Introduction

Coordinated activity between neurons and glial cells, including OLs, is necessary for effective brain function. OPCs receive synaptic inputs from neurons and release neuromodulators that enhance neuronal density, activity, local neural circuits, and synaptic plasticity1. However, the high metabolic rate of OLs renders them highly susceptible to oxidative stress, excitotoxicity, and inflammation2,3. Oxidative stress also activates microglia to produce neurotoxic factors, amplifying neuroinflammation and indirectly damaging OLs4,5.

VitC is a water-soluble micronutrient with well-established antioxidant and anti-inflammatory properties. Beyond its classic role as a cofactor for collagen synthesis, VitC directly scavenges reactive oxygen species (ROS) and regenerates other antioxidants (e.g., vitamin E)6. In the central nervous system (CNS), VitC is highly concentrated in neurons and glia7, where it modulates neurotransmitter synthesis, protects against lipid peroxidation, and attenuates microglial pro-inflammatory cytokine release8. Therefore, VitC was selected for this study based on its unique combination of potent direct antioxidant capacity, essential cofactor roles in epigenetic regulation and collagen synthesis, its notably high concentration in the CNS, and a well-established clinical safety profile, making it a compelling candidate for mitigating glial injury in conditions of oxidative stress.

Cortical OPCs and OLs were chosen for three reasons. First, cerebral white matter is highly vulnerable to hypoxic-ischemic injury, and cortical OPCs exhibit region-specific transcriptional profiles distinct from spinal counterparts9. Second, although our OGD/R model recapitulates acute injury, the cellular responses—apoptosis, impaired differentiation, and oxidative stress—mirror key features of chronic white matter disorders such as vascular dementia10,11,12. Third, cortical cells enhance translational relevance, as most clinical white matter pathology involves supratentorial regions. Under pathological conditions, OPCs proliferate and migrate to lesion sites but frequently fail to differentiate into myelinating OLs-a phenomenon termed “differentiation arrest” that is a hallmark of both acute demyelination and chronic hypoperfusion13,14. Mature OLs, by contrast, are metabolically active cells that support axonal energy metabolism; their dysfunction contributes to axonal degeneration independent of demyelination15. This stage-specific vulnerability and the central role of oxidative stress across acute and chronic settings underscore the rationale for investigating VitC as a protective agent.

Despite accumulating in vivo evidence that VitC supplementation reduces neuroinflammation and improves cognitive outcomes after hypoxic injury6,7,8, its direct effects on OLs and OPCs under oxidative stress remain poorly understood. Specifically, it is unclear whether VitC can (1) protect OPCs/OLs from apoptosis, (2) promote OPC differentiation, and (3) inhibit microglia-mediated inflammatory responses in a controlled in vitro model. To address this gap, we employed OGD/R-a validated in vitro model of ischemia-like oxidative stress-to investigate the protective effects of VitC on OPCs, OLs, and microglia. We hypothesized that VitC would reduce apoptosis, enhance OPC differentiation, and suppress pro-inflammatory cytokine expression in microglia, thereby providing mechanistic insights into its potential therapeutic utility for white-matter injury.

Materials and methods

Experimental design and grouping

Primary cell cultures were prepared from E19-E20 pregnant Sprague–Dawley (SD) rats (adult, weight 280–320 g, specific-pathogen-free grade, n = 18 litters; Animal Center of Xi’an Jiaotong University). Housing: SPF barrier, 22 ± 2 °C, 50–60% humidity, 12 h light/dark, ad libitum food & water. Euthanasia: Pregnant dams and pups were deeply anesthetized with isoflurane 5%, followed by cervical dislocation; death was confirmed by absence of heartbeat and respiration for ≥ 2 min.

All primary cell preparations were performed in a blinded fashion, i.e. the experimenter performing cell isolation was unaware of the future treatment allocation until the day of OGD/R. Animal care followed the Guide for the Care and Use of Laboratory Animals (8th ed.)16 and the ARRIVE 2.0 guidelines17. All protocols were approved by the Ethics committee of Shaanxi Provincial People’s Hospital (Ethics No. 2022K021).

Primary oligodendrocyte lineage cells (OPCs, OLs), BV2 microglia, and their co-cultures were used. Three experimental groups were defined: CON (normoxia, no VitC), OGD/R (OGD/R without VitC), and OGD/R+VitC (OGD/R with VitC). Experiments followed strict blinding. Replication was defined as: biological replicates (primary cells from independent litters or independent BV2 passages) ≥ 3; technical replicates (wells/fields/reactions per biological sample) ≥ 3. Specifics: CCK-8 (n = 4 biological replicates, 6 wells each); Immunofluorescence (n = 3, 5 fields each); qRT-PCR (n = 3, triplicate reactions each). Details are included in figure legends.

Oxygen–glucose deprivation/reoxygenation (OGD/R)

To initiate OGD/R, cells were cultured in glucose-free DMEM for 1 h in a tri-gas incubator. After removal of the glucose-free DMEM, the cells were grown in complete DMEM under 37 °C, 0.5% O2, 94.5% N2 and 5% CO2. During the experiment, cells were incubated with 95% air and 5% CO2, at 37 °C, for 24 h. Cells in the control group were not exposed to OGD/R18. Glucose-free DMEM: DMEM no glucose, no pyruvate (#11966-025, Gibco) supplemented with 1% antibiotic–antimycotic (#15240-062, Gibco). Complete DMEM: high-glucose DMEM (#11965-092, Gibco) + 10% FBS (#10099–141 C, Gibco) + 1% penicillin–streptomycin (#15140-122, Gibco). Tri-gas incubator: Heraeus HERAcell 150i, 0.5% O₂, 5%CO₂, 94.5% N₂, 37 °C, 95% humidity. Reoxygenation: cells returned to normoxic incubator (95% air, 5% CO₂, 37 °C) for 24 h. Duration optimization: preliminary CCK-8 assays (n = 4) showed 1 h OGD/R produced ~ 50% viability loss; hence 1 h OGD/R was adopted for all subsequent experiments. The 24-hour reoxygenation (R) period was selected based on our preliminary experiments and established models of in vitro ischemia-reperfusion injury. This timeframe allows for the full development of downstream consequences of the acute OGD/R insult, including the execution of apoptosis (peaking around 18–24 h post-insult in many neural cell models), significant changes in differentiation markers, and the robust transcription and translation of inflammatory mediators by activated microglia.

Primary culture of OPCs and microglia

Newborn SD rats were dissected out of their cerebral cortices in ice-cold HBSS, then minced and digested in 0.25% trypsin for 12 min (min). A 10% foetal bovine serum (FBS) in DMEM/F12 was used to terminate digestion. Cells were collected by centrifugation at 500 g for 5 min at 4 °C after the tissues were blown into a single-cell suspension with a pipette. Cells were then plated into a 75 cm2 flask precoated with poly-D-lysine. Incubations were performed at 37 °C with 5% CO2 in DMEM/F12 supplemented with 10% FBS. The medium was completely changed on days 2, 5, and 8 of the experiment. For day 8, the flask was shaken at 200 rpm for 2 h at 37 °C, and the medium was centrifuged at 300 g for 5 min to collect microglia. BV2 microglia culture conditions: 37 °C, 5% CO₂, 95% humidity, in DMEM/F-12 + 10% FBS + 1% P/S. OPC proliferation: PDGF-AA (20 ng/mL) + bFGF (10 ng/mL) on PDL-coated plates. For OPC purification, mixed glial cultures were shaken at 250 rpm for 16–18 h at 37 °C; detached cells were collected by centrifugation (200 g, 5 min) and resuspended in proliferation medium. OPCs were expanded for 48 h in proliferation medium: DMEM/F12 containing PDGF-AA (20 ng/mL) and bFGF (10 ng/mL) on PDL-coated plates19. For differentiation experiments, medium was switched to differentiation medium: Neurobasal-A supplemented with B27 (without vitamin A), N2, and T3 (30 ng/mL) for 72 h. Dissection buffer: ice-cold HBSS with Ca²⁺/Mg²⁺ free (#14175-095, Gibco) + 1% antibiotic–antimycotic. Digestion: 0.25% trypsin-EDTA (#25200-056, Gibco) pre-warmed to 37 °C for exactly 12 min; digestion was terminated with 3×volume of ice-cold 10% FBS-DMEM/F12. Seeding density: 2.5–3.0 × 10⁵ cells/cm² in PDL-coated (0.1 mg/mL, #P6407, Sigma) 75 cm² flasks. Microglia shake-off: orbital shaker (Thermo Fisher, MaxQ 4000) at 200 rpm, 37 °C, 2 h; purity ≥ 95% confirmed by Iba-1/CD11b double-immunofluorescence. OPC shake-off: 250 rpm, 16–18 h; purity ≥ 90% confirmed by PDGFRα⁺/O4⁺ staining. OPC proliferation medium: DMEM/F12 + 10%FBS + 20ng/mL PDGF-AA (#315 − 17, PeproTech) + 10ng/mL bFGF (#100-18B, PeproTech). OPC differentiation medium: Neurobasal-A (#10888-022, Gibco) + B27 without vitamin A (#12587-010, Gibco) + N2 (#17502-048, Gibco) + 30ng/mL T3 (#T6397, Sigma).

Apoptosis and differentiation of OPCs and apoptosis of OLs

The treatment Schedules were summarized in Table 1. VitC working solution: freshly prepared every experiment; filter-sterilised (0.22 μm) and kept dark at 4 °C; final concentration 5 µg/mL (selected from 1 to 20 µg/mL CCK-8 dose–response). Apoptosis endpoint: TUNEL⁺/DAPI⁺ ratio (≥ 500cells/condition, 5 random fields/well). Differentiation endpoint: MBP⁺/DAPI⁺ ratio after 72 h differentiation; MBP⁺ cells with processes ≥ 2× soma diameter counted as mature OLs. Method: MBP (myelin basic protein) was used to label glial cells, TUNEL staining label cell nuclei, and DAPI staining label cell apoptosis. Equipment: Olympus FV1200 confocal microscope, 20× objective, z-stack 1 μm step. Quantification: ImageJ v1.53c, blinded manual counting.

Table 1 Summary of treatment schedules for OPC apoptosis, OPC differentiation and OL apoptosis assays.
Full size table

Quantitative real-time PCR (QRT-PCR), ELISA, MDA and ROS

QRT-PCR: After 36 h of BV2 cells inoculated into plates, OGD/R (with glucose-free DMEM) + VitC treatment was performed. 1 h later, OGD/R (in complete DMEM) + VitC treatment was performed. 24 h later, cell samples were collected. QRT-PCR was used to measure the expression intensity of different genes. The purity of RNA was determined using a NanoDrop 2000 spectrophotometer after total RNA was extracted from cells using TRIzol reagent. The ultramicro nucleic acid detector detected the amount of RNA present. The RNA underwent reverse transcription to form complementary DNA using the PrimeScript™ RT Reagent Kit from Takara in Tokyo, Japan. Subsequently, QRT-PCR was performed with the SYBR Green PCR Mix Kit from Takara, following the provided guidelines. Analysis of the results was conducted utilizing the ∆∆CT (cycle threshold) method to quantify the data18. Actb was used as an internal control. Primer sequences used in this study were as follows: Actb: forward: 5′- CGGTTCCGATGCCCTGAGGCTCTT-3′, reverse: 5′- CGTCACACTTCATGATGGAATTGA-3′; IL1: forward: 5′-TGGCAACTGTTCCTG-3′, reverse: 5′- GGAAGCAGCCCTTCATCTTT − 3′20;IL6: forward: 5′- CAAAGCCAGAGTCCTTCAGAG − 3′, reverse: 5′- AGCATTGGAAATTGGGGTAG − 3′; IL10: forward: 5′- AGGCGCTGTCATCGATTT − 3′, reverse: 5′- CACCTTGGTCTTGGAGCTTAT − 3′; COX2: forward: 5′- TCCAACCTCTCCTACTACACCAG − 3′, reverse: 5′- GGGTCAGGGATGAACTCTCTC − 3′21;IFN-γ: forward: 5′- ATGAACGCTACACACTGCATC − 3′, reverse: 5′- CCATCCGTTTGCCAGTTCCTC − 3′22;TNF-a: forward: 5′- ACCGTCAGCcGATTTGCTAT − 3′, reverse: 5′- CTCCAAAGTAGACCTGCCCG − 3′. iNOS- forward: 5′- CCTCACCTACTTCCTGGACATCA-3′, reverse: 5′-GGGTTGTTGCTGAACTTCCAA-3′23. CD206: forward: 5′- CCTATGAAAATTGGGCTTACGG − 3′, reverse: 5′- CTGACAAATCCAGTTGTTGAGG − 3′24. RNA quality: 260/280 ratio 1.9–2.1, 260/230 ≥ 1.8 (NanoDrop 2000). RT reaction: PrimeScript RT Master Mix (#RR036A, Takara); 10 µL reaction, 37 °C 15 min, 85 °C 5 min. qPCR: TB Green Premix Ex Taq II (#RR820L, Takara); 10 µL system, triplicate wells/sample, Roche LightCycler 96. Cycling: 95 °C 30 s → 40 × (95 °C 5 s → 60 °C 30 s) → melt curve 65–95 °C.Efficiency: 90–105% (r² ≥ 0.99); melt-curve single peak. Normaliser: β-actin (Actb); 2^–∆∆CT method; results expressed as fold-change vs. CON.

ELISA

Conditioned media were collected from BV2 monocultures or OPC-BV2/OL-BV2 co-cultures at the end of the 24-hour reoxygenation period, centrifuged (500 × g, 10 min, 4 °C) to remove cell debris, and stored at − 80 °C until analysis. The concentrations of IL-1β, IL-6,TNF-α and IL-10 were quantified using commercially available sandwich ELISA kits (e.g., R&D Systems, Minneapolis, MN, USA or equivalent), strictly according to the manufacturer’s protocols. Briefly, 96-well plates pre-coated with capture antibodies were incubated with samples and standards. After washing, biotinylated detection antibodies were added, followed by streptavidin-HRP and substrate solution. The reaction was stopped with stop solution, and absorbance was measured at 450 nm (with reference at 570 nm) using a microplate reader (BioTek, Winooski, VT, USA). Cytokine concentrations were calculated from the standard curve generated for each assay. All samples were measured in duplicate, and results were expressed as pg/mL.

ROS and MDA

Intracellular ROS levels were determined using the DCFH-DA fluorescent probe (Beyotime, S0033S) according to manufacturer instructions. Briefly, cells were incubated with 10 µM DCFH-DA for 30 min at 37 °C, and fluorescence (ex/em: 488/530 nm) was measured and normalized to protein content. MDA was quantified using a commercial Lipid Peroxidation Assay Kit (Beyotime, S0131S). Cell lysates were reacted with TBA at 95 °C for 60 min, and absorbance at 532 nm was measured. MDA concentrations were calculated from a standard curve and normalized to total protein.

Co-culture of microglia with OPCs or OLs for apoptosis assessment and with OPCs for differentiation, all followed by qRT-PCR

The treatment Schedules were summarized in Table 2. Co-culture medium: 50% DMEM/F12 + 50% Neurobasal-A + 5% FBS + 1% N2 + 0.5% B27 + antibiotic–antimycotic. Cell ratio: OPCs/OLs: BV2 = 1:1.5 (final density 1 × 10⁵ cells/well in 24-well plate)25. Insert system: 0.4 μm pore PET inserts (#353095, Falcon) used for transwell (Corning #353095) co-culture microglia in lower chamber, OPCs/OLs on insert. Randomization: co-culture plates were coded (A, B, C…) by a second investigator; image acquisition and analysis performed blind.

Table 2 Treatment schedule for co-culture experiments.
Full size table

Immunofluorescence for cells

Cultured cells were washed with PBS three times and subsequently fixed using 4% paraformaldehyde (PFA) for 10 min at room temperature (RT). The cells were then washed again with PBS three times and blocked for 2 h at 4 °C in a solution containing 5% normal donkey serum and 0.3% Triton X-100 in PBS. Following this, the cells were incubated with primary antibodies (prepared in 2.5% NDS, 0.3% Triton X-100 in PBS) for 4 h at RT, and subsequently washed three times with PBS. The primary antibody used in this study is Rabbit anti-PDGFR alpha antibody. Afterwards, the cells were incubated with secondary antibodies (diluted in 2.5% NDS, 0.3% Triton X-100 in PBS) for 2 h at 4 °C, followed by three PBS washes. The secondary antibody utilized in this study was Dylight 488 goat anti-rabbit antibody. For OPC apoptosis staining, TUNEL was used to incubate the cells for 1 h at RT, then washed three times with PBS. For nuclear staining, the cells were exposed to DAPI for 10 min at RT, followed by another three washes with PBS. Finally, coverslips were mounted onto glass slides using a drop of Flurosave™ Reagent. Image acquisition was carried out with an Olympus FV1200 microscope19. Blocking buffer: 5% normal donkey serum + 0.3% Triton X-100 in PBS, 2 h, 4 °C. Primary antibodies: rabbit anti-PDGFRα (1:50, #ab203491, Abcam, Lot GR336298-11); mouse anti-MBP (1:200, #SMI-94R, BioLegend); rabbit anti-Iba-1 (1:500, #019–19741, Wako). Secondary antibodies: Alexa Fluor 488/555 donkey anti-rabbit or anti-mouse (1:400, #A21206, #A31572, Invitrogen). TUNEL: In Situ Cell Death Detection Kit, Fluorescein (#11684795910, Roche); 1 h, 37 °C, dark. Image acquisition: Olympus FV1200 confocal, 20× objective NA 0.75; z-stack 1 μm step; laser power and gain kept constant across groups. Quantification: ImageJ 1.53c, blind manual counting; ≥ 3 fields/well, ≥ 3 wells/group.

Calculation of additive amount in VitC cell culture medium

Previous animal experiment has found that26, administering appropriate doses of VitC [10.4, 31.2 mg/(kg·d)] in the diet during pregnancy can improve the cognitive function of offspring of SD rats exposed to mental restraint pressure. The mechanism may be that it reduces the mitochondrial damage of the brain cells of offspring and inhibit the oxidative stress response in the brain tissues. L-ascorbic acid (Sigma-Aldrich, A5960, purity ≥ 99%) was dissolved in ice-cold PBS immediately before use, while the specific amounts of additives still needed to be explored.

Statistics and reproducibility

GraphPad Prism 8.0 and SPSS23.0 were used for all data analyses. Mean values are presented with SD. All representative images, immunoblots, and statistical graphs are based on a minimum of three experiments, unless specified otherwise. Each data point in vitro represents a biological replicate. Statistical significance between two groups was determined using an unpaired two-tailed Student’s t test. Normal distribution of data was verified using the Shapiro-Wilk test, and homogeneity of variances was assessed using Levene’s test. For multiple group comparisons, one-way ANOVA was performed, followed by Tukey’s honestly significant difference (HSD) post hoc test when variances were equal, or Games-Howell post hoc test when variances were unequal. Statistical significance was defined as P < 0.05 (*), P < 0.01 (**), or P < 0.001 (***).

Results

Optimisation of OGD duration and VitC dose

We first determined the optimal OGD duration using BV2 microglia. Experiments (Fig. 1A) showed that OGD for 30 min only reduced BV2 cell viability by 12.9% (P = 0.42), failing to establish a stable oxidative stress model. OGD for 1 h caused a significant viability reduction (P < 0.001) without excessive cell death (no obvious morphological collapse). Longer durations (2–3 h) led to severe damage and no additional benefit, which was inconsistent with our research goal. To strengthen the methodological foundation, we conducted complementary CCK-8 assays on OPCs and OLs (differentiated for 5 days) exposed to 0.5 h, 1 h, and 2 h OGD. The results (Fig. 1A) confirmed that 1 h OGD also induced a substantial (~ 40–50%) reduction in viability in both OPCs and OLs, without causing overwhelming cell death, consistent with the BV2 data, thus justifying the selection of 1 h OGD for all subsequent experiments. Next, a dose–response curve (1–100 µg/mL VitC) was constructed under 1 h OGD in BV2, OPCs and OLs. 5 µg/mL VitC significantly restored viability of CON (P < 0.05) without further gain at higher doses (Fig. 1B). Consequently, 1 h OGD and 5 µg/mL VitC were used in all subsequent experiments.

Fig. 1
Fig. 1The alternative text for this image may have been generated using AI.
Full size image

Optimization of OGD duration and vitamin C dose. (A). Time-course injury(\(\:\stackrel{-}{X}\)±SD): BV2 viability (CCK-8) markedly decreased after 1 h OGD and remained low at 2–3 h (P<0.001 vs. CON); Similarly, viability of OPCs and OLs was substantially reduced after 1 h OGD and remained low at 2 h (P < 0.001 vs. CON). 1 h was selected for subsequent assays. (B). Dose–response protection of BV2, OPCs and OLs\(\:\stackrel{-}{X}\)±SD): following 1 h OGD, VitC (5–10 µg/mL) restored viability in a concentration-dependent manner (P< 0.05 vs. OGD/R); the minimal effective dose (5 µg/mL) was adopted for all experiments. Data are from n = 4 independent biological replicates (BV2 cells from 4 separate passages; primary OPCs/OLs from 4 litters), with 6 technical replicates.

VitC attenuated OGD/R-induced apoptosis of OPCs and OLs and rescued OPC differentiation

OGD/R increased apoptosis in OPCs (P < 0.01) and OLs (P < 0.01) relative to CON (Figs. 2A–B). VitC treatment reduced these values, respectively (P < 0.01 and P < 0.05 vs. OGD/R). Differentiation of OPCs into MBP⁺ OLs was significantly decreased compared to CON after OGD/R (P < 0.001), but recovered with VitC (P < 0.01 vs. OGD/R) (Fig. 2C). Mechanistically, OGD/R elevated intracellular ROS and MDA levels in OPCs and OLs, while VitC co-treatment attenuated these oxidative stress markers (all P < 0.05) (Fig. 2D).

Fig. 2
Fig. 2The alternative text for this image may have been generated using AI.
Full size image

OPC apoptosis, OL apoptosis and OL differentiation. (A). OPCs apoptosis(\(\:\stackrel{-}{X}\)±SD)(50 μm): PDGFRα⁺ OPCs showed a rise in TUNEL⁺ nuclei after OGD/R (P<0.01 vs. CON); 5 µg/mL VitC restored apoptosis to baseline (P < 0.01 vs. OGD/R). (B). OLs apoptosis \(\:\stackrel{-}{X}\)±SD (50 μm): MBP⁺ OLs displayed an increase in TUNEL⁺ cells following OGD/R (P < 0.01 vs. CON); VitC halved the apoptotic index (P<0.05 vs. OGD/R). (C). OLs differentiation \(\:\stackrel{-}{X}\)±SD (50 μm): Proportion of MBP⁺ mature OLs was significantly decreased compared to CON after OGD/R (P < 0.001); VitC recovered differentiation (P < 0.01 vs. OGD/R). (D). Oxidative stress markers \(\:\stackrel{-}{X}\)±SD: OGD/R elevated intracellular ROS and MDA levels in OPCs and OLs, while VitC co-treatment attenuated these oxidative stress markers (all P<0.05). Scale bar=50 μm and located in the bottom-right corner. Cells were subjected to 1 h OGD in the presence or absence of VitC (5 µg/mL), followed by 24 h reoxygenation with continuous VitC exposure where applicable. Data are from n = 3 independent biological replicates (primary OPCs/OLs from 3 litters), with ≥ 5 fields quantified per replicate.

VitC suppressed OGD/R-evoked pro-inflammatory cytokine expression in BV2 cells

OGD/R significantly up-regulated COX-2, IL-1β, IL-6, TNF-α, iNOS, CD206 and IL-10 mRNA (all P < 0.05) (Fig. 3A). VitC reversed the increase in COX-2, IL-1β, IL-6, iNOS and TNF-α (P < 0.05) while further elevating IL-10 and CD206 (P < 0.05), indicating a shift toward an anti-inflammatory phenotype. It was considered IFN-γ not expressed and therefore excluded due to the determined CQ value-35. OGD/R increased cytokine secretion, and VitC treatment significantly reduced pro-inflammatory (IL-1β, IL-6, TNF-α) while increasing anti-inflammatory (IL-10) protein levels with ELISA on conditioned media from BV2 monocultures (P < 0.05) (Fig. 3B).

Fig. 3
Fig. 3The alternative text for this image may have been generated using AI.
Full size image

Cytokine expression in BV2 microglia following 1 h OGD and 24 h reoxygenation (OGD/R) ± VitC (5 µg/mL). (A). RT-qPCR(\(\:\stackrel{-}{X}\)±SD): OGD/R up-regulated COX-2, IL-1β, IL-6, TNF-α, iNOS, CD206 and IL-10 mRNA (P<0.05 vs. CON). VitC reversed the increase in COX-2, IL-1β, IL-6, iNOS and TNF-α and further elevated IL-10 and CD206 (P < 0.05 vs. OGD/R). (B). ELISA\(\:\stackrel{-}{X}\)±SD: OGD/R increased, and VitC reduced IL-1β, IL-6, TNF-α while increasing IL-10 protein levels with ELISA on conditioned media from BV2 monocultures (P < 0.05). RT-qPCR data are from n = 3 independent biological replicates (BV2 cells from 3 independent passages), with triplicate technical replicates each. ELISA data are from n = 3 independent biological replicates, each measured in duplicate.

VitC replicated its protective profile in OPC-BV2 and OL-BV2 co-cultures

In OPC-BV2 co-culture, OGD/R increased OPC apoptosis (P < 0.001) and reduced differentiation of CON (P < 0.001); VitC normalised both parameters (P < 0.01) (Figs. 4A and 5A). Cytokine changes mirrored monoculture: VitC lowered COX-2, IL-1β, IL-6, TNF-α and iNOS while increasing IL-10 and CD206 (all P < 0.05) (Figs. 4B and 5B). ELISA of conditioned media from OPC/BV2 co-cultures showed consistent changes at the protein levels (IL-1β, IL-6, TNF-α, IL-10) (all P < 0.05) (Figs. 4C and 5C). OLs apoptosis was not altered by OGD/R in OL-BV2 co-culture (P-0.05) (Fig. 6A), suggesting mature OLs are relatively resistant to acute OGD/R stress in the presence of microglia (all P < 0.05) ((Fig. 6B and C).

Fig. 4
Fig. 4The alternative text for this image may have been generated using AI.
Full size image

OPCs apoptosis and microglial cytokine expressions in OPC/BV2 co-culture. (A). Apoptosis(\(\:\stackrel{-}{X}\)±SD)(50 μm): OGD/R increased TUNEL⁺/PDGFRα⁺ OPCs (P<0.001 vs. CON); VitC reduced apoptosis (P < 0.01 vs. OGD/R). (B). Cytokine expression (RT-qPCR) \(\:\stackrel{-}{X}\)±SD: OGD/R up-regulated COX-2, IL-1β, IL-6, TNF-α, iNOS, CD206 and IL-10 mRNA (P < 0.05 vs. CON). VitC reversed the increase in COX-2, IL-1β, IL-6, iNOS and TNF-α and further elevated IL-10 and CD206 (P<0.05 vs. OGD/R). (C). Cytokine expression (ELISA) \(\:\stackrel{-}{X}\)±SD: OGD/R increased, and VitC reduced IL-1β, IL-6, TNF-α while increasing IL-10 protein levels with ELISA on conditioned media collected from OPC-BV2 co-cultures at the end of the 24 h reoxygenation period (P < 0.05). Scale bar=50 μm and located in the bottom-right corner. Apoptosis data are from n = 3 independent biological replicates with ≥ 5 fields quantified per replicate; qPCR and ELISA data are from n = 3 independent biological replicates with triplicate and duplicate technical replicates, respectively.

Fig. 5
Fig. 5The alternative text for this image may have been generated using AI.
Full size image

OPCs differentiation and microglial cytokine expressions in OPC/BV2 co-culture. (A). Differentiation(\(\:\stackrel{-}{X}\)±SD)(50 μm): OGD/R raised the proportion of MBP⁺ OLs (P<0.001 vs. CON); VitC further elevated differentiation (P < 0.01 vs. OGD/R). (B). Cytokine expression (RT-qPCR) \(\:\stackrel{-}{X}\)±SD: OGD/R up-regulated COX-2, IL-1β, IL-6, TNF-α, iNOS, CD206 and IL-10 mRNA (P < 0.05 vs. CON). VitC reversed the increase in COX-2, IL-1β, IL-6, iNOS and TNF-α and further elevated IL-10 and CD206 (P<0.05 vs. OGD/R). (C). Cytokine expression (ELISA) \(\:\stackrel{-}{X}\)±SD: OGD/R increased, and VitC reduced IL-1β, IL-6, TNF-α while increasing IL-10 protein levels with ELISA on conditioned media collected from OPC-BV2 co-cultures at the end of the 48 h differentiation period following OGD/R (P < 0.05). Scale bar=50 μm and located in the bottom-right corner. Differentiation data are from n = 3 independent biological replicates with ≥ 5 fields quantified per replicate; qPCR and ELISA data are from n = 3 independent biological replicates with triplicate and duplicate technical replicates, respectively.

Fig. 6
Fig. 6The alternative text for this image may have been generated using AI.
Full size image

OLs apoptosis and microglial cytokine expressions in OL/BV2 co-culture. (A). OLs apoptosis(\(\:\stackrel{-}{X}\)±SD)(50 μm): MBP⁺/TUNEL⁺ counts remained unchanged across groups (P>0.05), indicating that OGD/R does not trigger OLs apoptosis in the mature OL–BV2 paradigm. (B). Cytokine expression (RT-qPCR) \(\:\stackrel{-}{X}\)±SD: OGD/R up-regulated COX-2, IL-1β, IL-6, TNF-α, iNOS, CD206 and IL-10 mRNA (P<0.05 vs. CON). VitC reversed the increase in COX-2, IL-1β, IL-6, iNOS and TNF-α and further elevated IL-10 and CD206 (P<0.05 vs. OGD/R). (C). Cytokine expression (ELISA) \(\:\stackrel{-}{X}\)±SD: OGD/R increased, and VitC reduced IL-1β, IL-6, TNF-α while increasing IL-10 protein levels with ELISA on conditioned media collected from OL-BV2 co-cultures at the end of the 24 h reoxygenation period (P < 0.05). Scale bar=50 μm and located in the bottom-right corner. Apoptosis data are from n = 3 independent biological replicates with ≥ 5 fields quantified per replicate; qPCR and ELISA data are from n = 3 independent biological replicates with triplicate and duplicate technical replicates, respectively.

Discussion

This study systematically investigated the multi-faceted protective effects of VitC on glial cells under oxidative stress conditions. We demonstrate that VitC (5 µg/mL) simultaneously protects oligodendrocyte lineage cells from OGD/R-induced damage and modulates microglial inflammatory responses through dual mechanisms. Our findings bridge in vitro observations with potential clinical translation.

We first established the comprehensive protective effects of VitC on oligodendrocyte lineage cells.

Consistent with the established vulnerability of OLs to oxidative stress2,3 and previous reports of OGD/R-induced damage11,12, we confirmed that OGD/R significantly increased apoptosis in both OPCs and mature OLs while severely impairing OPC differentiation. Importantly, VitC treatment not only reduced apoptosis but also restored differentiation capacity, indicating protection beyond mere cell survival. The magnitude of apoptosis reduction (~ 40–50% with VitC treatment) suggests substantial therapeutic potential.

To directly address the mechanistic basis of this protection, previously noted as speculative, we performed experiments measuring oxidative stress markers in purified oligodendrocyte lineage cells. We found that OGD/R significantly elevated intracellular ROS and MDA levels in both OPCs and OLs, while VitC co-treatment effectively attenuated these increases. This provides direct evidence that VitC’s core protective mechanism involves attenuation of oxidative damage within the oligodendrocyte lineage itself, thereby establishing a causal link between reduced oxidative stress and improved cellular outcomes. Furthermore, this direct antioxidant action provides the most parsimonious explanation for the coordinated effects observed: by scavenging ROS and reducing lipid peroxidation, VitC simultaneously mitigates the primary insult to OPCs/OLs (cells highly vulnerable to oxidative damage) and suppresses a key trigger (ROS) for microglial pro-inflammatory activation. This finding is particularly significant given the high metabolic rate and oxidative vulnerability of OLs2,3.

Beyond direct cellular protection, we demonstrated that VitC exerts immunomodulatory effects on microglia in a bidirectional manner. OGD/R activated BV2 microglia, upregulating pro-inflammatory markers (COX-2, IL-1β, IL-6, TNF-α, iNOS) while also increasing IL-10 and CD206. VitC treatment not only suppressed the pro-inflammatory response but further enhanced anti-inflammatory markers, suggesting active reprogramming rather than simple inhibition. This “bidirectional regulation” differs from traditional anti-inflammatory agents and may underlie VitC’s favorable safety profile in neuroinflammatory contexts.

Our co-culture experiments revealed critical insights into glial crosstalk under oxidative stress. In OPC-BV2 co-cultures, OGD/R-induced microglial activation promoted OPC apoptosis and impaired differentiation, effects that were reversed by VitC. Notably, mature OLs showed relative resistance to microglia-mediated damage in OL-BV2 co-cultures, suggesting stage-specific vulnerability within the oligodendrocyte lineage. This aligns with reports of higher basal antioxidant capacity in mature OLs12 and indicates that therapeutic strategies may need to consider the maturation state of target cells. The transwell system confirmed that these interactions are primarily mediated by soluble factors.

A particularly notable finding was the differential vulnerability of OLs to OGD/R-induced apoptosis in monoculture versus co-culture with microglia. While OGD/R significantly increased OL apoptosis in monoculture (Fig. 2B), this effect was completely abrogated in OL-BV2 co-cultures (Fig. 6A), despite concurrent upregulation of microglial pro-inflammatory cytokines. Several non-mutually exclusive explanations may account for this observation. First, microglia may exert context-dependent protective effects on mature OLs under acute stress, potentially through release of trophic factors such as IGF-1, BDNF, or activin A27,28,29, which are known to support OL survival. Second, mature OLs possess higher basal antioxidant capacity compared to OPCs12, which may render them relatively resistant to the additional inflammatory burden imposed by activated microglia. Third, the transwell configuration, while ideal for studying soluble factor-mediated crosstalk, may not fully recapitulate the more damaging contact-dependent interactions that occur in situ. Fourth, it is possible that the temporal dynamics differ: microglia-derived inflammatory mediators may require longer exposure or additional ‘second hits’ to induce OL apoptosis, whereas the direct oxidative insult in monoculture triggers rapid cell death. This resilience of mature OLs in co-culture is consistent with emerging literature suggesting that microglia can adopt a protective phenotype towards OLs under certain conditions25,30. Importantly, these findings do not diminish the pathological role of microglia in white matter injury, but rather highlight the cell stage-specific nature of glial crosstalk and suggest that therapeutic strategies may need to be tailored to the maturation state of target oligodendrocyte lineage cells.

Our findings must be interpreted in the context of methodological considerations. The differences between our results and some previous studies31,32 regarding VitC’s effects on OL differentiation may stem from several factors: (1) Cell source variations (cortical vs. spinal OPCs may have different regulatory pathways); (2) Treatment timing (simultaneous vs. delayed VitC administration); and (3) Model specificity (acute OGD/R vs. other stress paradigms). Our observation that delayed VitC treatment reduces efficacy underscores the importance of early intervention during oxidative stress.

Several aspects enhance the translational relevance of our study. The VitC concentration used (5 µg/mL ≈ 28 µM) falls within the range measured in human CSF after standard oral supplementation6,33 and is safely achievable with 1–2 g daily oral intake34,35. This pharmacological feasibility, combined with VitC’s established safety profile, supports its potential as a low-cost adjunctive therapy for white matter disorders.

We acknowledge several limitations that provide direction for future research. First, while the OGD/R model is widely used and effectively simulates acute ischemia-reperfusion injury, it does not fully recapitulate the complex, chronic pathological milieu of progressive white matter disorders such as multiple sclerosis or vascular dementia. Future studies employing chronic hypoxia or cuprizone models would complement our findings. Second, the 0.4 μm transwell co-culture system, while ideal for isolating soluble paracrine interactions, inherently excludes contact-dependent mechanisms including phagocytosis, trogocytosis, and CD200-CD200R signaling. This constitutes a recognized limitation and identifies an important avenue for future investigation using mixed glial cultures or in vivo systems. Third, our study focused on a single VitC concentration (5 µg/mL) based on dose-response optimization; whether higher or repeated dosing confers additional benefit remains unknown. Fourth, although we demonstrated VitC’s antioxidant effects, we did not investigate upstream signaling pathways (e.g., Nrf2, NF-κB) that may mediate these effects. Fifth, the use of BV2 microglia-while providing experimental consistency-may not fully capture the heterogeneity of primary microglia. Finally, our study was exclusively in vitro; in vivo validation in animal models of white matter injury is essential to establish therapeutic efficacy and optimal delivery routes.

These findings provide mechanistic evidence supporting VitC as a candidate for further evaluation in preclinical models of white matter injury. While our in vitro results are promising, translation to clinical applications will require validation in animal models and careful consideration of bioavailability and dosing regimens.