Abnormal development of gastrointestinal system of homozygous Foxp2(R552H)-mutated mice

Fujita-Jimbo, Eriko; Nakamura, Sachie; Sudo, Katsuko; Momoi, Takashi

doi:10.1038/s42003-025-08468-z

Download PDF

Article
Open access
Published: 17 July 2025

Abnormal development of gastrointestinal system of homozygous Foxp2(R552H)-mutated mice

Communications Biology volume 8, Article number: 1059 (2025) Cite this article

1754 Accesses
1 Altmetric
Metrics details

Subjects

Abstract

Forkhead box protein P2 (Foxp2) regulates the expression of genes related to organ morphogenesis. Homozygous Foxp2(R552H) knock-in (Foxp2^R552H/R552H) mice exhibit abnormal brain development, and die around the weaning period. Here we demonstrate that Foxp2^R552H/R552H mice exhibit abnormal development of gastrointestinal (GI) system, followed by atrophy of stomach, abnormal rotation of intestine, and decreased expression of genes related to GI system development such as bar-like home box 1 (BARX1) and secreted frizzled-related protein 1 (Sfrp1), antagonist for Wnt/β-catenin signaling, and decreased expression of E-cadherin and Zonula occludens-1 (ZO-1) in epithelium, followed with increase of Zonulin in the serum, marker of leaky gut, and decrease of alpha-smooth muscle actin (SMA) in smooth muscle, resulting in their atrophy. Foxp2^+/+ and Foxp2^R552H/R552H transgenic mice expressing Foxp2 promoter-mediated mCherry exhibit that Foxp2 autoregulates its expression in the developing stomach. Foxp2 may control Wnt/β-catenin signaling via its autoregulation system, but Foxp2(R552H) may not. Our results suggest that Foxp2 is necessary for the development of the GI system.

Sonic Hedgehog acts as a macrophage chemoattractant during regeneration of the gastric epithelium

Article Open access 12 January 2022

Epithelial zonation along the mouse and human small intestine defines five discrete metabolic domains

Article 06 February 2024

BECLIN1 is essential for intestinal homeostasis involving autophagy-independent mechanisms through its function in endocytic trafficking

Article Open access 20 February 2024

Introduction

Forkhead-box protein P2 (Foxp2) is a nuclear transcription factor that forms a complex with Foxp1, Foxp2, and Foxp4 (Foxp1/2/4)^1,2,3. Homozygous Foxp2-deficient mice exhibit abnormal development of various organs, including the brain, lung, and skeletal system⁴, suggesting that Foxp2 regulates the expressions of genes related to the development of these organs. Heterozygous R553H mutation of the human FOXP2 gene has been detected in the affected members of a large family with a monogenic speech and language disorder with orofacial motor impairment^5,6. FOXP2(R553H) lacks DNA-binding activity and transcriptional activity. Homozygous Foxp2(R552H) knock-in mice (Foxp2^R552H/R552H mice) have a mutation corresponding to the human FOXP2(R553H) mutation, and exhibit impairments of motor skills and ultrasonic vocalization⁷. Foxp2^R552H/R552H mice show abnormal cerebellum development, along with contraction of the ventral posterior part of the thalamus and the barrel in the cortex^7,8, and die around the weaning period at about 4 weeks after birth⁷.

Little is known about the cause of death of Foxp2^R552H/R552H mice. One possible explanation is that Foxp2^R552H/R552H mice cannot eat solid foods due to their motor dysfunctions; however, they die even when provided with enforced liquid food. Gastrointestinal (GI) functions, such as movement and digestion, are regulated by GI system including epithelium and smooth muscle layers, under control of the enteric nervous system (ENS), such as myenteric (Auerbach) plexuses and submucosal (Meissner) plexuses.

In the present study, we found that Foxp2^R552H/R552H mice also exhibit abnormal GI tract development, followed by atrophy of stomach and abnormal rotation of intestine. Therefore, we conducted additional investigations focusing on Foxp2 and GI system development and digestive function.

Development of the mouse GI system is controlled by Wnt signaling in embryonic days (E)10.5–14.5, during which the gut arises from endodermal tissue, forming organ tissue with multiple distinct structures and functions via mesenchymal–epithelial interactions⁹. Caudal-related homeobox transcriptional factors (CDX family proteins) play unique roles in axial patterning during gut development under several distinct signaling pathways, including Wnt/β-catenin signaling, while bar-like home box 1 (BARX1) promotes the expression of secreted frizzled-related protein (sFRP), a soluble antagonist for Wnt/β-catenin signaling, inducing the development of stomach from endodermal tissues^9,10; Barx1 promotes development of stomach smooth muscle cells and intestinal rotation¹¹.

In zebrafish, foxP2 expression was monitored by promoter-mediated EGFP expression¹². In the present study, we focused on the roles of Foxp2 during the development of the GI system. To this end, we used transgenic mice expressing Foxp2 promoter-mediated mCherry in the background of Foxp2^+/+ and Foxp2^R552H/R552H mice. Our results suggest the abnormal development of the GI system and its atrophy in Foxp2^R552H/R552H mice.

Results

Abnormal GI system in Foxp2 ^R552H/R552H mice

Foxp2^R552H/R552H mice exhibited abnormality of the GI system, including the stomach, cecum, and intestine at postnatal day (P) 28 (Fig. 1a); ballooned stomach (v) and cecum (iv and vii), abnormal intestinal rotation with gangrenous change (vi and viii). In Foxp2^R552H/R552H mice, percentages of individuals with abnormal GI tract such as ballooned organs (stomach and cecum, Fig. 1b–ii), abnormal intestinal rotation (Fig. 1b iii), abnormal ballooned organs with intestinal rotation (Fig. 1b–iv) were present in 72.7%, by 95.5%, by 72.7% of individuals, respectively, compared to Foxp2^+/+ mice. Among the 44 individuals tested, comprising 22 males and 22 females, no significant differences were observed between genders (Supplementary Fig. S1 for reference). Gastrointestinal hematoxylin and eosin (HE) staining of Foxp2^R552H/R552H mice showed atrophy in all GI tracts including esophagus, small intestine, cecum, and colon. On the other hand, the structure of the glands is abnormal in the corpus of the stomach of Foxp2^R552H/R552H mice (Fig. 1c–ix); Compared to Foxp2^+/+ mice, Foxp2^R552H/R552H mice exhibited smaller stomachs (Fig. 1d) and its thinner outer muscle layer (Fig. 1c). We performed qPCR analysis to examine how the homozygous R552H mutation influenced the expression of genes related to digestion function at P21 (Fig. 1e). Compared to Foxp2^+/+ mice, Foxp2^R552H/R552H mice exhibited downregulated expressions of secretin receptor (Sctr) and gastrin-releasing peptide receptor (Grpr), which are related to digestive function. The expression of Sctr reduced to 6.6% of the control expression, and the expression of Grpr reduced to 41.9% of the control expression.

**Fig. 1: Decreased gastric function in *Foxp2*^R552H/R552H mice and effects of *Foxp2* on gastrointestinal-related genes.**

Expression of mCherry in mCherry-Tg mouse embryos

We generated transgenic (Tg) mice expressing Foxp2 promoter-mediated mCherry (Foxp2^+/+/mCherry-Tg mice) to examine Foxp2 expression in the developing GI system of Foxp2 (Fig. 2). For this purpose, we used BAC clone (no. RP23-321I2)¹³, containing exon 1 and 178.6 kb upstream, promoter and enhancer region (Supplementary Fig. S2) which regulate the expression of Foxp2 in primarily nervous system, GI system including stomach and intestine at embryonic stages. mCherry was strongly expressed in various cartilage, groin and genital ridge, stomach (left and ventral panels), brain (anterior, ventral, left, and right panels), somite (left and right panels), and roof plate in the neural tube (dorsal and posterior) at E13.25 (Fig. 2a). Neural crest cells (NCCs) begin to migrate into the gut tube at E10.5, and the GI system develops from the gut tube into an organ with multiple distinct structures and function during E10.5–14.5⁹. Section analysis at E13.25 revealed that mCherry was mainly expressed in the GI tract (Fig. 2b), including the stomach, pyloric sphincter, and cecum, as well as in the ribs and vertebral body, and weakly expressed in forestomach, esophagus, and lung epithelium. The mCherry expression was not uniformly but regionally different in the GI tract. We focused on the mCherry expression in the developing stomach (E11.0–P29) (Fig. 3). Analysis revealed strong mCherry expression at E11, which spread across the lower part of the stomach at E16.5 and E18.5. At P13, mCherry expression was restricted to the corpus of the stomach. At P29, we detected stronger mCherry expression in the columnar epithelium of the corpus compared to in the esophagus, forestomach, pyloric sphincter, or gastro-duodenal junction.

**Fig. 2: Detection of mCherry in *Foxp2* promoter-mediated *mCherry-*Tg (*Foxp2*^+/+*/mCherry-Tg*) mice.**

**Fig. 3: The mCherry-positive area in the stomach of *Foxp2*^+/+/*mCherry*-Tg mice.**

Abnormal development GI system in Foxp2 ^R552H/R552H/mCherry-Tg mice

To clarify the relationship between Foxp2(R552H) and GI system abnormality, we generated Foxp2^R552H/R552H mice expressing mCherry (Foxp2^R552H/R552H/mCherry-Tg mice) (Supplementary Fig. S2). First, Foxp2^R552H/+ mice were mated with Foxp2^+/+/mCherry-Tg mice. Then the resulting Foxp2^R552H/+/mCherry-Tg offspring were mated with Foxp2^R552H/+ mice, thereby generating Foxp2^R552H/R552H/mCherry-Tg mice, which maintain one mCherry gene (Fig. 4).

**Fig. 4: Genotyping of *mCherry-*Tg mice with or without mutation.**

We examined the mCherry expression in the Foxp2^+/+/mCherry-Tg and Foxp2^R552H/R552H/mCherry-Tg mice at E10.5 (Fig. 5a). The mCherry intensities were weaker in the gut tube (closed arrowheads), NCCs (arrowheads) of Foxp2^R552H/R552H/mCherry-Tg mouse embryos compared to those of Foxp2 ^+/+/mCherry-Tg mouse embryos. In contrast with the heterogeneous and regional expression of mCherry in the GI tract at E13.25 (Fig. 2b and Supplementary Fig. S3), mCherry was almost uniformly expressed along proximal to distal axis in the gut tube of the Foxp2^+/+/mCherry-Tg mice at E10.5 (Fig. 5a).

**Fig. 5: Alterations of genes and mcherry expression induced in *Foxp2*^R552H/R552H/*mCherry*-Tg embryo.**

Next, we examined how Foxp2(R552H) influenced the expressions of genes related to the GI system development of the embryos at E12.5 (Fig. 5b). Compared to Foxp2^+/+ mice, Foxp2^R552H/R552H mice exhibited downregulated mRNA expression levels of Barx1 (73.8%), Sfrp1 (60.1%), Catenin Beta 1 (Ctnnb1) coding β-catenin (78.9%), which are related to Wnt signaling in stomach development; and of Rearranged during transfection encoding tyrosine kinase receptor (Ret) (51.6%) and a transcription factor Phox2B (39.2%), which are related to ENS development. Stomach was smaller in the Foxp2^R552H/R552H/mCherry-Tg mice at E13.5, compared to Foxp2^+/+/mCherry-Tg mice (Fig. 5c). BARX1 and mCherry expressions were mainly colocalized in both the inner circular and the outer longitudinal muscular layer of the stomach, and each decreased in the Foxp2^R552H/R552H/mCherry-Tg mice (Fig. 5d). BARX1 and mCherry mRNA expressions decreased by about 30% in the whole stomach of Foxp2^R552H/R552H/mCherry-Tg mice (Fig. 5e), compared to Foxp2^+/+/mCherry-Tg mice.

We histologically examined the influence of the Foxp2(R552H) mutation on the GI tract around the weaning period (Fig. 6). Compared to Foxp2^+/+/mCherry-Tg mice, the Foxp2^R552H/R552H/mCherry-Tg mice exhibited smaller stomachs with atrophic features and much lower mCherry expression at P20 (Fig. 6a). The mCherry positivity in stomach was attributed to the mucosal layer and smooth muscle (Fig. 6b). In Foxp2^R552H/R552H mice, the smooth muscle layer and columnar epithelium layer of the stomach were poorly developed with reduced thickness at P28 (Fig. 6b and c). On the other hand, the distribution of neural networks substructure of the gastric ENS exhibited a tendency to be sparser in the stomach of Foxp2^R552H/R552H mice at P8 as shown by acetylcholinesterase staining^14,15 (Supplementary Fig. S4a). The numbers of HuC/D-positive neuronal cells were not decreased in Foxp2^R552H/R552H mice at P8 (Supplementary Fig. S4b).

**Fig. 6: Stomach alterations in *Foxp2*^R552H/R552H/*mCherry*-Tg mice.**

To examine the cells expressing mCherry in the GI tract, we performed immunostaining with cell type-specific antibodies (Fig. 7a). The mCherry reactivities were observed in the cytoplasmic region of alpha-smooth muscle actin (SMA)-positive smooth muscle layer (Fig. 7a–i) and E-cadherin-positive (Fig. 7a–i and ii) and Zonula occludens-1 (ZO-1)-positive epithelium (Fig. 7a–v) of Foxp2^+/+/mCherry-Tg mice at P28. Compared to Foxp2^+/+/mCherry-Tg mice, Foxp2^R552H/R552H/mCherry-Tg mice exhibited very low levels of mCherry reactivities in the smooth muscle layer (Fig. 7a–ii, iv and vi) and decreased mRNA levels of SMA (56.6%), E-cadherin (36.2%), Zo-1 (57.5%) and mCherry (36.6%) (Fig. 7b). To examine the influence of the mutation on the epithelial barrier of GI tract, we focused on the level of Zonulin in the serum, marker of leaky gut¹⁶. Foxp2^R552H/R552H/mCherry-Tg exhibited about 3-fold higher Zonulin levels than Foxp2^+/+/mCherry-Tg mice (Fig. 7c).

**Fig. 7: The influence of *Foxp2*[R552H] mutation on the stomach epithelium.**

Discussion

Atrophy and dysfunction of the GI system in Foxp2 ^R552H/R552H mice

Foxp2^R552H/R552H mice exhibited decreased expression of genes related to digestive function in the stomach (Fig. 1). Additionally, the Foxp2^R552H/R552H mice exhibited atrophy of the GI tract, including the smooth muscle layers and epithelium of stomach. These results suggested that Foxp2 directly or indirectly promotes the development of epithelium and smooth muscle layer of the corpus with digestive functions (Fig. 6), while this activity is impaired in Foxp2(R552H). Thinning of tissue layers was observed throughout the homozygous GI tract, which could be due to lack of proper development, lack of tissue maintenance, or atrophy (Fig. 1c). Moreover, the observed ballooning of the Foxp2^R552H/R552H mice (Fig. 1a) may be due to a rapid decrease in the thickness of the intestinal wall.

Abnormal development of GI system and Foxp2(R552H) mutation

The smooth muscle layer and columnar epithelium layer of the stomach were poorly developed with reduced thickness in Foxp2^R552H/R552H mice (P28) (Fig. 6b and c). Early gut regionalization during E10.5–14.5 is mediated by transcriptional factors, such as Barx1 and Cdxs, in response to intercellular signals, including from Wnt/β-catenin signaling pathways⁹. Regional attenuation of these signals promotes stomach development; BARX1 promotes stomach development via SFRP1 expression antagonizing Wnt/β-catenin signaling. Barx1-deficient mice had significantly reduced stomach size⁹. Here we found that mCherry was colocalized with BARX1 (Fig. 5c and d) and more strongly expressed in the corpus (Fig. 3) where Wnt signaling is repressed⁹, and that Barx1 and Sfrp1 expressions were decreased in the stomach of the Foxp2^R552H/R552H mice at E12.5 (Fig. 5b).

Furthermore, forced expression of Barx1 in the intestinal mesenchyme expands smooth muscle compartments¹¹. Barx1 promotes the intestinal rotation¹¹, while Foxp2^R552H/R552H mice exhibited abnormal intestinal rotation (Fig. 1). mRNA and protein of Foxp1, 2 and 4 are expressed in GI tract^17,18. In the mouse stomach, mCherry was consistent with Foxp2 protein expression in the gastric mucosal layer, inner circular muscle layer, and outer longitudinal muscle layer as reported by Lu et al¹⁸. These results suggest that Foxp2 plays a role in the development of GI tract including stomach and intestine (Fig. 8a), through Wnt signaling via BARX1^9,19.

**Fig. 8: A possible molecular mechanism of *Foxp2*-mediated GI tract development.**

Foxp2 (R552H) may cause abnormal GI epithelial development with impaired tight junctions and adherens junctions, followed with leaky gut (Figs. 6 and 7a); In the gastrointestinal tract, tight junctions limit the permeation of substances, whereas adherens junctions firmly attach cells to each other and support the intestinal barrier function. E-cadherin, the main component of adherens junctions, and Zo-1, the component of tight junctions, down regulated in Foxp2^R552H/R552H mice, in which Zonulin level in serum, marker of leaky gut, increased (Fig. 7), suggesting that Foxp2^R552H/R552H/mCherry-Tg mice show leaky gut; Deceased E-cadherin and Zo-1 may impair barrier function, through which Zonulin pass into serum resulting in increase of Zonulin level in the serum of Foxp2^R552H/R552H/mCherry-Tg mice. One possible speculation is that secreted Zonulin may further stimulate degradation of tight junction proteins via activation of protease-activated receptor (PAR) 2, causing the uncontrol permeability and severe gastroenteritis including necrotizing enterocolitis and gangrenous change as shown in Fig.1a–vi and viii. However, the homozygous GI tract did not exhibit characteristics of necrosis, such as structural changes, cell swelling/loss of plasma integrity, or immune cell infiltration (Fig. 1c). Further histological analysis on the disruption of the blood supply, and/or bacterial infection of GI tract causing gangrenous change in the GI tract of Foxp2^R552H/R552H mice remain to be studied in future.

Sparse distribution of ENS and Foxp2(R552H) mutation

The ENS develops through the differentiation of enteric NCCs into enteric neurons (ENs). Vagal NCCs migrate into the GI system during embryonic days (E)10.5–14.5²⁰. Ret-null mice, a mouse model of Hirschsprung’s disease, display inhibited migration of NCCs into the GI system, causing aganglionosis due to the absence of ganglions in gut tissues, abnormality of the gut, and neonatal lethality²¹. RET inactivation late in ENS development leads to the death of ENs in the distal colon²². In addition to decreased mCherry intensity in the precursor cells of NCCs at the dorsal side of the neural tube (Fig. 5a), Foxp2^R552H/R552H mice exhibit decreased Ret mRNA levels in the GI system (Fig. 5b).

On the other hand, unlike the Hirschsprung model with suppressed Ret expression²¹, the numbers of HuC/D-positive cells were not decreased in the intestines of Foxp2^R552H/R552H mice on P8 (Supplementary Fig. S4b), but a tendency for sparser neural network distribution was shown by acetylcholinesterase^14,15 (Supplementary Figs. S4a and S5) and Protein gene product (PGP)9.5 in the ENS (Supplementary Fig. S6b). mCherry co-localized mainly with neural marker PGP9.5, but not with c-KIT, a specific marker of Interstitial Cells of Cajal (ICC) (Supplementary Fig. S6a). These results suggest that the decreased Ret or abnormal development of the GI system observed in Foxp2^R552H/R552H mice may not have influenced the migration and proliferation of ENs. However, Foxp2(R552H) may have influenced the differentiation of ENs into the ENS or may have more influence on GI tract development, including epithelium and smooth muscle (Fig. 8). It may also indirectly influence ENS differentiation. Thus, the tendency for a sparser distribution of the ENS in Foxp2^R552H/R552H mice, which is sufficiently not always statistically significant (Supplementary Figs. S4 and S6), may have been indirectly caused by abnormal GI tract development.

Furthermore, there have been several reports on variants of Hirschsprung’s disease that clinically resemble Hirschsprung’s disease despite the presence of ganglion cells in rectal suction biopsies; some variants include intestinal neuronal dysplasia, intestinal ganglioneuromatosis, immature ganglia, and congenital smooth muscle cell disorder²³. Thus, Foxp2^R552H/R552H/mCherry-Tg mice may be one of the useful mouse models for studying the relationship between abnormal development of GI system and variants of Hirschsprung’s disease in the future.

Regional and temporal mCherry expression during development

The mCherry expression was regionally and temporally changed during GI tract development from the GI tube (Figs. 2, 3 and 5a). Wnt/β-catenin signaling influences the early development of NCCs and GI system^24,25. In zebrafish, destruction of Lcf1/Tcf1 consensus sequence alters the foxP2 expression in the brain¹². Several Lcf1/Tcf1 consensus sequences are present in the nucleotide sequence of Foxp2 promoter used in this study¹², which was derived from a BAC clone²⁶. Taken together with these results, β-catenin regulates the gene expression via complex with Foxp2²⁷, suggesting that regional and temporal expression of mCherry in GI system during development is under the control of Wnt/β-catenin signaling. In addition, other intercellular signals such as SHH, FGF and retinoic acid from enteric mesenchyme and epithelium^9,19 may be also involved in the regional and temporal change of mCherry expression in the developing GI system (Fig. 8b).

Furthermore, mCherry was downregulated in the developing GI system of Foxp2^R552H/R552H mice during development (Figs. 5–7), suggesting that Foxp2 autoregulates its expression via binding on nucleotide sequence of the Foxp2 promoter or enhancer used in this study (Supplementary Fig. S2). One of the possible factors for Foxp2 autoregulation during development is FOXP2-binding partner, such as FOXP1, FOXP4, TBR1, and β-catenin^1,27,28 (Fig. 8b) because their heterodimer complexes with mutated FOXP2 may not function as normal transcriptional complex to promote mCherry expression in the developing GI system even when they form heterodimer complexes. Enhanced Foxp2 expression may promote its regional expression during organ development via autoregulation system (Fig. 8b). Foxp2 has been considered a transcriptional repressor⁴. However, recent accumulated evidence has suggested that Foxp2 has transcriptional activation as well^2,3,27,29. The members of Foxp family may have dual functions as transcription factors: they can function both as transcriptional activators and repressors³⁰.

In summary, our findings suggest that Foxp2^R552H/R552H mutation causes abnormal development of the GI tract from gut tube, resulting in GI dysfunction. Foxp2 may play a role in the development of GI system via its autoregulation and regulation of Wnt signaling. The Foxp2^+/+/mCherry-Tg mice and Foxp2^R552H/R552H/mCherry-Tg mice will be useful for further investigations of the molecular mechanisms regulating regional and temporal Foxp2 expression and dual functions, activator and repressor activity, of Foxp2 during development.

Methods

Animals

Our research complied with the fundamental principles for conducting animal experiments and associated practices in academic research institutions, in accordance with the guidelines provided by the Ministry of Education, Culture, Sports, Science and Technology. The Animal Care and Use Committees of Jichi medical university (approval numbers, H31-32, R4-09, 20130-1) and Tokyo medical university (approval numbers, R3-0078, D14007, 14134) approved all animal breeding and experimental procedures. We have complied with all relevant ethical regulations for animal use.

Using BAC transgenesis of the Foxp2 gene containing the Foxp2 promoter region, we generated Tg mice that specifically express Foxp2 promoter-mediated mCherry protein (mCherry-Tg mice, Supplementary Fig. S2). BAC transgenesis can integrate the transgene independent of position²⁶. To establish independent transgenic lines, we transferred the Foxp2 promoter-mediated mCherry gene through BAC recombination, and injected the linearized BAC transgene construct into pronucleus-stage mouse C57BL/6 N embryos. Foxp2(R552H) mice⁷ (RIKEN Bioresource Center, RBRC04060) have generated knock-in mice with a mutation corresponding to the human FOXP2(R553H) mutation. The Foxp2(R552H) mice have a genetic background shifted from 129sv to C57BL/6 J, while the mCherry-Tg mice have a background changed from C57BL/6 N to C57BL/6 J. Both were backcrossed for eight generations. Heterozygous Foxp2(R552H) mice and mCherry-Tg mice were crossed and used in the experiment. Experimental animals ranged from embryonic day 10.5 to postnatal day 29.

All mice were housed under specific pathogen-free (SPF) conditions on a 12-hour light/dark cycle, with unrestricted access to food and water. Additionally, the mice were monitored daily for signs of disease or mortality. The room temperature was maintained between 20 °C and 26 °C, and the humidity ranged from 40 to 70%.

This study was carefully designed to evaluate the sex influence as provided below. Pathological differences were initially evaluated (Fig. 1, Supplementary Fig. S1, and Supplementary file for Fig. 1b), and it was determined that sex did not contribute to these differences. This conclusion was consistently upheld across all subsequent experiments. Moreover, the sex of the embryos and immature mice is not a factor to be considered in this study because the digestive tract is formed regardless of sex. The results are as follows: Figs. 1 b, 1 d, 2a, parts of 3, 4, 5, 7c, S4, S5, and S6b present data encompassing both male and female mice. Figures 1 a, 1 c, 1 e, 2b, parts of 3, 6, 7a, 7b, S3, and S6a feature results exclusively from male mice, Fig. S1 displays abnormal digestive tract observed in female mice corresponding to male mice in Fig. 1a.

Mouse genotyping

To identify the wild-type and targeted alleles, we extracted genomic DNA (gDNA) from the tails of P3-5 mice and from the tails or limbs collected during fetal sampling, and performed PCR for genotyping. The following primer pairs were used: forward primer 5ʹ- GATGGTCAAGACCCACTAGT -3ʹ and reverse primer 5ʹ- AGGAGGAGACAGCATGCATT -3ʹ for Foxp2(R552H) mice; and forward primer 5ʹ- AGGACGGCGAGTTCATCTAC -3ʹ and reverse primer 5ʹ- TGGTGTAGTCCTCGTTGTGG -3ʹ for mCherry-Tg mice. The amplification protocol was as follows: 1 cycle at 95 °C for 3 min; 40 cycles at 95 °C for 30 s, 62 °C for 30 s, and 72 °C for 30 s; and 1 cycle at 72 °C for 7 min.

Quantitative real-time PCR

Total RNA was prepared from mice, using the RNeasy mini kit (Qiagen, Hilden, Germany) according to the manufacturer’s specifications. Complementary DNAs were synthesized from total RNA (1 µg) using reverse transcriptase (Invitrogen, MA, USA). Real-time PCR (qPCR) analysis was performed using the Applied Biosystems 7500 fast real-time PCR system (Applied Biosystems, CA, USA) with the TaqMan Gene Expression Assays (Applied Biosystems) based on published sequences for the following genes: mCherry, mouse Foxp2, Sctr, Grpr, Barx1, Sfrp1, Ctnnb1, Ret, Phox2B, Gastrin (FAM-labeled probe) and GAPD (VIC-labeled MGD probe). Gastrin, encoding Gastrin released from G cells, was used as a control in Fig. 1e. Gapd was served as an endogenous control in Figs. 5b, e, and 7b. For each sample, the 20 µL total volume comprised 10 µL TaqMan Fast Universal PCR Master Mix (2×; Applied Biosystems), 1 µL TaqMan Gene Expression Assays, and 1 µL of each first-strand cDNA sample. The real-time PCR fragments were amplified as follows: 1 cycle at 95 °C for 20 s; followed by 60 cycles at 95 °C for 3 s, and 60 °C for 30 s.

Detection of mCherry-Tg expression in whole bodies and organs

The expression was viewed using a Leica Stereo Microscope and imaging system M165FC (Leica Microsystems, Wetzlar, Germany).

Immunofluorescence for sections

Mice were washed with phosphate-buffered saline (PBS) adjusted to pH 7.4, and then fixed with 4% paraformaldehyde in PBS at 4 °C overnight. This procedure aimed to preserve the cellular and tissue structures in a condition suitable for observation. Next, they were sequentially soaked overnight at 4 °C in 10%, then 20%, and 30% sucrose/PBS at each concentration, then embedded in optimal cutting temperature (O.C.T.) compound (Sakura Finetec, CA, USA), and frozen. Frozen 10 μm-thick sections were cut on a cryostat and attached to MAS-coated slides (Matsunami Glass, Osaka, Japan).

The sections were acclimated at room temperature for 15 min before undergoing the staining process. They were washed three times with PBS and blocked for one hour at room temperature (RT) with PBS containing 0.1% skim milk and 0.1% Triton X-100 to prevent nonspecific binding. Subsequently, the primary antibodies specific to the target protein, including polyclonal rabbit anti-Barx1 (Abcam, Cambridge, UK, 1:200), monoclonal mouse anti-ZO-1 (Sanko Junyaku Co., Ltd., Tokyo, Japan, 1:200), rabbit anti-SMA (Abcam, 1:1000) and rat anti-E-cadherin (Takara Bio, Shiga, Japan, 1:200) were diluted at their respective dilution ratios in a solution of PBS containing 1% skim milk and 0.1% Triton X-100 and incubated overnight at 4 °C. The following day, the sections were washed three times with PBS and incubated with fluorescently labeled secondary antibodies, Alexa Fluor 488-conjugated secondary antibodies against mouse, rabbit and rat IgG (Molecular Probes in Eugene, Oregon, USA) diluted to 1:200, at room temperature for two hours. Nuclei were stained with Hoechst 33342 (1:5000) from Molecular Probes at 37 °C for 15 min. The staining process was conducted according to the experimental schedule. Furthermore, the primary antibodies were used to determine the localization of the target protein, and the fluorescently labeled secondary antibodies enabled visualization using an Olympus FLUOVIEW FV1000 confocal laser scanning microscope (Olympus, Tokyo, Japan).

Whole-mount immunofluorescence

Whole embryos, their stomachs and pieces of GI tract from postnatal mice were washed with PBS, and then fixed with 4% paraformaldehyde in PBS for at least 12 h at 4 °C or acetone at least one hour at −20 °C, and blocked using buffer (5% goat serum, 0.1% Triton X-100 in PBS) for one hour at RT to prevent nonspecific binding. Samples were then incubated with primary antibodies [polyclonal rabbit anti-Barx1 (Abcam, 1:200), monoclonal rat anti-CD117 (c-Kit; eBioscience, Wien, Austria, 1:500)³¹, polyclonal rabbit anti-PGP9.5 (Ultraclone, Cambridge, UK, 1:1000)³², and polyclonal rabbit anti-HuC/D (Abcam, 1:400)], diluted in blocking buffer, and rotated overnight at 4 °C. The secondary antibodies were rat IgG and rabbit Alexa Fluor 488 and/or 594 conjugated antibodies (Molecular Probes, 1:500). Visualization was performed using a light and fluorescence Stereo microscopy and imaging system M165FC (Leica Microsystems), and light and fluorescence microscopy a AX70 microscope with an DP73 camera (Olympus, Tokyo, Japan) and BZ-X800 (Keyence, Itasca, IL, USA). Data presented in Supplementary Figs. S4 and S6b were quantified using ImageJ software, developed by the National Institutes of Health (NIH), USA.

Acetylcholinesterase histochemistry

The procedure was conducted using documented methods¹⁵, as detailed below. The gut was dissected as a single piece from the proximal esophagus to the large intestine, and washed with PBS, and fixed in 4% paraformaldehyde in PBS overnight at 4 °C. The gut was then incubated in buffer (0.2 mM ethopropazine HCl, 4 mM acetylthiocholine iodide, 10 mM glycine, 2 mM cupric sulfate, and 65 mM sodium acetate) for 2–4 hr. Staining for acetylcholinesterase was developed by incubating for 1.5 min in 1.25% sodium sulfide. Tissues were rinsed extensively with water. It was obtained by flattening the tissue with the serous side up and mounting 50% glycerol before shooting. Gut images were captured on an Olympus microscope (AX70) with a digital camera (DP73).

H&E staining

Tissues from mice and control mice were washed with PBS and soaked in 10% formalin in PBS for 24 h at 4 °C. After dehydration, tissues were immersed in paraffin followed by paraffin block preparation. Thin sections are then cut into 6-micro meter-thick sections. Sections were then deparaffinized and subjected to deparaffinization, hematoxylin staining for nuclear visualization, eosin staining for cytoplasmic staining, and finally, dehydration and mounting. Visualization was performed using an Olympus microscope (AX70) with a digital camera (DP73).

Measurement of zonulin

Serum samples were prepared by centrifuging whole blood collected from mice for 10 min at 2000 × g. The concentration of Zonulin¹⁶ was measured using a mouse Zonulin ELISA kit (Mybioscience, San Diego, CA, USA) with 10 µL of serum, which is based on Zonulin antibody-Zonulin antigen interactions and an HRP colorimetric detection system to detect Zonulin antigen targets in samples.

Statistics and reproducibility

Statistical analyses were performed using GraphPad Prism software, version 7.0 (GraphPad Software Inc., CA, USA). The sample size was determined based on previous literature, preliminary experiments, available resources, and ethical principles regarding animal use. The number of mouse samples used is specified in the figure legends. Each mouse underwent three repeated measurements, which were considered technical replicates rather than independent samples (Figs. 1, 5, and 7). In contrast, measurements in Supplementary Figs. S4 and S6 were treated as independent values. Data were compared between samples using the Mann–Whitney U test. Results are expressed as the mean ± standard error of the mean (SEM). For statistical comparisons among experimental data, the significance level was set at *P < 0.05, **P < 0.01, ***P < 0.001.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

Supplementary Data includes the source data for the graphs presented in the main figures. Supplementary Information provides the original uncropped gel image from the main Fig. 4 (shown as Supplementary Fig. S7). The other data supporting the findings of this study are available from the corresponding author upon reasonable request.

References

Li, S., Weidenfeld, J. & Morrisey, E. E. Transcriptional and DNA binding activity of the Foxp1/2/4 family is modulated by heterotypic and homotypic protein interactions. Mol. Cell Biol. 24, 809–822 (2004).
Article CAS PubMed PubMed Central Google Scholar
Spiteri, E. et al. Identification of the transcriptional targets of FOXP2, a gene linked to speech and language, in developing human brain. Am. J. Hum. Genet. 81, 1144–1157 (2007).
Article CAS PubMed PubMed Central Google Scholar
Vernes, S. C. et al. High-throughput analysis of promoter occupancy reveals direct neural targets of FOXP2, a gene mutated in speech and language disorders. Am. J. Hum. Genet. 81, 1232–1250 (2007).
Article CAS PubMed PubMed Central Google Scholar
Shu, W. et al. Altered ultrasonic vocalization in mice with a disruption in the Foxp2 gene. Proc. Natl. Acad. Sci. USA 102, 9643–9648 (2005).
Article CAS PubMed PubMed Central Google Scholar
Lai, C. S., Fisher, S. E., Hurst, J. A., Vargha-Khadem, F. & Monaco, A. P. A forkhead-domain gene is mutated in a severe speech and language disorder. Nature 413, 519–523 (2001).
Article CAS PubMed Google Scholar
Vargha-Khadem, F., Gadian, D. G., Copp, A. & Mishkin, M. FOXP2 and the neuroanatomy of speech and language. Nat. Rev. Neurosci. 6, 131–138 (2005).
Article CAS PubMed Google Scholar
Fujita, E. et al. Ultrasonic vocalization impairment of Foxp2 (R552H) knockin mice related to speech-language disorder and abnormality of Purkinje cells. Proc. Natl. Acad. Sci. USA 105, 3117–3122 (2008).
Article CAS PubMed PubMed Central Google Scholar
Ebisu, H., Iwai-Takekoshi, L., Fujita-Jimbo, E., Momoi, T. & Kawasaki, H. Foxp2 regulates identities and projection patterns of thalamic nuclei during development. Cereb. Cortex. 27, 3648–3659 (2017).
PubMed Google Scholar
Kim, B. M. & Shivdasani, R. A. Stomach development, stem cells and disease. Development 143, 554–565 (2016).
Article CAS PubMed PubMed Central Google Scholar
McCracken, K. W. & Wells, J. M. Mechanism of embryonic stomach development. Stem Cell Dev. Biol. 66, 36–42 (2017).
CAS Google Scholar
Jayewickreme, C. D. & Shivdasani, R. A. Control of stomach smooth muscle development and intestinal rotation by transcription factor BARX1. Dev. Biol. 405, 21–32 (2015).
Article CAS PubMed PubMed Central Google Scholar
Bonkowsky, J. L. et al. Domain-specific regulation of foxP2 CNS expression by lef1. BMC Dev. Biol. 8, 103 (2008).
Article PubMed PubMed Central Google Scholar
Cunningham, F. et al. Ensembl 2022. Nucleic Acids Res. 50, D988–D995 (2022).
Article CAS PubMed Google Scholar
Cantrell, V. A. et al. Interactions between Sox10 and EdnrB modulate penetrance and severity of aganglionosis in the Sox10Dom mouse model of Hirschsprung disease. Hum. Mol. Genet. 13, 2289–2301 (2004).
Article CAS PubMed Google Scholar
Enomoto, H. et al. GFRα1-deficient mice have deficits in the enteric nervous system and kidneys. Neuron 21, 317–324 (1998).
Article CAS PubMed Google Scholar
Fasano, A. Zonulin and its regulation of intestinal barrier function: the biological door to inflammation, autoimmunity, and cancer. Physiol. Rev. 91, 151–175 (2011).
Article CAS PubMed Google Scholar
Shu, W., Yang, H., Zhang, L., Lu, M. M. & Morrisey, E. E. Characterization of a new subfamily of winged- helix/forkhead (Fox) genes that are expressed in the lung and act as transcriptional repressors. J. Biol. Chem. 276, 27488–27497 (2001).
Article CAS PubMed Google Scholar
Lu, M. M., Li, S., Yang, H. & Morrisey, E. E. Foxp4: a novel member of the Foxp subfamily of winged-helix genes co-expressed with Foxp1 and Foxp2 in pulmonary and gut tissues. Mech. Dev. 119, S197–S202 (2002).
Article PubMed Google Scholar
Kim, B. M., Buchner, G., Miletich, I., Sharpe, P. T. & Shivdasani, R. A. The stomach mesenchymal transcription factor Barx1 specifies gastric epithelial identity through inhibition of transient WNT signaling. Dev. Cell. 8, 611–622 (2005).
Article CAS PubMed Google Scholar
Nishiyama, C. et al. Trans-mesenteric neural crest cells are principal source for the colonic enteric nervous system. Nat. Neurosci. 15, 1211–1218 (2012).
Article CAS PubMed Google Scholar
Uesaka, T., Nagashimada, M., Yonemura, S. & Enomoto, H. Diminished Ret expression compromises neuronal survival in the colon and causes intestinal aganglionosis in mice. J. Clin. Invest. 118, 1890–1898 (2008).
Article CAS PubMed PubMed Central Google Scholar
Schuchardt, A., D’Agati, V., Larsson-Blomberg, L., Costantini, F. & Pachnis, V. Defects in the kidney and enteric nervous system of mice lacking the tyrosine kinase receptor Ret. Nature 367, 380–383 (1994).
Article CAS PubMed Google Scholar
Friedmacher, F. & Puri, P. Classification and diagnostic criteria of variants of Hirschsprung’s disease. Pediatr. Surg. Int. 29, 855–872 (2013).
Article PubMed Google Scholar
Dorsky, R. I., Moon, R. T. & Raible, D. W. Control of neural crest cell fate by the Wnt signalling pathway. Nature 396, 370–373 (1998).
Article CAS PubMed Google Scholar
Sutton, G., Kelsh, R. N. & Scholpp, S. The Role of Wnt/β-catenin signaling in neural crest. Development in Zebrafish. Front Cell Dev. Biol. 9, 782445 (2021).
Article PubMed PubMed Central Google Scholar
Yang, X. W., Model, P. & Heintz, N. Homologous recombination based modification in Escherichia coli and germline transmission in transgenic mice of a bacterial artificial chromosome. Nat. Biotechnol. 15, 859–865 (1997).
Article CAS PubMed Google Scholar
Richter, G. et al. β-catenin regulates FOXP2 transcriptional activity via multiple binding sites. FEBS J. 288, 3261–3284 (2021).
Article CAS PubMed Google Scholar
Deriziotis, P. et al. De novo TBR1 mutations in sporadic autism disrupt protein functions. Nat. Commun. 5, 4954 (2014).
Article CAS PubMed Google Scholar
Hickey, S. L., Berto, S. & Konopka, G. Chromatin decondensation by FOXP2 promotes human neuron maturation and expression of neurodevelopmental disease genes. Cell Rep. 27, 1699–1711 (2019).
Article CAS PubMed PubMed Central Google Scholar
den Hoed, J., Devaraju, K. & Fisher, S. E. Molecular networks of the FOXP2 transcription factor in the brain. EMBO Rep. 22, e52803 (2021).
Yamataka, A. et al. A lack of intestinal pacemaker (c-kit) in aganglionic bowel of patients with Hirschsprung’s disease. J. Pediatr. Surg. 995 30, 441–444 (1995).
Article CAS Google Scholar
Thompson, R. J., Doran, J. F., Jackson, P., Dhillon, A. P. & Rode, J. PGP 9.5–a new marker for vertebrate neurons and neuroendocrine cells. Brain Res. 278, 224–228 (1983).
Article CAS PubMed Google Scholar

Download references

Acknowledgements

We sincerely thank Dr. H. Osaka and Dr. T. Yamagata (Jichi medical university) for supporting the experiments, Ms. N. Omika (Jichi medical university) for support with sample collection and analysis, Ms. M. Shindo-Murakoshi for providing experimental support, and Dr. A. Shiota (Institute of Immunology Co., Ltd.) for their invaluable assistance in the generation of genetically modified mice. We also acknowledge Dr. G. Kawahara, Dr. E. Wada and Dr. YK. Hayashi (Tokyo Medical University) for providing experimental support. We are grateful to the staff at the animal center for their support in mouse maintenance (Jichi medical university and Tokyo Medical University). Additionally, we are grateful to Dr. P. Kretschmer (San Francisco Edit) for proofreading and improving the English language of this manuscript. This work was supported by Grants-in-Aid for Scientific Research (KAKENHI) from the Ministry of Education, Culture, Sports, Science and Technology, Japan (grant numbers 15K06716, 15K06744, 20K08166, 23K07342), and Asahi Glass Foundation. The funders had no role in the design of the study, data collection, analysis, or the publication of the results. This research was conducted in Japan.

Author information

Authors and Affiliations

Department of Pediatrics, Jichi Medical University, 3311-1 Yakushiji, Shimotsuke-shi, Tochigi, Japan
Eriko Fujita-Jimbo & Sachie Nakamura
Preclinical Research Center, Tokyo Medical University, 6-1-1, Shinjuku, Shinjuku- ku, Tokyo, Japan
Katsuko Sudo
Department of Pathophysiology, Tokyo Medical University, 6-1-1, Shinjuku, Shinjuku-ku, Tokyo, Japan
Takashi Momoi

Authors

Eriko Fujita-Jimbo
View author publications
Search author on:PubMed Google Scholar
Sachie Nakamura
View author publications
Search author on:PubMed Google Scholar
Katsuko Sudo
View author publications
Search author on:PubMed Google Scholar
Takashi Momoi
View author publications
Search author on:PubMed Google Scholar

Contributions

E.F-J. and T.M.: study conception and design. E.F-J., T.M. and K.S.: sample collection and processing. E.F-J., S.N., and K.S.: Experimental work. E.F-J., S.N., and T.M.: data collection and analysis. E.F-J., T.M., and K.S.: Result interpretation. E.F-J., T.M., and K.S.: manuscript proofreading and review. E.F-J. and T.M.: manuscript writing, formatting, and editing.

Corresponding authors

Correspondence to Eriko Fujita-Jimbo or Takashi Momoi.

Ethics declarations

Competing interests

The authors declare no competing interests.

Peer review

Peer review information

Communications Biology thanks Nicolas Chevalier, Melissa Musser, and the other, anonymous, reviewer(s) for their contribution to the peer review of this work. Primary Handling Editors: Simona Chera, George Inglis and Johannes Stortz. A peer review file is available.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Description of Additional Supplementary Files

nr-reporting-summary

Supplementary Data

Transparent Peer Review file

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

About this article

Cite this article

Fujita-Jimbo, E., Nakamura, S., Sudo, K. et al. Abnormal development of gastrointestinal system of homozygous Foxp2(R552H)-mutated mice. Commun Biol 8, 1059 (2025). https://doi.org/10.1038/s42003-025-08468-z

Download citation

Received: 25 July 2023
Accepted: 01 July 2025
Published: 17 July 2025
Version of record: 17 July 2025
DOI: https://doi.org/10.1038/s42003-025-08468-z