Main

The consequences of sex-specific gene expression, including increased levels of X-linked gene products owing to genes that escape X-chromosome inactivation (XCI), can contribute to sex-specific regulatory programmes and sexually dimorphic phenotypes, including diseases1,2,3,4,5,6,7. The mechanisms underlying escape from XCI remain obscure8,9. Xist RNA is essential to trigger XCI during early development10,11, and the prevailing view has been that it becomes dispensable later on for XCI maintenance in differentiated cells, where multiple layers of epigenetic factors can lock in the silent state of the inactive X chromosome (Xi)12,13,14,15,16. In the mouse, Xist is indispensable for the initiation of two waves of XCI9, the first being imprinted (iXCI), leading to silencing of the paternally inherited X chromosome (Xp) by E3.517,18,19,20. The second wave of XCI is random (rXCI) and occurs in the embryo proper at around implantation (~E5.5)18. XCI can be faithfully recapitulated in vitro upon differentiation of mouse embryonic stem (mES) cells or by ectopic Xist induction in undifferentiated cells21,22,23,24. At the onset of XCI, Xist RNA spreads in cis on one of the two X chromosomes leading to its almost complete transcriptional repression by recruiting SPEN25,26,27,28,29,30. Xist also recruits (via hnRNPK) the Polycomb Repressive Complex 1 (PRC1), which in turn recruits PRC231,32,33. The polycomb complexes are thought to mediate the early maintenance of SPEN-induced gene silencing31. Later appearance of DNA methylation at CpG islands on the Xi is thought to maintain XCI34. Using tetracycline-responsive Xist transgenes in mES cells previously defined a critical early time window around 2–3 days of differentiation that marked a shift from Xist-dependent gene silencing to Xist-independent and irreversible XCI12. The capacity of Xist RNA to initiate chromosome-wide gene silencing de novo also appeared to be lost after this time window12.

How and why a subset of X-linked ‘escapees’ can evade or override Xist-mediated silencing, to be bi-allelically expressed from both the active X chromosome (Xa) and the Xi is not known35,36. A few constitutive escapees (~3–7% in mice and ~4–11% in humans36,37,38,39) can evade silencing from the very onset of XCI and in most cell types and individuals and are conserved across different species9,36. By contrast, a larger subset of X-linked genes (at least 20% in humans and mice) show variable ‘facultative’ escape, becoming re-expressed following silencing in some tissues and often variably between individuals17,18,21,40,41,42. Given the profound impact that escapees may have on sexual dimorphism43,44, understanding how XCI escape is modulated could have important implications for female biology and women’s health.

Here, we set out to test whether Xist RNA plays any role in regulating escapees. Recent evidence has revealed that both reactivation of silenced genes and de-dampening of escapee expression levels from the Xi can in fact occur upon XIST/Xist loss and that this may impact tissue homeostasis and even contribute to disease45,46,47,48,49,50. In these studies, genes that show reactivation upon Xist loss often correspond to genes that have been shown to escape XCI in other contexts, tissues or cell types16,45,46,47,48,50,51. Thus, contrary to previous thinking that Xist exerts its silencing role only during early embryogenesis, it may also influence escapee expression in later life. Nevertheless, how exactly transcriptional regulation of escapees is affected by Xist is unclear and has important implications for development and disease.

Results

Increased Xist RNA levels can silence Xi escapee genes in NPCs

To explore whether Xist RNA levels directly modulate escapee expression in post-XCI differentiated cells, we first assessed whether messenger RNA levels of escapees correlated with Xist RNA levels in 21 clonal, female neural progenitor cell (NPC) F1 hybrid lines (129/Sv × Cast/EiJ)52. Allelic RNA sequencing (RNA-seq) analysis confirmed substantial variability in numbers of escapees per NPC clone53,54, ranging from 48 to 124 escapees out of 379 informative X-linked genes (Extended Data Fig. 1a–d). Examining Xist RNA levels and escapee expression in different clones revealed a significant negative correlation, suggesting that Xist RNA may indeed play a role in modulating X-linked escapee expression on the Xi (Fig. 1a). We also checked whether in human somatic tissues, the expression levels of XIST correlate inversely with that of escapees using brain transcriptomic data from the GTEx project55. Even if rXCI in these samples prevents us from assessing allele-specific Xi transcriptional activity, we found that in brain areas in which we detected higher levels of XIST, escapees are expressed at lower levels, supporting our observation in mouse NPCs (Extended Data Fig. 1e).

Fig. 1: Increased levels of Xist RNA silences Xi escapees in NPCs.
Fig. 1: Increased levels of Xist RNA silences Xi escapees in NPCs.The alternative text for this image may have been generated using AI.
Full size image

a, Scatterplot showing a correlation between average escape and Xist expression using RNA-seq data from 21 NPC clones (129/Sv × Cast/Eij genetic background). Mean escape is calculated as the average allelic ratio (Xi/(Xi+Xa)) across 379 informative genes. Normalized Xist expression is calculated as library-size scaled counts per million (CPM), divided by the value for the lowest clone. R specifies Pearson’s correlation coefficient, and the P value is given by a correlation test. The error band depicts 95% confidence intervals. b, The experimental outline showing that TX ES cells (Cast/Eij × C57BL/6 genetic background) carrying a tetracycline-responsive promoter (ptet) upstream of the Xist gene on the B6 X chromosome were differentiated into NPCs without Dox. Single clones carrying the inactivated B6 allele were picked and expanded, and Xist RNA levels were increased by adding Dox to the culture media. c, FISH for Xist RNA (green) in NPC clone E6 in the untreated condition (control) and after 3 days of Dox treatment (Dox (3 d)). DNA is stained with DAPI (blue). d, RNA-seq data showing the fold change in Xist expression (normalized CPM) compared with untreated cells across the time course of Dox treatment. Data relative to the mean of measurements in clone E6 are shown. Individual biological replicates are shown for each timepoint (control, Dox (3 d) and Dox (7 d): n = 3, Dox (14 d) and Dox (21 d): n = 2 biological replicates. e, Schematic of the mouse X chromosome and heat map showing X-linked transcript allelic ratios in untreated clone E6 and after 3, 7, 14 and 21 days of Dox treatment. Allelic ratio indicates the fraction of reads from the Xi compared with reads from the Xi and Xa (ratio, 1: Xi monoallelic expression; ratio, 0: Xa monoallelic expression; ratio, 0.5: biallelic expression; ratio, >0.1: escape). Gene groups are defined as contiguous groups of escapees within 100 kb of each other (Methods). f, Heat map showing the allelic ratio of 133 escapees identified in clone E6 and shown in e. Escapees are assigned to three different categories as shown in Extended Data Fig. 1h and described in the Methods. The escape category for each gene is indicated below the heat map together with the zoom-in of the gene groups shown in e. g, Box plot showing the changes in allelic ratios for the different escape categories across the time course of Dox treatment. Data of clone E6 are shown. All the differences between control and Dox-treated measurements for escapee sets are significant at Padj < 0.01 (Wilcoxon rank sum test, Benjamini–Hochberg adjusted). Box plots show the median, 25th and 75th percentiles as well as 1.5× the interquartile range. h, Schematic of the exponential decay models used to study gene silencing kinetics. Data can be described by a full silencing model (blue, allelic ratio approaches 0) or a residual escape model (green, allelic ratio approaches value >0.1. The steepness of the curve corresponds to the gene’s silencing half-life). i, Beeswarm plot showing the distributions of silencing half-life fit to all escapees using the offset model and stratified by escape category. P values are calculated using Wilcoxon’s rank sum test (not adjusted for multiple testing). The large dots and error bars depict the median and 25th and 75th percentiles. j, Silencing half-lives per gene group as shown in f. Large dots show the mean and whiskers show the standard deviation across genes in the group. k, Beeswarm plot showing the distributions of residual escape parameters fit to all escapees using the offset model and stratified by escape category. P values are computed using Wilcoxon’s rank sum test (not adjusted for multiple testing). The large dots and error bars depict the median and 25th and 75th percentiles. Averaged data from individual biological replicates per timepoint (control, Dox (3 d) and Dox (7 d): n = 3, Dox (14 d) and Dox (21 d): n = 2 biological replicates) (eg and ik). Data from 133 genes (constitutive n = 12; facultative n = 84; NPC-specific n = 37 genes) (g, h, j and k).

Source data

To test the direct role of Xist RNA on XCI escape, we established a system that allows the induction of higher Xist RNA levels on the Xi in NPCs. We generated clonal NPC lines by in vitro differentiation of female TX1072 mES cells56, which is a polymorphic F1 hybrid line ((Cast/EiJ) × (C57BL/6)) carrying a doxycycline (Dox)-inducible ptet promoter upstream of the Xist endogenous locus on the C57BL/6 X chromosome56,57. When grown in the absence of Dox, TX1072 mES cells undergo rXCI during differentiation and the resulting NPCs are a heterogeneous pool with either the C57BL/6 or Cast/EiJ X chromosome inactivated (Fig. 1b). We selected one clonal line (E6) in which the B6 X chromosome was inactivated and used two previously described clonal NPC lines (CL30 and CL31) both carrying an Xi of B6 origin25 (Fig. 1b and Extended Data Fig. 1f). Thus, in these three lines, Xist expression levels from the B6 Xi can be increased by adding Dox to the culture media (Fig. 1b).

In clone E6, 133 genes escape XCI, whereas clones CL30 and CL31 show less escape, with 61 and 48 escapees, respectively (Extended Data Fig. 1f,g). We compared the escapees identified in our NPC clones with those identified in 19 previous studies in which the XCI status of X-linked genes had been assessed across many different cell types, both for rXCI and iXCI13,18,19,21,40,41,50,53,58,59,60,61,62,63,64,65,66,67,68 (Extended Data Fig. 1h and Supplementary Table 1). On the basis of this comparison, we defined three categories of escapees: (1) ‘constitutive’ escapees (escape in >50% of the studies); (2) ‘facultative’ escapees (variable escape, in different contexts); and (3) ‘NPC-specific’ escapees (escape only seen in NPCs so far, behave like facultative escapees). Out of the 133 escapees identified in clone E6, 12 are constitutive, 84 are facultative and 37 are NPC-specific escapees (Supplementary Table 2). Within the category of NPC-specific genes, only seven genes were found to escape XCI in all NPC clones (Extended Data Fig. 1i and Supplementary Table 2).

This comparison also revealed that in contexts in which facultative and NPC-specific escapees are inactivated, in the large majority of the cases, they do so either more slowly or later compared with other X-linked genes (Supplementary Table 3). Characterizing escape variability across clones, in light of previous data (Supplementary Table 1), is key to determining if certain X-linked genes are sensitive to Xist RNA level changes across cell types, tissues or developmental contexts. We went on to test whether Xist overexpression directly leads to silencing of these escapees in different NPC lines (Fig. 1 and Extended Data Fig. 2).

Xist RNA levels increased by 6.9–7.5 fold following Dox induction for 3, 7, 14 and 21 days (Fig. 1c,d and Extended Data Fig. 2a–e). When escapee expression levels were assessed after 3 days of Xist induction, 78 out of 133 escapees showed silencing, with a significant reduction in allelic ratio of at least 50%, and a total of 89 genes were still expressed from the Xi (Extended Data Fig. 2i). By day 14 and 21 of Dox treatment, 25 and 21 escapees showed residual escape, respectively (albeit being expressed at a reduced level) (Fig. 1e,f and Extended Data Fig. 2i). Overall, during the time course, the expression levels of all the escapee categories were found to be consistently reduced, demonstrating the capacity of Xist RNA to initiate gene silencing in differentiated cells, beyond the early developmental time window previously defined for Xist action (Fig. 1e,f and Extended Data Fig. 2i). Similar results were obtained upon Xist upregulation up to 21 days in CL30 and CL31 clones (Extended Data Fig. 2d). These data demonstrate progressive Xist-mediated silencing over time in all tested NPC clones, even if a direct comparison of silencing dynamics between clone E6 and clones CL30 and CL31 is limited by the lower number of escapees in CL30 (61) and CL31 (48) compared with clone E6 (133) (Fig. 1g, Extended Data Fig. 1i and Extended Data Fig. 2f,h). The reduced number of escapees in clones CL30 and CL31 is probably because they were originally differentiated in the presence of Dox from TX1072 ES cells (to skew XCI25), unlike clone E6. Thus, clones CL30 and CL31 had a prolonged exposure to elevated Xist levels during their derivation, consistent with our observation that the timing and level of Xist expression affect escape.

To characterize the differential silencing dynamics of escapees (Fig. 1f,g and Extended Data Fig. 2f), we quantified the speed at which escape was lost upon Xist overexpression (silencing half-life) and asked whether after prolonged Dox treatment certain genes retained some expression (residual escape) (Fig. 1h and Extended Data Fig. 3a,b). We found that for 31 genes, full silencing was not established even after persistent Xist overexpression, while the majority of genes become robustly silenced (Fig. 1h and Extended Data Fig. 2i). Escapees varied widely in silencing speeds, with constitutive escapees being silenced more slowly than NPC-specific genes and facultative escapees showing the widest range of silencing kinetics (Fig. 1i). Residual escape was more frequent among constitutive escapees than among facultative and NPC-specific escapees (Fig. 1k and Extended Data Fig. 3a,b). Allele-specific expression analysis of X-linked genes showed that Xist overexpression led to significant downregulation of most escapees on the Xi, while Xa expression remained unchanged (Extended Data Fig. 4). This observation suggests the lack of compensatory mechanisms that control the overall dosage of escapees, at least at the mRNA level (Extended Data Fig. 4).

We also found changes in the expression levels of autosomal genes after 7 days of Dox treatment, particularly in clones CL30 and CL31 (that is, 60 and 35 upregulated genes and 49 and 43 downregulated genes, respectively) (Extended Data Fig. 3f–h). The fact that autosomal genes are not only downregulated but also upregulated, and that the affected genes are not clustered at specific autosomal loci (Extended Data Fig. 3i), suggests that this is probably a secondary, indirect effect of Xist upregulation, presumably due to the change in dosage of various X-linked escapee gene products, many of which can affect chromatin and transcription69,70. However, we cannot exclude the possibility of the direct action of Xist RNA in trans also accounting for some of the autosomal effects. Finally, we asked whether the expression levels of escapees or their position along the Xi explain the differences found in silencing upon Xist upregulation (Fig. 1j and Extended Data Fig. 3c–e). We found no correlation between escapee expression levels from either both the Xi and Xa or only the Xi and their efficiency in silencing upon Xist overexpression (Extended Data Fig. 3c,d). However, escapees pairs within 100 kb of each other showed more similar half-lives than randomly chosen pairs, implying that neighbouring escapees share similar responses to increased Xist levels (Fig. 1j and Extended Data Fig. 3e). This contrasts with the effects seen on autosomes where genes that show up- or downregulation are not in proximity to each other (Extended Data Fig. 3i). Along the Xi, we identified 11 gene groups that include 3 to 14 genes that share similar silencing speeds (Fig. 1e,f,j).

Thus, increased Xist RNA levels directly reduce the expression levels of X-linked escapees in post-XCI cells, leading to almost full loss of escape after 21 days of Dox induction.

Xist RNA can initiate XCI of escapees in terminally differentiated astrocytes

To test whether Xist overexpression can also induce Xi-escapee silencing in non-dividing, post-mitotic cells, we differentiated NPC clone E6 into astrocytes71. Astrocyte verification involved staining for the astrocyte marker GFAP and the proliferation marker Ki-67 (Fig. 2a and Extended Data Fig. 5a). The quantification of Ki-67-positive cells in differentiated astrocytes confirmed that 99,3% of the cell population is non-dividing, whereas in E6 NPCs, 75% of cells are dividing before differentiation (Extended Data Fig. 5a). Transcriptomic analysis of astrocytes confirmed that the XCI status of X-linked genes remained remarkably stable upon differentiation from NPCs (Fig. 2e, Extended Data Fig. 5b,c and Supplementary Table 2). In fact, the overwhelming majority of escapees identified in NPCs are still transcriptionally active on the Xi in astrocytes (Fig. 2d,e and Extended Data Fig. 5b–d). Xist upregulation in astrocytes following 3 and 7 days of Dox was manifested both by RNA fluorescence in situ hybridization (RNA-FISH) and RNA-seq (Fig. 2b,c). The allelic ratios of the majority of escapees changed significantly following 3 and 7 days of Xist upregulation, demonstrating that Xist RNA can efficiently initiate gene silencing in post-mitotic cells (Fig. 2d and Extended Data Fig. 5e,f). To exclude that escapee silencing might be explained by a small number of dividing cells, we simulated mixtures of untreated astrocytes with defined fractions of Dox-treated NPCs (Extended Data Fig. 5g). Notably, while 3 days of Dox led to similar escapee silencing effects in NPCs and astrocytes, with 57% and 60% of genes showing a significant reduction in allelic ratio of at least 50%, respectively, 7 days of increased Xist levels did not lead to further silencing in astrocytes, unlike in NPCs (Fig. 2e, Extended Data Fig. 2i and Extended Data Fig. 5h). This may reflect different kinetics of gene silencing between dividing and non-dividing cells. Non-dividing cells may need longer exposure to Xist RNA levels to enable efficient escapee silencing. Alternatively, cell division may be a requirement to establish efficient gene silencing over time.

Fig. 2: Increased levels of Xist RNA silences Xi escapees in astrocytes.
Fig. 2: Increased levels of Xist RNA silences Xi escapees in astrocytes.The alternative text for this image may have been generated using AI.
Full size image

a, Experimental outline showing that TX NPCs (E6 clone) carrying a ptet promoter upstream of the Xist gene on the B6 X chromosome were differentiated into astrocytes without Dox. Xist RNA levels were increased by adding Dox to the astrocyte culture media. b, FISH for Xist RNA (green) in the untreated-astrocyte condition (control) and after 3 days of Dox treatment. DNA is stained with DAPI (blue). c, RNA-seq data showing the fold change in Xist expression (normalized CPM) compared with untreated cells across the time course of Dox treatment (17.5–21.1-fold enrichment). Two individual biological replicates are shown per condition. d, Heat map showing the mean allelic ratios between two replicates of escapees after 3 and 7 days of Dox treatment. Escapees are assigned to three different categories as shown in Extended Data Fig. 1g and described in the Methods. The escape category for each gene is indicated below the heat map. e, Scatterplot comparing the allelic ratios of individual escapees in astrocytes and NPCs (E6 clone) for the different Dox treatment conditions. The number of genes matching and Pearson correlation between the two cell types are indicated in the ‘control’ scatterplot.

Source data

We also tested whether autosomal genes were affected upon Xist upregulation in astrocytes and found 466 up- and 412 downregulated genes after 7 days of Dox (Extended Data Fig. 3j). Similar to NPCs, these genes do not colocalize, again pointing to a probable indirect effect (Extended Data Fig. 3k). We found limited overlap between genes that are affected in NPCs and astrocytes, suggesting that the autosomal targets of Xist upon Xist upregulation are potentially different across different cell types (Extended Data Fig. 3l,m).

Altogether, these results demonstrate that the capacity of Xist to silence escapee genes is not restricted to multipotent, rapidly dividing stem cells but can also occur in non-dividing terminally differentiated cells.

Xist RNA-mediated silencing of escapees in NPCs is SPEN dependent

Next, we investigated whether Xist-mediated silencing in post-XCI cells is SPEN-dependent, as during early development25. In clones CL30 and CL31, both Spen alleles have an auxin-inducible degron (AID) domain, allowing its acute degradation upon the addition of auxin25. SPEN was depleted for 2 days before inducing Xist upregulation for 3 and 7 days (Fig. 3a). Depletion of SPEN in the absence of Xist upregulation led to significant upregulation of escapees, consistent with previous data25 (Fig. 3b). We also confirmed that SPEN is dispensable for XCI maintenance, as we observed no reactivation of Xi silenced genes in its absence (Supplementary Fig. 1 and Supplementary Table 4). Upon combined Dox and Auxin treatment, Xist was efficiently upregulated (6.0–8.7-fold enrichment) (Fig. 3c). While the induction of increased Xist RNA levels for 3 and 7 days in the presence of SPEN leads to statistically significant silencing of escapees in both NPC clones (that is, −Dox versus +Dox comparison), when this is done in the absence of SPEN (that is, −Dox versus +Dox, +Aux comparison), no significant changes in the allelic ratios of escapees were found (Fig. 3b,d–f and Supplementary Table 5). These data clearly demonstrate that the silencing of escapees by increased Xist RNA levels cannot occur in the absence of SPEN (Fig. 3d,e). Indeed, the overwhelming majority of escapees across the three categories were unaffected by Xist overexpression in the context of SPEN depletion (Fig. 3d,e). A few exceptions include Ctps2, Ap1s2, Srpk3, Zdhhc9 and G530011O06Rik, which are dampened upon Xist upregulation even in the absence of SPEN in at least one clone or timepoint (Fig. 3d and Supplementary Table 5). This is consistent with previous observations showing that SPEN is dispensable for the silencing of a small subset of genes during XCI25. In summary, our data unexpectedly reveal that SPEN is essential for Xist-mediated silencing of nearly all escapees in differentiated cells, similarly to early embryonic development when XCI is initially established.

Fig. 3: Xist-mediated silencing in NPCs is SPEN dependent.
Fig. 3: Xist-mediated silencing in NPCs is SPEN dependent.The alternative text for this image may have been generated using AI.
Full size image

a, Experimental outline showing that Xist RNA levels were increased in NPC clones carrying a SPEN–AID degron2. SPEN was depleted by adding auxin (indole-3-acetic acid) to the culture media for 2 days before inducing Xist upregulation with Dox for 3 or 7 days in the presence of auxin. b, Box plots showing the changes in allelic ratios of escapees across the time course of Dox and auxin treatment. Both CL30 and CL31: control and Dox (7 d): n = 3, others: n = 2 biological replicates. The data across 67 (CL30) and 50 (CL31) genes show a significant increase in allelic ratios between control and auxin treatment (P value < 0.05) and a significant decrease in allelic ratios upon Dox (3 d) (CL30: adjusted P value (Padj) = 5.7 × 10−28, CL31: Padj = 4.6 × 10−17) and 7 d (CL30: Padj = 3.3 × 10−37, CL31: Padj = 1.7 × 10−21) compared with control but no significant differences between control and Dox-treated samples in the absence of SPEN (that is, +Dox, +Aux) after 3 d (CL30: Padj = 1, CL31: Padj = 1) and 7 d (CL30: Padj = 1, CL31: Padj = 1). The data also show significant changes in allelic ratios upon Dox treatment in the presence of SPEN compared with its absence (that is, +Dox, −/+Aux) after 3 d (CL30: Padj = 2.3 × 10−21, CL31: Padj = 5 × 10−13) and 7 d (CL30: Padj = 5.2 × 10−25, CL31: Padj = 6 × 10−15). P values are calculated using Wilcoxon rank sum tests and adjusted using the Benjamini–Hochberg procedure. All box plots show the median, 25th and 75th percentiles as well as 1.5× the interquartile range. c, RNA-seq data showing the fold change in Xist expression compared with untreated cells following Dox treatment for 3 and 7 days and in combination with auxin treatment for 5 and 9 days, respectively. d, Heat map showing allelic ratios of escapees (67 (CL30) and 50 (CL31)) upon Xist induction for 3 days (Dox (3 d)) and 7 days (Dox (7 d)) and in combination with auxin treatment (Dox (3 d), Aux (5 d) and Dox (7 d), Aux (9 d)). Data from NPC clones CL30 and CL31 are shown. The escape category for each gene is indicated below the heat map. The four genes Gm14539, Gm8822, G6pdx and Mdm4-ps show either an unchanged or increased (rather than decreased) allelic ratio upon Dox treatment. Gm14539, Gm8822 and Mdm4-ps are pseudogenes with homologues on other chromosomes, and the annotation of SNPs at these loci is likely to be subjected to misannotations. The G6pdx locus in the CL30 and CL31 clones is tagged with a GFP/Tomato Hygro/Blasticidin resistance cassette, which may influence the transcriptional status of this particular gene on both alleles. The allelic changes observed for G6pdx are therefore difficult to interpret in these clones. ef, Dot plots representing changes in allelic ratios upon Dox and auxin treatments for the 3-day (e) and 7-day timepoints (f). The average allelic ratios of 42 genes escaping in both CL30 and CL31 clones are shown. The diagonal dashed line represents no change compared with an untreated cell line. The error band depicts 95% confidence intervals. All box plots show the median, 25th and 75th percentiles and 1.5× the interquartile range. Averaged data from individual biological replicates per timepoint (control and Dox (7 d): n = 3, Aux (2 d), Dox (3 d), Dox (3 d), Aux (5 d) and Dox (7 d), Aux (9 d): n = 2 biological replicates) (b and df). Data from 67 (CL30) and 50 (CL31) genes (b, d and e).

Source data

Xist-mediated silencing of escapees leads to loss of TAD-like domains on the Xi

Facultative escapee clusters reside in TAD-like structures on the Xi, which is otherwise devoid of TADs54,72. Whether this is a cause or a consequence of escapee expression is unknown. We investigated whether escapee TAD-like structures are affected by increased Xist expression, with or without SPEN. We performed allele-specific Capture Hi-C analysis of >1-Mb genomic regions encompassing TAD-like domains previously observed on the Xi in NPCs54(Fig. 4a,b). One of these (the ‘Mecp2Hcfc1 cluster’) spans ~800 kb including 24 facultative and 6 NPC-specific escapees (Fig. 1e,f). This is the most gene-dense region of the X chromosome, and escapees within this cluster show the highest variability in terms of facultative escape patterns between different NPC clones (Extended Data Fig. 1f). A second ‘Kdm5c cluster’ spans ~500 kb and includes one constitutive escapee, Kdm5c, as well as three facultative and four NPC-specific escapees (Fig. 1e,f).

Fig. 4: Increased levels of Xist RNA leads to loss of TAD-like domains on the Xi.
Fig. 4: Increased levels of Xist RNA leads to loss of TAD-like domains on the Xi.The alternative text for this image may have been generated using AI.
Full size image

ab, Capture Hi-C interactions and insulation score at the Mecp2Hcfc1 (a) and Kdm5c (b) cluster in clone E6 before and upon Dox treatment. Capture Hi-C interactions are shown for the Xa and the Xi in the untreated condition (control; top) and upon Dox treatment for 7 days (middle) and 21 days (bottom) for the Mecp2Hcfc1 cluster and 7 days for the Kdm5c cluster. Capture Hi-C data are shown at 10 kb resolution. Heat maps show the allelic ratios for 29 (a) and 25 (b) X-linked genes included in the captured regions. Escapees belonging to groups 6 (green) and 7 (pink) within the Mecp2Hcfc1 cluster are highlighted. Differential map shows changes in genome topology between Dox-treated samples and control samples. c, Capture Hi-C interactions and insulation score at the Kdm5c cluster for the Xi in clone E6 after 7 days of Dox treatment and subsequent washout (4 days). Arrows indicate areas of increased interaction frequencies upon washout. Heat map shows the allelic ratios for 25 X-linked genes included in the captured regions. Differential maps show changes in genome topology between Dox-treated and washout samples.

Source data

As previously reported, TAD-like structures are oon the Xi, where topological organisation resembles that on the Xa (Fig. 4a,b). Following 7 days of Xist induction, the Mecp2–Hcfc1 locus TAD-like structures on the Xi become attenuated, while the Xa remains unchanged (Fig. 4a and Extended Data Fig. 6a). Following 21 days of Xist upregulation, TAD-like structures are completely lost across the entire Mecp2Hcfc1 region, and all escapees are fully silenced (Fig. 4a). Again, no changes in three-dimensional (3D) structure were observed on the Xa (Extended Data Fig. 6b). Similar results were obtained at the Kdm5c cluster, where just 7 days of Xist upregulation resulted in efficient silencing of all three facultative and four NPC-specific escapees in the cluster as well as loss of TAD-like structures (Fig. 4b and Extended Data Fig. 6c). Only the constitutive escapee Kdm5c resisted complete inactivation, and a long-range looping interaction upstream of Kdm5c was maintained, probably representing long-range contacts with other expressed loci13,54 (Fig. 4b). Thus, TAD-like structures at escapee clusters on the Xi may be the result of ongoing transcription and their silencing, or increased Xist levels, leads to their loss.

To assess whether loss of TAD-like structures occurred owing to increased Xist RNA levels, as has been previously postulated13,30 or to escapee silencing, Capture Hi-C was performed in NPCs carrying the SPEN–AID degron (Fig. 5a–c). No differences in 3D topology on the Xa were observed upon Dox (Xist upregulation) and auxin (SPEN depletion) treatment (Extended Data Fig. 6d). Xist upregulation for 21 days in the context of acute SPEN depletion resulted in no loss in local 3D topology and no change in escapee transcription within the Mecp2Hcfc1 cluster, even though Xist RNA levels were tenfold higher in Dox-treated cells (Fig. 5c). Thus, increased Xist levels can only lead to loss of TAD-like structures at the Mecp2Hcfc1 cluster if SPEN is present. This suggests that Xist RNA alters Xi TAD-like structures only if gene silencing is induced. We also looked at undifferentiated TX1072 ES cells, where induction of Xist does not induce complete gene silencing68,73, and showed that Xist induction in the presence of SPEN does not lead to loss of TAD-like structures in regions where genes are not fully inactivated (Extended Data Fig. 7a,b), further demonstrating that loss of 3D structure on the Xi occurs owing to loss of gene expression.

Fig. 5: Loss of TAD-like domains at escapee clusters occurs owing to gene silencing by Xist RNA.
Fig. 5: Loss of TAD-like domains at escapee clusters occurs owing to gene silencing by Xist RNA.The alternative text for this image may have been generated using AI.
Full size image

ac, Capture Hi-C interactions and insulation score at the Mecp2Hcfc1 cluster for the Xi in clone CL30.7 are shown. Capture Hi-C interactions are shown for the Xa and the Xi in the untreated condition (a), upon Dox treatment for 21 days (b) and after 23 days of auxin treatment and 21 days of Dox treatment (c). Capture Hi-C data are shown at 10 kb resolution. Heat maps show allelic ratios for 29 X-linked genes included in the captured region. Differential maps show changes in genome topology between 21-day Dox-treated samples and control samples (b) and 23-day auxin and 21-day Dox-treated samples compared with control samples (c).

Source data

Silencing of most facultative escapees becomes Xist independent after prolonged Xist upregulation

Next, we tested whether the Xist-mediated silencing of escapees in NPCs is irreversible or strictly Xist dependent. In clone E6, Xist was induced for 7, 14 or 21 days, followed by 7 days of Dox washout and RNA-seq (Fig. 6a–d). After washout, Xist returned to baseline levels (Fig. 6b,c), but escapee silencing became increasingly irreversible with longer induction, showing distinct reactivation dynamics across escape categories (Fig. 6d–f and Supplementary Table 6).

Fig. 6: Silencing of most facultative escapees becomes Xist independent after prolonged Xist upregulation.
Fig. 6: Silencing of most facultative escapees becomes Xist independent after prolonged Xist upregulation.The alternative text for this image may have been generated using AI.
Full size image

a, Experimental outline showing Xist upregulation was induced by Dox treatment for 7, 14, and 21 days following 7 days of Dox washout. b, RNA-seq data showing fold changes in Xist expression (normalized CPM) compared with untreated control cells after 7, 14 and 21 days of Dox treatment, followed by 7 days of Dox washout. Data relative to the mean of measurements in clone E6 are shown. c, FISH for Xist RNA (green) in NPC clone E6 in the untreated condition (control), after 21 days of Dox treatment (Dox (21 d)) and following 7 days of Dox washout (Dox (21 d)−washout (7 d)). DNA is stained with DAPI (blue). d, Heat map showing allelic ratios of 133 escapees identified in clone E6 upon Dox treatment for 7, 14, and 21 days and following 7 days of Dox washout after these timepoints. Escapees are assigned to three different categories as shown in Extended Data Fig. 1h and described in the Methods. Gene groups are defined as contiguous groups of escapees within 100 kb of each other as in Fig. 1f. e, Box plots quantifying the reversibility of escape per gene (constitutive, 12; facultative, 84 and NPC-specific, 37 genes) for each timepoint by computing the ratio of the allelic ratio after washout divided by the allelic ratio in untreated samples. Differences between Dox (7 d) and Dox (14 d) and between Dox (7 d) and Dox (21 d) are significant for the facultative and NPC categories (Dox (14 d): facultative P = 1.46 × 10−6, NPC-specific P = 0,00608; Dox (21 d): facultative P = 2.08 × 10−12, NPC-specific P = 0,00421). P values are calculated using a paired Wilcoxon’s rank sum test and adjusted using the Benjamini–Hochberg procedure. All box plots show the median, 25th and 75th percentile as well as 1.5× the interquartile range. f, Stack histogrammes showing the classification of genes into irreversible, partially irreversible and fully reversible escapees across the silencing time course. Genes are considered reversible when they reach at least 50% of untreated escape as well as an allelic ratio >0.1 after washout. Similarly, they are considered partially irreversible when they reach 10–50% of untreated escape and an allelic ratio >0.1, and they are considered irreversible otherwise. g, Scatterplot comparing silencing half-lives (Fig. 1) to fold recovery after washout for the gene groups (74 genes in total) indicated in d. Genes in a subset of local gene groups are highlighted to show their coordinated behaviour. Reversible, partially irreversible and irreversible fold recovery thresholds are indicated. R indicates Pearson’s correlation and the P value is given by a correlation test.

Source data

After 7 days of Xist upregulation followed by 7 days of Dox washout, 95 escapees out of 133 become reactivated, 16 escapees are partially irreversible and 22 escapees are irreversibly silenced (Fig. 6f). All 12 constitutive escapees are fully reversible at this timepoint (Fig. 6f). After 14 days of Xist upregulation, 57 escapees are irreversibly silenced (Fig. 6f). The number of irreversibly silenced escapees remains mostly unchanged across all categories after 21 days of Xist induction. Notably, all constitutive escapees except Kdm6a and Ddx3x are still reactivated upon washout following 21 days of Xist upregulation. Thus, although all constitutive escapees are sensitive to Xist RNA levels, the majority of them remain resistant to complete XCI (Fig. 6d–f). By contrast, for irreversibly silenced genes, Xist RNA becomes dispensable after 2 weeks of upregulation (Fig. 6f). Longer washout of Dox after 14 days of Xist induction led to only a limited increase in the number of reversible genes compared with shorter washout times (7 days) (Extended Data Fig. 8a,b). We confirmed these results in clones CL30 and CL31 (Extended Data Fig. 8c–f).

We also assessed whether differences in reactivation reflect differences in silencing dynamics of escapees (Fig. 6g). Escapees that undergo fast silencing upon increased Xist levels are less prone to reactivate, whereas slowly silenced genes tend to retain the capacity to become reactivated, when Xist returns to basal expression levels (Fig. 6g).

Given the silencing reversibility of both Kdm5c and Hcfc1Mecp2 clusters (Fig. 6d), we tested whether their 3D TAD-like organization on the Xi also reappeared. After 7 days of Xist upregulation followed by Dox washout, the 3D organization of these loci is re-established across the genes that become re-expressed within the Kdm5c cluster (Fig. 4c and Extended Data Fig. 6c). Similar observations were made at the Hcfc1Mecp2 cluster, even if gene silencing and TAD loss were less pronounced after 7 days of Dox treatment (Extended Data Fig. 6e). However, following 21 days of Dox treatment and washout, TAD-like structures were not re-established in regions of the cluster that encompass irreversibly silenced genes (for example, most genes of group 6), but 3D structures were restored at the reversible genes of group 7 (Extended Data Fig. 6e). These 3D structures are less pronounced than those we observed after 7 days of Dox treatment and washout, reflecting the different number of escapees that are actively transcribed and their expression levels between the two conditions (Extended Data Fig. 6e). Thus, the emergence of TAD-like structures at escapee clusters seems to be a direct consequence of transcription.

In summary, we show that most escapees become irreversibly silenced after 14 days of increased Xist levels; constitutive escapees remain reversible even after prolonged (21 d) Xist upregulation, and 3D structures at escapee clusters are directly linked to gene transcription.

Irreversible silencing of escapees is associated with DNA methylation at promoters and H3K27me3 enrichment

To define the epigenetic mechanisms underlying irreversible gene silencing following prolonged Xist upregulation, we assessed XCI maintenance marks: polycomb-deposited chromatin marks32,33 and CpG island DNA methylation34. We performed CUT&RUN for H3K27me3 and H2AK119Ub following 7 and 21 days of Dox treatment and after Dox washout. Increased Xist RNA levels trigger enrichment of both chromatin marks X chromosome wide, whereas Dox washout leads to their overall decrease to basal levels (Fig. 7a and Extended Data Fig. 9a,b). After 7 and 21 days of Xist upregulation, H3K27me3 and H2AK119Ub are enriched on the Xi, both at repressed genes and escapees and including gene promoters, gene bodies and intergenic regions. Enrichment of both H3K27me3 and H2AK119Ub is largely reversible upon Dox washout (Fig. 7b,c and Extended Data Fig. 9c,d). Thus, variations in Xist RNA levels result in the reversible recruitment of the polycomb machinery to an already inactivated Xi in post-XCI cells.

Fig. 7: Irreversible silencing of escapees is associated with DNA methylation at promoters and H3K27me3 enrichment.
Fig. 7: Irreversible silencing of escapees is associated with DNA methylation at promoters and H3K27me3 enrichment.The alternative text for this image may have been generated using AI.
Full size image

a, Density plots showing the correlation between H3K27me3 and H2AK119Ub enrichments across 10 kb windows with more than ten average read counts spanning the Xi during the Dox treatment time course (control, 7 days (Dox (7 d)), 21 days (Dox (21 d))) and washout (for 7 days after each treatment (Dox (7 d) wo, Dox (21 d) wo)). The axes represent normalized log counts. b, Box plot comparing H3K27me3 enrichment (normalized counts) across intergenic regions, as well as promoters and gene bodies of escapees during Dox treatment and washout. H3K27me3 levels are shown separately for the Xa (light red) and Xi (dark red) (n = 6,514 intergenic, 107 promoter, 126 genebody genomic intervals in all conditions). c, The same as b but for for H2AK119Ub. H2AK119Ub levels are shown separately for the Xa (yellow) and Xi (orange) (n = 6,514 intergenic, 107 promoter, 126 genebody genomic intervals). d, Dot plot comparing the gene-length normalized H3K27me3 (left) and H2AK119Ub (right) levels over gene bodies of reversibly (green) and irreversibly (grey) silenced escapees during Dox treatment and washout. Normalized counts are shown (n = 86 irreversible, 30 reversible genes). The dot depicts the mean, and the error bars depict standard errors. e, Aggregate plots of H3K27me3 (left) and H2AK119Ub (right) coverage over the promoter region (1 kb upstream to 500 bp downstream of the transcription start site (TSS)) and gene bodies (scaled to gene length, until the transcription end site (TES)) of reversibly (green) and irreversibly (grey) silenced escapees during Dox treatment and washout. The log2 fold change in coverage is calculated to the untreated condition (control). f, Genome tracks showing H2AK119Ub and H3K27me3 accumulation and loss on the Xa (grey) and Xi (H3K27me3 (pink) and H2AK119Ub (yellow)) during Dox treatment and washout. Two example regions containing both reversibly (green) and irreversibly (grey) silenced escapees are shown. g, Violin plots showing allele-specific DNA methylation levels of CpG islands during Dox treatment and washout. For each CpG island, the average fraction of methylated cytosines is calculated across CpG sites from haplotype-informative reads. The Xa (grey) and Xi (light blue) chromosomes are shown separately. Differences observed for Xi between control and treated conditions are significant for Dox (21 d) (P = 0.0155) and Dox (21 d) wo (P = 0.00312). P values are calculated over n = 42 CpG islands using a paired Wilcoxon’s rank sum test. h, Beeswarm plot showing the fold change in promoter methylation compared with the untreated condition (control) during Dox treatment and washout for reversible (green) and irreversible (grey) escapees. Promoters are defined as regions of accessible chromatin as measured by ATAC-seq that overlap (−500 bp, 1,000 bp) intervals around annotated TSSs. The median is indicated with a black bar. Differences between reversible and irreversible genes are significant for Dox (21 d), n = 63 irreversible, 16 reversible promoters (P = 0.0194) and Dox (21 d) wo (P = 0.0456). P values are calculated using a paired Wilcoxon’s rank sum test. All box plots show the median, 25th and 75th percentiles as well as 1.5× the interquartile range. All figures show average data across two biological replicates.

Source data

We also assessed the reversible Xist-dependent enrichment of H3K27me3 and H2AK119Ub at autosomal loci (Extended Data Fig. 9e) to ascertain whether the autosomal genes that are misregulated upon Xist upregulation colocalize with regions that become Polycomb marked and found no correlation (Extended Data Fig. 9f).

We examined polycomb changes following Dox induction and washout at reversible and irreversible escapees on the Xi. After 7 and 21 days of Dox induction, H2AK119Ub is enriched at both reversible and irreversible escapees and it returns to levels close to basal enrichment upon washout at both timepoints (Fig. 7d–f and Extended Data Fig. 9g). By contrast, H3K27me3 is decreased at reversible escapees after 7 and 21 days of Dox induction and washout but is retained at irreversible genes albeit at lower levels (Fig. 7d–f). Although the difference in reduction between reversible and irreversible escapees remains after 21 days of Dox induction and washout, in this latter case, the H3K27me3 levels do not return to basal levels, also in the case of reversible escapees (Fig. 7d–f and Extended Data Fig. 9h). This difference in dynamics between PRC1- and PRC2-deposited chromatin marks probably reflects the mechanisms by which these complexes are recruited to the Xi by Xist RNA: directly via hnRNPK in the case of PRC1 and indirectly following H2AK119Ub enrichment in the case of PRC232,33.

We next asked whether irreversible escapee silencing is linked to DNA methylation, a hallmark of Xi genes9. Promoters and CpG islands of silent Xi genes are hypermethylated, while gene-body methylation marks active escapees37,74. Following 7 and 21 days of Xist upregulation and Dox washout, progressive CpG methylation gain was observed across the Xi (Fig. 7g), alongside reduced methylation at escapee gene bodies, indicating their transition towards Xi-like silencing (Extended Data Fig. 9i). Unlike polycomb marks, CpG methylation persisted after Dox washout, with irreversible genes showing higher promoter CpG methylation than reversible ones after 21 days (Fig. 7d,h).

In summary, prolonged Xist upregulation renders escapee silencing irreversible, with stable promoter hypermethylation and loss of gene-body methylation. Irreversibly silenced genes retain H3K27me3, whereas H2AK119Ub follows Xist levels. Reversibly silenced escapees gain little promoter methylation and are fully re-expressed when Xist levels drop.

Xist RNA levels modulate X-linked escapee gene expression in vivo

Finally, we assessed whether increased Xist RNA levels similarly impact escapees during mouse embryonic development. The role of Xist RNA and the kinetics of gene silencing and escape have been shown to be very similar between iXCI and rXCI22. Thus, iXCI was used to extend our findings from in vitro differentiated cells to an in vivo setting.

The same mice from which TX1072 mES cells56 were derived were used, with a Dox-inducible endogenous Xist allele (TX) and a tetracycline-responsive transactivator (rtTA) integrated at the ubiquitously expressed Rosa26 locus57.

We first examined how increased Xist RNA impacts escape from iXCI in late pre-implantation embryos. TX/Y males (Xptet/Y; R26rtTA/WT, where WT is wild type) were crossed with JF1 females to obtain F1 hybrids (Fig. 8a). RNA-seq was performed after Dox-induced Xist overexpression at E3.5 and E4.5, when XCI and escape are already established on the paternal Xp19. F1 embryos were collected at E2.5 and E3.5, cultured 24 h with Dox and analysed using single-embryo RNA-seq (Fig. 8a). Female embryos carrying rtTA showed Xist induction, while rtTA-negative siblings served as controls (Fig. 8a). RNA-FISH confirmed larger, more intense Xist clouds in rtTA+ blastomeres (Fig. 8b and Extended Data Fig. 10a), although whole-embryo RNA-seq did not reveal major Xist upregulation at E3.5 or E4.5 (Extended Data Fig. 10b), consistent with blastomere variability75,76. Nonetheless, rtTA+ embryos showed reduced X-linked allelic ratios compared with controls at E4.5, indicating enhanced Xi silencing (Extended Data Fig. 10c,d).

Fig. 8: Xist levels modulate X-linked dosage in vivo.
Fig. 8: Xist levels modulate X-linked dosage in vivo.The alternative text for this image may have been generated using AI.
Full size image

a, Experimental outline showing male TX B6 mice (XptetY; R26rtTA/WT) were crossed with WT JF1 females. F1 embryos were collected at E2.5 and E3.5 and cultured for 24 h while adding Dox to the culture media. RNA-seq was performed at E3.5 and E4.5. b, RNA-FISH for Xist RNA (green) in E4.5 XX embryos obtained by crossing male TX B6 mice (XptetY; R26rtTA/rtTA) with WT JF1 females. DNA is stained with DAPI (blue). c, Box plots showing mean allelic ratios for −rtTA and +rtTA embryos for the different escapee categories. The constitutive, facultative (includes genes annotated as facultative in Extended Data Fig. 1h and NPC-specific escapees) and E4.5-specific categories contain 10, 97 and 24 escapee genes, respectively. Biological replicates: for E3.5, −rtTA n = 2 embryos, +rtTA n = 4 embryos; for E4.5, −rtTA n = 17 embryos, +rtTA n = 20 embryos. The adjusted P values for the comparison between −rtTA and +rtTA embryos are Padj = 3.9 × 10−2 for the constitutive category, Padj = 6.60 × 10−16 for facultative and Padj = 8.2 × 10−5 for E4.5-specific escapees (two-sided Wilcoxon rank sum test, adjusted using the Benjamini–Hochberg procedure). d, Experimental outline shows TX/Y males carrying the rtTA transactivator (Xptet/Y; R26rtTA/rtTA or Xptet/Y;R26rtTA/WT) were crossed with WT JF1 females. Xist RNA overexpression was induced by adding Dox to the drinking water of pregnant females for 5 days, from E3.5 to E8.5. RNA-seq was performed using RNA extracted from ExE tissue. e, RNA-seq data showing fold changes in Xist expression (normalized CPM) for rtTA− +Dox (control) and rtTA+ +Dox (Dox). Fold changes are calculated to the mean Xist levels of rtTA+ −Dox samples. Each dot represents an individual embryo. Biological replicates: −rtTA, +Dox n = 2 embryos; +rtTA, +Dox n = 6 embryos; +rtTA, −Dox n = 8 embryos. f, Plot showing average escape for each ExE sample, categorized by rtTA genotypes and Dox treatment. Biological replicates: −rtTA, +Dox n = 2 embryos; +rtTA, +Dox n = 6 embryos; +rtTA, −Dox n = 8 embryos. PCA was performed on the whole transcriptome excluding X chromosomes. g, Heat map showing the mean allelic ratios of 74 escapees in E8.5 ExE tissues across rtTA+ −Dox, rtTA+ +Dox and rtTA− +Dox conditions. Escapees are categorized as in Extended Data Fig. 1h, with NPC-specific genes included in the facultative category. Genes are additionally called ‘E8.5-specific’ if they show an allelic ratio >0.1 and <0.8 in more than 50% of rtTA+ −Dox ExE samples and do not escape in NPCs. The constitutive, facultative (includes genes annotated as facultative in Extended Data Fig. 1h and NPC-specific escapees) and E8.5-specific categories contain 10, 48 and 16 escapee genes, respectively. h, Box plots showing mean allelic ratios rtTA+ −Dox, rtTA+ +Dox and rtTA− +Dox ExE samples for the different escapee categories. The adjusted P values for the comparison between rtTA+ −Dox and rtTA+ +Dox ExE samples are Padj = 7.8 × 10−2 for the constitutive category, Padj = 5.6 × 10−12 for facultative and Padj = 8.5 × 10−4 for E8.5-specific escapees (two-sided Wilcoxon rank sum test, adjusted using the Benjamini–Hochberg procedure). All box plots show the median, 25th and 75th percentile and 1.5× the interquartile range. i, Scatterplot showing the same data as in h but comparing allelic ratios of individual escapee genes between rtTA+ −Dox and rtTA+ +Dox. Biological replicates: −rtTA, +Dox n = 2; +rtTA, +Dox n = 6; +rtTA, −Dox n = 8 (h and i).

Source data

To address the impact of Xist upregulation on escapee expression from the Xi, we focused on E4.5 embryos. We found 251 inactivated Xp genes out of 381 informative genes and 131 escapees (Extended Data Fig. 10e,f). All constitutive escapees identified in embryos and 74 of the facultative genes were also detected in NPCs. Of the 31 NPC-specific escapees described earlier, only 14 escaped XCI in embryos as well, confirming their facultative nature, and we therefore classified them in the facultative gene category. We identified a further 24 E4.5 embryo-specific escapees (Extended Data Fig. 10f and Supplementary Table 7). Following Dox-induced Xist upregulation, most escapees become downregulated on the Xi at E4.5 (Extended Data Fig. 10f–h). Similar to NPCs, constitutive escapees were less sensitive to Xist upregulation (Fig. 8c and Extended Data Fig. 10g). Interestingly, E4.5-specific escapees show variable responses to Xist upregulation, with most genes showing silencing but a subset being unaffected (Fig. 8c and Extended Data Fig. 10g). Closer examination of the latter revealed that two of these, Rho5x and Fthl17f (also known as Gm5635), are imprinted and only expressed from the Xp77,78 at this stage of development19.

To assess the effects of Xist upregulation for longer times and later in vivo, we induced Xist RNA from E3.5 to E8.5 (Fig. 8d). Male TX/Y mice with rtTA (Xptet/Y; R26rtTA/rtTA or Xptet/Y;R26rtTA/WT) were crossed with WT JF1 females, and Dox was added to the drinking water of pregnant females for 5 days starting at E3.5. RNA-seq was performed at E8.5 focusing on extraembryonic (ExE) tissues where the Xp is always the inactive X. Increased Xist RNA levels were observed in rtTA+ E8.5 ExE tissue (up to 17.9 fold) but not in rtTA− controls (Fig. 8e, Extended Data Fig. 10i and Supplementary Table 7). Xist upregulation caused a consistent reduction in X-linked allelic ratios in all rtTA+ tissues (Fig. 8f and Extended Data Fig. 10j,k). At E8.5, we identified 74 escapees, including 9 ExE-specific ones (Fig. 8g). Following Xist upregulation, all categories of escapees were significantly downregulated, with only 11 genes still escaping XCI, including Ogt (previously shown to escape iXCI18,19), as well as Taf1 and Rpsx4 (shown to escape in mid-gestation placenta59) (Fig. 8h,i). Thus, increased Xist levels from E3.5 to E8.5 silence most facultative and tissue-specific escapees, while most constitutive escapees still resist complete inactivation (Fig. 8h,i).

In summary, our in vivo experiments, focused on cell and tissue contexts with iXCI, clearly demonstrate that Xist RNA is a direct regulator of escape in multiple contexts well after the initiation of X-chromosome-wide inactivation.

Discussion

Here, we demonstrate that Xist RNA can directly modulate X-linked escapee expression in dividing NPCs and non-dividing astrocytes as well as in pre- and post-implantation embryos. The silencing action that Xist RNA exerts on escapees is largely SPEN dependent and occurs well outside of the early differentiation time window that XCI was thought to be restricted to. In light of these findings, natural fluctuation in Xist/XIST levels driven by genetic variation at the locus or its regulators can strongly affect X-linked escapee gene expression across and within individuals. Even small increases in X-linked escapee expression, as shown in humans and mice, may contribute to cancer development45,49.

In human brain transcriptomic data, we found that higher XIST levels correlate with lower escapee expression. This is consistent with a recent study showing that XIST RNA levels are heterogeneous across single cells in the human brain, and lower levels of Xi-associated XIST correlate with larger sex differences in gene expression, an indicator of Xi transcriptional activity79. A similar approach showed that XIST RNA levels vary across breast cancer subtypes, with those expressing the highest XIST levels being characterized by lower levels of breast cancer-specific X-linked escape45.

We also found evidence for misregulation of autosomal gene expression upon Xist overexpression, which might indicate spreading of Xist RNA on autosomal loci80. However, autosomal genes were both up- and downregulated without locus-specific clustering, suggesting indirect effects of Xist upregulation via altered escapee dosage, many of which are transcription and chromatin regulators.

A recent study showed that XIST can re-silence genes that had been reactivated on the Xi in B cells, if XIST was first switched off and then back on46. Furthermore, ectopic induction of a human XIST complementary DNA (cDNA) from an autosome in cancer cells led to repression of a reporter gene81, and the overexpression of XIST from chromosome 21 in neural stem cells was found to silence autosomal genes82. However, the integration of XIST transgenes onto autosomes does not explore the role of endogenous XIST in modulating X-linked gene dosage and Xi transcriptional activity.

Our work directly addresses the fundamental question of the role of Xist in regulating escapee expression by increasing Xist levels on an already inactive X chromosome in post-XCI cellular and developmental contexts. Escapees that have either lost their repressed state (facultative) or that never acquired it (constitutive) during differentiation are still fully susceptible to Xist–SPEN-mediated transcriptional repression in differentiated cells. Irreversible escapee silencing is accompanied by higher promoter DNA methylation. H2AK119Ub is reversibly recruited to the Xi, whereas H3K27me3 is retained at irreversibly silenced escapees, suggesting that PRC2 may participate in maintaining silencing independently of Xist. However, given the known kinetic differences between these two chromatin marks83, we cannot exclude that a longer Dox washout would have resulted in loss of H3K27me3.

Our study also shed light on the interplay between the 3D topology of Xi escapee regions and their transcriptional activity. We demonstrate that TAD-like domains encompassing Xi escapee clusters54 are eliminated by gene repression and reappear upon re-establishment of transcription. In NPCs, this reversibility of 3D structure at the ‘Mecp2Hcfc1’ cluster is not simply a consequence of higher levels of Xist RNA but strictly depends on SPEN-mediated gene silencing. The lack of structural changes upon Xist upregulation in ES cells suggests that the recruitment of SPEN alone is not sufficient to change the 3D structure of the Xi upstream of gene silencing, at least in this cellular context. In this study, we focused on two clusters, but we expect these effects on 3D topology to occur at all clusters of escapees on the Xi. Furthermore, although increased levels of Xist RNA and ensuing escapee silencing can overrule TAD-like structures on the Xi in post-XCI cells, such structures might still facilitate the onset of facultative escape during development.

The sensitivity and reversibility of facultative and constitutive escapees to Xist RNA silencing is strikingly different. Constitutive escapees are less susceptible and maintain the capacity to resist full XCI. These genes are involved in fundamental functions, including chromatin regulation, protein translation and ubiquitination84,85, and are believed to be highly dosage-sensitive, as they have retained a Y-chromosome homologue during sex chromosome evolution84. Thus, they presumably need to be protected from complete Xist-mediated silencing not only during development, when XCI is first initiated, but also in adult tissues, as any increase in Xist RNA levels could potentially lead to their inactivation with deleterious effects.

By contrast, facultative escape is highly variable and unlikely to have the same evolutionary pressures. Whether facultative escape reflects inefficient XCI maintenance or is actually purposeful is still not fully understood. As prolonged high levels of Xist RNA lead to irreversible inactivation of these genes, we speculate that the capacity of facultative genes to become reactivated and to escape XCI in some contexts may be determined by the levels of Xist RNA to which they were exposed at the onset of XCI. During embryonic development and ES cell differentiation, XCI is not perfectly synchronous18 and different cells will express different levels of Xist RNA23, potentially setting a threshold for facultative escapees to remain susceptible to varying Xist RNA levels in adult somatic cells. Accordingly, the modulation of their expression levels following changes in Xist RNA expression may underlie the plasticity of these X-linked genes to allow for fine-tuning gene dosage regulation in different conditions. Our study uncovers a role for endogenous Xist RNA levels in tuning escapee dosage and lays the foundation for exploring its impact on disease, identifying biomarkers and developing X-linked gene dosage therapies.

Methods

Cell culture

mES cells TX1072 (Mus musculus castaneus (Cast/EiJ) × Mus musculus domesticus (C57BL/6)) have been previously derived in the laboratory56. Cells were cultured on a gelatine-coated (0.1% gelatine in 1× PBS) cell culture dish in 2i-containing ES cell media (DMEM, 15% fetal bovine serum, 0.1 mM β-mercaptoethanol, 1,000 U mL−1 leukaemia inhibitory factor, CHIR99021 (3 µM) and PD0325901 (1 µM)).

NPC differentiation

mES cells TX1072 were differentiated and sub-cloned as previously described53. In brief, 1 × 106 ES cells were seeded in a gelatin-coated 10-cm petri dish in N2B27 media (DMEM/F12:Neurobasal (1:1), L-glutamine, 0.1 mM 2-mercaptoethanol). At day 7 of differentiation, 3 × 106 cells were plated in N2B27 media supplemented with epidermal growth factor (EGF) and fibroblast growth factor (FGF) (10 ng ml−1 each) in bacterial Petri dishes to prevent cells from attaching to the plates. After 3 days of cell growth in suspension as cellular aggregates (or spheres), the aggregates were harvested and plated onto gelatine-coated 10-cm Petri dishes in N2B27 media supplemented with EGF and FGF. Monolayer NPCs grew out of the attached sphere. To generate the E6 NPC clone used in this study, 5,000–10,000 single cells were plated in 10-cm Petri dishes and single clones were manually picked after 15–20 days. Single NPC clones were expanded and characterized by RNA-FISH to assess karyotype stability. In case of unstable karyotype resulting in gain or loss of chromosomes, NPC clones were either discarded or further sub-cloned. Clone E6 was regularly tested for karyotype stability by RNA-FISH at the end point of each experiment, before sequencing. The NPC clones CL30 and CL31 carrying endogenous SPEN alleles tagged with AID–Halo have been previously generated in the laboratory25. Each line was sub-cloned to obtain karyotypically stable clones named CL30.7 and CL31.16. NPCs were cultured on a gelatine-coated (0.1% gelatine in 1× PBS) cell culture dish in NPC media (N2B27 media supplemented with with FGF2 (10 ng ml−1) and EGF (10 ng ml−1), both from PeproTech).

Astrocyte differentiation

NPC clone E6 was used for astrocyte differentiation. Tissue culture plates or coverslips (for RNA-FISH and immunostaining) were coated with Poly-D-Lysine overnight and washed three times in water before laminin coating for at least 2 h. NPCs were seeded in astrocyte differentiation media (N2B27 medium supplemented with 20 ng ml−1 bone morphogenetic protein (BMP4, R&D Systems)). Cells were differentiated for 3 days before starting Dox treatment in terminally differentiated astrocytes.

Cell treatments

Xist expression in TX1072 was induced by addition of Dox (1 µg ml−1) to the NPC media or astrocyte media. Culture media supplemented with Dox were renewed every 24 h. For Dox washout, Dox-containing media were removed and cells were refreshed with Dox-free culture media. Auxin-mediated depletion of SPEN was achieved by supplementing the culture media with Auxin (Sigma) at the concentration of 500 µM, as previously described25. Auxin-containing media were renewed every 24 h.

RNA-FISH

RNA-FISH on NPCs and pre implantation embryos was performed as previously described86,87. NPCs were dissociated using Accutase (Invitrogen) and attached to Poly-L-Lysine (Sigma)-coated coverslips for 10 min. Cells were fixed with 3% paraformaldehyde in PBS for 10 min at room temperature and permeabilized with ice-cold permeabilization buffer (1× PBS, 0.5% Triton X-100, 2 mM vanadyl–ribonucleoside complex (New England Biolabs)) for 4 min on ice. Coverslips were stored in 70% ethanol at −20 °C. Cells were dehydrated in increasing ethanol concentrations (80%, 95% and 100%) and air dried quickly. Probes were prepared from plasmid p510. Probes were fluorescently labelled by nick translation (Abbott). We used dUTP labelled with ATTO-488 green (Jena Bioscience) or Cy5 (Merck). Labelled probes were co-precipitated with mouse Cot-1 DNA (ThermoFisher) in the presence of ethanol and salt, resuspended in formamide, denatured at 75 °C for 8 min and competed at 37 °C for 40 min. Probes were hybridized in FISH hybridization buffer (50% formamide, 20% dextran sulfate, 2X SSC, 1 μg μl−1 BSA (New England Biolabs), 10 mM vanadyl–ribonucleoside complex) at 37 °C overnight. The next day, coverslips were washed three times for 5 min with 50% formamide in 2X SSC at 42 °C and three times for 5 min with 2X SSC at room temperature. 4,6-Diamidino-2-phenylindole (DAPI; 0.2 mg ml−1) was added to the second wash, and coverslips were mounted with Vectashield (Vectorlabs). For E3.5 and E4.5 embryos, we followed a similar protocol with these modifications: coverslips were incubated in Denhardt’s solution (3X SSC, 0.2 mg ml−1 BSA, 0.2 mg ml−1 Ficoll-400 and 0.2 mg ml−1 polyvinylpyrrolidone (PVP40) in water) for 3 h at 65 °C, followed by incubation in 3:1 methanol–glacial acetic acid solution for 20 min at room temperature and in 0.25% (vol/vol) glacial acetic acid 0.1 M triethanolamine solution for 10 min at room temperature. The zona pellucida was removed by treatment with acidified Tyrode’s solution. E3.5 embryos were permeabilized for 13 min and E4.5 for 20 min, respectively. Images were acquired with an OLYMPUS iXplore Spin-SR Spinning Disk microscope with a 60× or 100× objective. Images were analysed using ImageJ software (Fiji).

Astrocyte immunostaining

Astrocytes were fixed in 3% paraformaldehyde for 10 min at room temparature and washed once with PBS. Cells were permeabilized with permeabilization solution (0.25% Triton, 2 mM vanadyl–ribonucleoside complex in PBS) for 10 min at room temperature. After permeabilization, cells were blocked with blocking solution (2.5% BSA, 1 U µl−1 RNasin (Promega), 0.1% Tween-20 in PBS) for 1 h at room temperature and incubated overnight with primary antibodies in blocking solution (1:400 GFAP (#173002, Synaptic System), 1:200 Ki67 (#556003, BD biosciences)). After three 10-min washes with PBS + 0,1% Tween (PBST), cells were incubated with secondary antibodies in blocking solution for 1 h at room temperature (1:100 Alexa Fluor, Thermo Fisher Scientific). After three 10-min washes with PBST (DAPI was added to the second wash at 1:1000), samples were mounted using ProLong Diamond antifade mountant and imaged with an OLYMPUS iXplore Spin-SR Spinning Disk microscope 100×.

NPC RNA extraction and RNA-seq

RNA was extracted from >1 M NPCs using the RNeasy kit and on-column DNAse digestion (QIAGEN). RNA integrity was measured using the Bioanalyzer Nano Kit. Only high-quality RNA was used for subsequent library preparation using the NEBNext Poly(A) mRNA Magnetic Isolation Module (E7490L) and NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (E7760L, New England Biolabs (NEB)) implemented on the liquid handling robot Beckman i7. Obtained libraries that passed the quality control (QC) step were pooled in equimolar amounts, and the pools were loaded on the Illumina sequencer NextSeq 500 or NextSeq 2000 and sequenced bi-directionally, generating ~500 million paired-end reads that were each 75 bases long. For the 129/Sv × Cast-EiJ NPCs, RNA was quantified with Qubit RNA Broad Range assay (Q10211, Invitrogen). RNA was sent to Novogene for RNA integrity and purity quality check followed by eukaryotic strand-specific mRNA (with PolyA enrichment) library preparation. Libraries were then pooled and sequenced on an Illumina Novaseq 6000 platform for 2 × 150 bp paired-end reads for a total of 80 million reads per sample.

Blastocyst collection and whole-embryo RNA-seq

All animal experimental designs and procedures were performed in agreement with the rules and regulations of the Institutional Animal Care and Use Committee (IACUC) under protocol numbers 019-03-21EH and 24-007_HD_EH. Embryos were derived from mating between 8–40-week-old C57BL/6 TX males Xptet/Y; R26rtTA/WT (whole embryo RNA-seq) or Xptet/Y; R26rtTA/rtTA (RNA-FISH) and superovulated 5–7-week-old WT JF1 females. Superovulation of JF1 females was induced by injecting 50 µl anti-inhibin serum (AIS) followed by injecting 2.5 U hCG 45–47 h after the AIS injection. Embryos were harvested at E2.5 and E3.5 and cultured in vitro in G-1 PLUS media (Vitrolife) in the presence of 10 µg ml−1 Dox for 24 h. For RNA-FISH analysis, approximately half of the collected embryos at each timepoint were grown in culture medium without Dox. The sex of the embryos was determined either by Xist RNA-FISH or by PCR after RNA-seq library preparation. Single embryos were picked and washed three times with transfer buffer (1× PBS, 0.4% BSA) and transferred into 0.2-ml PCR tubes containing 2 μl lysis buffer (0.7% Triton X-100, 2 U μl−1 RNasin (Promega), 1 μl oligo-dT30VN primer (10 μM 5′-aagcagtggttatcaacgcagagtact30vn-3′) and 1 μl 10 mM dNTP mix (ThermoFisher)). Illumina libraries were prepared by using a modified smart-seq2 protocol83 using SuperScript IV Reverse Transcriptase (RT) and tagmentation procedure as previously described (Henning 2018). The RT reaction mix was as follows: 2 μl SSRT IV 5x buffer; 0.5 μl 100 mM dithiothreitol; 2 μl 5 M betaine; 0.1 μl 1 M MgCl2; 0.25 μl 40 U μl−1 RNAse inhibitor; 0.25 μl SSRT IV; 0.1 μl 100 uM template-switching oligonucleotide, 1.15 μl RNase-free H2O. The RT thermal conditions were 52 °C for 15 min and 80 °C for 10 min. cDNA was generated using 16 PCR cycles. The cDNA cleanup (0.6× solid-phase reversible immobilization ratio) was carried out omitting the ethanol wash steps, and the elution volume was 13 μl H2O. For tagmentation, the sample input was normalized to 0.2 ng μl−1. Obtained libraries that passed the QC step were pooled in equimolar amounts. After library preparation, the sex and genotype of each embryo were assessed by PCR for rtTA (rtTA_F, acgccttagccattgagatg, rtTA_R, tctttagcgacttgatgctc); Xist (Xist_F, ggttctctctccagaagctaggaa, Xist_R, tggtagatggcattgtgtattatatg) and Eif2s3y (Eif2s3y_F, aattgccaggttattttcattttc, Eif2s3y_R, agttcagtggtgcacagcaa). Libraries were sequenced at 50 bp paired-end reads on a NextSeq 2000 platform. The sequence of the rtTA transactivator integrated at the Rosa26 locus in TX mice is shown in Supplementary Fig. 2.

Xist induction in vivo, ExE RNA extraction and RNA-seq

All experimental designs and procedures were performed in agreement with the rules and regulations of IACUC under protocol numbers 019-03-21EH and 24-007_HD_EH. We mated 8–40-week-old C57BL/6 TX males Xptet/Y; R26rtTA/WT or Xptet/Y; R26rtTA/rtTA with 8–10-week-old WT JF1 females. Xist was induced by adding Dox (1 g l−1 Dox and 100 g l−1 sucrose57) to the drinking water of pregnant females 3.5 days after coitum. The water bottles were changed every 48 h and protected from light. Non-induced embryos were obtained from pregnant females provided with water containing only sucrose. After 5 days of Dox treatment (E8.5 after coitum), embryos were dissected from the uteri of the pregnant females. ExE tissues were dissected in PBS and collected in 150 µl 1x RNA Protection Reagent (#T2011-1, NEB), snap-frozen and stored at −70 °C. RNA extraction was performed using the Monarch Total RNA Miniprep Kit (T2010S, NEB) following the protocol for mammalian whole-blood RNA extraction with a few modifications88. RNA was eluted in 30 µl water. Sexing of the ExE samples was performed using quantitative PCR (qPCR). cDNA was generated from 20 ng RNA using SuperScript IV RT (Invitrogen) and random hexamers. qPCR experiments were performed with Fast SYBR Green Master Mix (Applied Biosystems) according to manufacturer’s instructions and analysed on a QuantStudio Real-Time PCR Light Cycler (Thermo Fisher Scientific). The following primers were used: Xist (Xist_F, ggttctctctccagaagctaggaa, Xist_R, tggtagatggcattgtgtattatatg), Eif2s3y (Eif2s3y_F, aattgccaggttattttcattttc, Eif2s3y_R, agttcagtggtgcacagcaa) and actin (Actin_F aaccctaaggccaaccgtgaaaag, Actin_R catggctggggtgttgaaggtctc). For RNA-seq library preparation, 1 ng RNA (in 2.4 µl) was mixed with 1 µl 10 mM dNTP mix and 1 μl oligo-dT30VN primer. Subsequent library preparation steps were carried out as previously described for whole-embryo RNA-seq. Libraries were sequenced at 50 bp paired-end reads on a NextSeq 2000 platform.

Capture Hi-C

Capture Hi-C was performed as previously described89. Two arrays of biotinylated RNA probes were designed to tile 3 Mb targets on the mouse X chromosome (Hcfc1Mecp2 cluster; ChrX: 72,590,000–75,430,000; Kdm5c cluster; ChrX: 150,210,000–153,045,000; Kdm6a cluster; ChrX: 15,725,000–18,725,000). The probe arrays were synthesized by Agilent according to SureSelect DNA target-enrichment technology.

Enzymatic methylation sequencing

Genomic DNA (gDNA) from >1 M NPC was extracted using a column-based DNeasy Blood & Tissue Kit (QIAGEN). DNA integrity was tested on a 0.8% agarose gel, and high-quality gDNA was used to prepare libraries according to the NEBNext Enzymatic Methyl-seq Kit following the section for large insert libraries with minor modifications. A total of 55–100 ng gDNA was used per library, including a spike-in of pUC and lambda DNA as a control for methylation efficiency. Samples were fragmented using the Covaris S2 System to achieve an average fragment size of 350–400 bp and barcoded using five PCR cycles for 100 ng input and six PCR cycles for 55 ng input. The obtained libraries were pooled in equimolar amounts and sequenced at 100 bp paired-end reads on a NextSeq 2000 platform.

ATAC-seq

Assay for transposase-accessible chromatin using sequencing (ATAC-seq) was performed following the Omni-ATAC protocol90. A total of 25,000 cells were collected, lysed for 3 min on ice in lysis buffer (10 mM Tris–HCl pH.5, 5 M NaCl, 1 M MgCl2, 0.1% NP-40, 0.1% Tween-20, 0.01% digitonin), washed in wash buffer (10 mM Tris–HCl pH.5, 5 M NaCl, 1 M MgCl2, 0.1% Tween-20) and spun down at 500 RCF at 4 °C for 10 min. Pellets were resuspended in 50 µl transposition reaction (2X TD buffer, 1× PBS, 0.1% Tween-20, 0.1% digitonin, 5 µl Illumina Tn5 transposase) and incubated for 30 min at 37 °C with 1,000 rpm agitation. DNA was isolated with a Zymo DCC5 kit and eluted in 21 µl elution buffer. DNA samples were initially amplified by five cycles of PCR, followed by a variable number of additional amplification cycles estimated by qPCR for each sample. PCR products were purified using the Zymo DCC5 kit and eluted in 20 µl water. A two-size selection of fragments was performed using 0.5× and 1.3× volume of AMPure XP beads (Beckman Coulter). Libraries were quantified and analysed using Qubit and Tapestation assays, before preparing equimolar dilutions. Paired-end sequencing was performed on a NextSeq 500 (Illumina).

CUT&RUN

CUT&RUN was performed as previously described91. In brief, 0.5 million cells were collected and permeabilized in 1 ml nuclear extraction buffer (20 mM HEPES pH 7.9, 10 mM KCl, 0.5 mM spermidine, 0.1% Triton X-100, 20% glycerol, c0mplete EDTA free). If needed, cells were frozen at −80 °C using slow-freezing pots to preserve integrity and then thawed on ice before starting the protocol. Cells were spun down at 3,500 rpm for 5 min and resuspended in 600 μl nuclear extraction buffer. Nuclei were then gently mixed with 300 μl activated bead slurry, prepared from 10 μl Bio-Mag Plus Concanavalin A-coated beads (86057, Polysciences) per 0.5 million cells and incubated at room temperature for 5–10 min on a rotating wheel. Blocking was performed on ice for 5 min in blocking buffer (wash buffer 20 mM HEPES pH 7.5, 150 mM NaCl, 0.5 mM spermidine, 0.1% BSA, cOmplete EDTA free, supplemented with 2 mM EDTA). After blocking, nuclei were washed with 1 ml wash buffer, resuspended in 500 μl wash buffer containing target antibodies diluted 1:100 (H3K27me3 (9733, Cell Signaling), H2AK119Ub (D27C4, Cell Signaling)) and incubated overnight at 4 °C on a rotating wheel. The next day, nuclei were washed three times with wash buffer, A-MNase fusion protein (pA-MNase, generated by the EMBL PepCore facility) was added at 700 ng ml−1 in 500 μl wash buffer and they were incubated at 4 °C for 1 h on a rotating wheel. After three washes, nuclei were resuspended in 150 μl wash buffer and equilibrated to 0 °C in a metal block on ice for 5 min. Chromatin digestion was performed for 30 min on ice by adding 3 μl 100 mM CaCl2 to the sample. Digestion was stopped by adding 150 μl 2X STOP buffer (200 mM NaCl, 20 mM EDTA, 4 mM EGTA, 0.1% NP-40, 40 μg ml−1 glycogen). Next, the NaCl concentration in the sample was raised to 300 mM by adding 20 μl 5 M NaCl to the sample, and RNA digestion was performed using 1.5 μl RNAse A (Thermo Scientific, 10 mg ml−1) for 20 min at 37 °C. Following beads removal, the supernatant was treated with ProteinaseK (Thermo Scientific, 300 μg ml−1) in 0.1% SDS for 30 min at 56 °C. Total DNA was extracted using phenol-chloroform, precipitated with 100% EtOH at −20 °C overnight and size selection was performed using Ampure XP beads (double-sided size selection: first round: bead slurry added at 0.5× the sample volume; second round: bead slurry added at 1.3× the sample volume). The DNA was eluted in 25 μl low-EDTA buffer (10 mM Tris, 1 mM EDTA (pH8)), quantified using Qubit and analysed on Tapestation (Agilent). Barcoded CUT&RUN libraries were prepared from 25 ng DNA using the NEBNext Ultra II DNA Library Prep Kit for Illumina according to the manufacturer’s protocol and sequenced on a NextSeq 2000 with 75 bp paired-end read settings.

Bioinformatics

Allele-specific pre-processing of RNA-seq data

All steps for the pre-processing of RNA-seq data can be reproduced using a nextflow pipeline available at https://github.com/yuviaapr/allele-specific_RNA-seq. Reads were trimmed using trim_galore (v0.6.6). To construct reference genomes for allele-specific mapping, genomes in which known heterozygous variants (https://ftp.ebi.ac.uk/pub/databases/mousegenomes/REL-2112-v8-SNPs_Indels/mgp_REL2021_snps.vcf.gz) were masked by the ambiguous base N were constructed using SNPsplit (SNPsplit_genome_preparation script, v0.5.0) and converted to STAR references (STAR v2.5.3a). For the E6, CL30/CL30.7 and CL31/CL31.16, the mm10 genome (GRCm38) was used. For the embryo and 129/Sv × CAST/EiJ cell lines, the mm11 genome was used (GRCm39). Reads were aligned to the N-masked genomes using the options –sjdbOverhang 99–outFilterMultimapNmax 1–outFilterMismatchNmax 999–outFilterMismatchNoverLmax 0.06–alignIntronMax 500000–alignMatesGapMax 500000–alignEndsType EndToEnd. The rtTA transgene was included in the reference genome used for the mapping of the embryo data (Supplementary Fig. 2). Reads mapping to the mitochondrial genome were removed and split into parental genotypes using SNPsplit and known heterozygous variants. Gene-level read counts for each haplotype and without allelic resolution were derived using featureCounts (v2.0.1).

Computation of allelic ratios in RNA-seq for escapee definition

Allele-specific expression per gene was calculated from genotype-assigned read counts. First, lowly expressed genes with an average allelic read count lower than ten were excluded (summing both haplotypes). Escape of an X-linked gene was generally quantified as the fraction of read counts on the inactivated X against the total read count across both active and inactive X (Xi / (Xi + Xa), allelic ratio, also known as d-score). Genes were considered as escaping when the allelic ratio exceeded 0.1 (10% of expression from the inactive X). As the causal gene of XCI, Xist was not considered an escapee. A small number of other genes showed allelic ratios >0.8, which probably represents either strain-specific expression or technical artefacts due to erroneous mapping or single nucleotide polymorphisms (SNPs) with non-reference genotypes, rather than genuine expression largely restricted to the Xi. These genes were excluded for subsequent analysis. For all analyses of escape in the E6 cell line, we used the set of 133 genes (134 including Xist) which showed an allelic ratio >0.1 in all untreated replicates. The use of N-masking of the genome should reduce mapping bias at SNP positions. Furthermore, we focus on relative changes (reductions) in allelic ratios, which should be unaffected by technical artefacts.

Escapee meta-analysis

To obtain a consensus of escaping genes from literature, we performed a meta-analysis of papers that used genome-wide expression profiling to derive escapees. For each study (Supplementary Table 1), we considered the genes defined as escapees or silenced by the experimental and analysis methodology used in that paper. In each study, a gene is therefore considered ‘escaping’, ‘silenced’ or ‘not detected’. We then classified genes as ‘constitutive escapees’ if they were detected in at least three and escaped in more than 50% of the studies. We defined genes as ‘facultative escapees’ if they were escaping in less than 50% of studies or were only detected in fewer than three (but escaped in at least one study). Finally, we defined genes as ‘silenced’ if they were not escaping in any assayed study.

Differential allelic imbalance analysis

To test for differential allelic imbalance (differences in escape between conditions), we used binomial generalized linear models (R package stats, v4.2.0). We modelled the number of reads mapping to the inactive X as binomially distributed with the formula (k, n) = 1 + treatment and tested for the significance of a treatment coefficient using a Wald test. P values were adjusted using the Holm–Bonferroni method.

Modelling of escape trajectories

We used nonlinear parametric regression to fit an exponential decay curve to the allelic ratios after Xist overexpression. Specifically, we used the nls function (R, stats) to fit the allelic ratios r = Xi / (Xi + Xa) with the exponential decay function r = a* exp(k*t) + b, where t represents the number of days of Dox treatment, a is a scaling parameter of the decay, b allows for an asymptotic offset and k specifies the decay constant. In particular, k relates to the speed (half-life) of silencing loss by t1/2 = −ln(0.5) / k and b quantifies whether there is residual escape after prolonged Xist overexpression. We also fit the same model without b, to test which genes showed evidence for residual escape as opposed to full silencing. After excluding all genes with a regression R2 < 0.3 for both fits, we used the Bayesian information criterion to classify whether genes showed residual escape.

Definition of escapee gene groups

To define locally close groups of escapees on the X chromosome, we iterated through all escapees on the X, grouping genes into one ‘gene group’ if the gene start position was within 100 kb of each other and splitting whenever this was not the case. This approach partitioned the escapee set into 11 groups of three or more genes (with 3–14 escapees) and 57 singles or pairs.

Differential expression analysis

We used DESeq2 (R, v1.36.0) to test both haplotype-specific and total expression counts for differential expression using standard settings, using the formula ~Treatment and adjusting P values using the Benjamini–Hochberg correction.

Allele-specific analysis of DNA methylation data

Processing of DNA methylation was performed using the methylseq nextflow pipeline with the emseq option (v2.3.0, v3.3.0, NextFlow v22.10.6, v24.10.02). Reads were trimmed using TrimGalore (v0.6.7) and aligned to the same N-masked genome (GRCm38) using bismarck (v0.24.0), and we used SNP_split (v0.5.0) to assign mapped reads to parental genomes, similar to the RNA-seq data. We finally used bismark_methylation_extractor from the Bismarck software to generate base-level methylation counts for both haplotypes. We retrieved genomic coordinates of CpG islands (http://genome.ucsc.edu/cgi-bin/hgTrackUi?g=cpgIslandExt), gene bodies and promoters (2 kb upstream to 200 bp downstream of transcription start sites) (EnsDb.Mmusculus.v79, v2.99.0). To quantify DNA methylation in promoters, we used regions of accessible chromatin defined by ATAC-seq data in matched cell lines (see below) if they overlapped with annotated promoter regions. We quantified average methylation values across per-base methylation values b = methylated / (methylated + unmethylated) in the regions of interest.

Allele-specific Capture Hi-C analysis

Allele-specific Capture Hi-C analysis was performed using the Hi-C Pro pipeline (v2.11.4)92 as previously described89. Paired-end reads were first independently aligned using bowtie2 to the same N-masked genome reference. Read pairs were then assigned to either C57BL/6 J or CAST-EiJ genomes, and allele-specific BAM files for downstream analysis were generated. Low-quality reads, multiple hits, singletons and read pairs that did not map to the same genotype were then removed. Further filtering for valid interactions, which excludes reads outside of the captured region, was performed, and only valid pairs were used to build the normalized contact maps at a 10-kb resolution with the cooler package (v0.8.9). Insulation scores were calculated using the cooltools package (v0.3.2). Comparative Hi-C contact maps were generated using the HiCExplorer suite. The maps were first normalized to observed / expected values using HiCTransform, followed by comparative analysis with HiCcompare. All data were visualized using pyGenomeTracks93. Capture Hi-C statistics including sequencing depth and mapped reads are presented in Supplementary Table 8.

Allele-specific ATAC-seq analysis

All steps for the pre-processing of ATAC-seq data can be reproduced using a nextflow pipeline available at https://github.com/yuviaapr/allele-specific_ATAC-seq. In brief, initial quality checks of the raw FASTQ files were performed using FastQC (v0.11.9). Reads were trimmed using TrimGalore (v0.6.3). A reference genome for allele-specific mapping was constructed as described for the allele-specific RNA-seq analysis and used to generate a bowtie index. Paired-end reads were aligned using bowtie2 (v2.3.4.1) to the N-masked genome index with the following parameters: –very-sensitive -X 2000. Duplicates were removed using Picard Tools (v2.20.8) before downstream analyses. Peaks were called using MACS2 (v2.2.7.1) using the following parameters: -g mm–buffer-size 100 -q 0.01–keep-dup all–min-length 100–format BAMPE–nomodel. Consensus peaks were generated using the ‘dba.peakset’ function from the DiffBind Bioconductor R package (v3.8.4), with the requirement that peaks should be present in at least two BAM files. Blacklist regions (from ENCODE for BSgenome.Mmusculus.UCSC.mm10) were removed using the dba.blacklist function, and the raw counts for the resulting consensus peak set were generated using the dba.count function using summits = FALSE. Peak counts were normalized using the dba.normalize function, with default settings. Differential accessibility analysis between the split BAM files coming from the Xi and Xa was performed using the dba.analyze function with methods = DBA_DESEQ2 (calling the DESeq2 Bioconductor R package (v1.38.3) in the background). Peaks were annotated to their nearest gene using the ChIPseeker Bioconductor R package (v1.34.1) using the mm10 genome from the TxDb.Mmusculus.UCSC.mm10.knownGene Bioconductor R package (v3.10.0).

Allele-specific CUT&RUN analysis

All steps for the pre-processing of CUT&RUN data can be reproduced using a nextflow pipeline available at https://github.com/yuviaapr/allele-specific_CUTandRUN. In brief, paired-end reads were mapped with Bowtie2 (v2.3.4.1) (–very-sensitive -X 1000–no-mixed–no-discordant) against an N-masked genome reference (generated as described for allele-specific RNA-seq analysis). Low-quality and mitochondrial reads were filtered using Samtools (v1.9). Genotype assignment was performed with SNPsplit (v0.3.4), followed by duplicate removal with Picard Tools (v2.20.8). Three BAM files were generated: C57BL/6, CAST-EiJ and total reads (allelic and unassigned). BigWig files were generated from each BAM file using bamCoverage, with scale factors calculated using edgeR on 10 kb binned coverage data.

Processing of embryo RNA-seq data

The embryo RNA-seq data were pre-processed as described above (see ‘Allele-specific pre-processing of RNA-seq data’ section), using the SNPs between C57BL/6 and JF1 mice (https://ftp.ebi.ac.uk/pub/databases/mousegenomes/REL-2112-v8-SNPs_Indels/mgp_REL2021_snps.vcf.gz). To confirm the annotated genotypes of the embryos, reads were mapped to the rtTA transgene sequence using Bowtie2 (v2.5.4), and any embryo with >150 mapped transgene reads was considered rtTA positive. For developmental staging, principal component analysis (PCA; prcomp, stats v4.2.0) was performed on total read counts after size-factor normalization (estimateSizeFactors, DESeq2, v1.36.0) and subsetting on highly variable genes (getTopHVGs, scran, v1.24.1). The first principal component separated embryo stages as determined by morphological staging and was used as a developmental pseudotime. For the allelic analysis, genes were considered escapees if they showed an allelic ratio >0.1 in at least 50% of embryos. Genes were annotated into escape categories as in the meta-analysis and classified as ‘E4.5 and E8.5 specific’ if they did not escape in E6 and/or were not annotated as escapees in the meta-analysis.

Processing of human RNA-seq data

The RNA-seq count tables from normal brain tissues were collected through the GTEX data portal (v8, https://www.gtexportal.org/home/downloads/adult-gtex/bulk_tissue_expression). Only female samples were used (n = 728). The raw RNA-seq counts were normalized using the trimmed mean of M values (TMM) method94. Human escapees were obtained from the work of Tukianinen et al.7. Only genes classified as ‘escape’ and ‘variable’ were considered. In total, 128 genes were detected in the GTEX data. The X-linked gene expression levels were obtained by calculating the mean expression of all genes per sample, and the normalized (z-score) mean expression of escapees versus the normalized expression of Xist was plotted.

Statistics and reproducibility

No statistical methods were used to predetermine sample size. The experiments were not randomized and the investigators were not blinded to allocation during experiments and outcome assessment.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.