithelium injury
- Xiaoxu Huang
- Tongqi Li
- Junran Sun
Cell Communication and Signaling (2025)