Main

Myocardial involvement occurs in 25–50% of patients with systemic lupus erythematosus (SLE), including those without symptoms, and can result in myocardial inflammation with ventricular dysfunction, progression to heart failure and high rates of mortality1,2,3,4,5,6,7. Organ damage in SLE is presumed to be driven by both T cells and specific autoantibody populations that react with the host tissue, form immune complexes and drive inflammation8,9,10. In the heart, the identity and mechanisms by which autoantibodies contribute to myocardial injury remain elusive. Growing evidence suggests that autoantibodies can directly mediate myocardial injury. Congenital heart block in neonates exposed to maternal SLE autoantibodies through passive transfer across the placenta provides evidence that injury can occur through the direct effects of autoantibody binding11,12,13,14,15. This paradigm is further supported by evidence in other autoimmune conditions in which autoantibodies binding to cardiac surface proteins, including ion channels and β-adrenergic receptors, impair calcium handling and action potential propagation, increase reactive oxygen species (ROS), activate apoptosis and cause heart failure and arrhythmias16,17,18,19,20,21,22,23,24. In addition, multiple studies have reported direct contributions of SLE autoantibodies to alterations in brain function by directly modulating cellular processes in neurons25,26. Taken together, these studies further suggest that, in addition to complement-mediated and immune cell-mediated myocardial injury, autoantibodies may directly lead to cardiac dysfunction via independent mechanisms. Additionally, the absence of reports identifying a specific autoantibody target linked to a particular SLE disease phenotype, either in general or specifically related to myocardial involvement, suggests that multiple SLE autoantibodies act in concert to induce injury. This underscores the complex nature of the disease and the need to investigate the effect of the full repertoire of patient-specific autoantibodies on cardiac tissue function to identify autoantibodies that together lead to myocardial injury in SLE.

Cardiomyocytes derived from human induced pluripotent stem cells (hiPSC-CMs) represent a promising approach for modeling human cardiac pathophysiology in vitro. We previously reported improved maturation of hiPSC-CMs within engineered human cardiac tissues by an electromechanical stimulation regimen that gradually increases the stimulation frequency from 2 Hz to 6 Hz (ref. 27). This ‘intensity training’ regimen subjects tissues to stress while also promoting the development of features similar to those of a more mature human myocardium, including metabolism, ultrastructure and electrophysiology27,28.

Notably, cellular stress in SLE has been associated with the redistribution and clustering of intracellular autoantigens to apoptotic blebs on the surface of the plasma membrane29,30,31. Antigenic fragments created in these blebs, often in relation to ROS generation, evoke autoimmune inflammatory responses in some patients with SLE, unlike those without such cellular stress29,30. Therefore, we hypothesized that stress in the adult human heart could lead to differential autoantibody binding patterns and modulate autoantibody-mediated myocardial injury. To test this hypothesis, we used the intensity training regimen to simulate stress-induced cellular processes, including antigen redistribution, and thereby capture potential additional aspects of disease pathogenesis.

We cultured engineered human cardiac tissue models with serum-derived, purified IgG fractions from individual patients with SLE to capture the full autoantibody repertoire of each patient and the patient-specific effects of purified IgG on cardiac tissue function. Patients with SLE with and without clinical evidence of myocardial inflammation (Myo+ and Myo− patients, respectively) were delineated based on 18F-fluorodeoxyglucose (18F-FDG) uptake in positron emission tomography/computed tomography imaging (18F-FDG–PET/CT). The Myo+ group included patients with SLE with new-onset systolic dysfunction (SD), defined as left ventricular ejection fraction (EF) less than 50% at the time of serum collection (denoted Myo+SD+), and patients with preserved EF (EF > 50%, denoted Myo+SD−). IgG binding to cardiac tissues was quantified, and the impact of binding on tissue function and molecular and transcriptional profiles was assessed. Using phage immunoprecipitation sequencing (PhIP-seq), we characterized patient-specific autoantibody targets, and, using liquid chromatography with tandem mass spectrometry (LC–MS/MS), we profiled cell surface accessible antigens on cardiomyocytes and cardiac fibroblasts to inform the identification of pathogenic autoantibody candidates (Fig.1).

Fig. 1: Overview of the experimental design.
Fig. 1: Overview of the experimental design.The alternative text for this image may have been generated using AI.
Full size image

Figure was created using BioRender.

Results

SLE cohorts

Samples were obtained from patients enrolled in two different SLE cohorts: one pre-existing cohort of patients without cardiac symptoms who were receiving treatment in the outpatient setting and one prospective cohort of patients who were hospitalized for active cardiac disease. Patients with SLE met the 1997 American College of Rheumatology (ACR) classification criteria32. Clinical studies of 18F-FDG uptake were conducted for all patients, both hospitalized and non-hospitalized, to determine the presence of myocardial inflammation. All 18F-FDG–PET/CT scans were evaluated qualitatively for the presence or absence of enhanced myocardial 18F-FDG uptake, and, for a subset of patients, levels of 18F-FDG uptake were quantified by standardized uptake values (SUVs)33 (Methods). Patients with SLE were divided into two primary groups based on myocardial 18F-FDG uptake: (1) Myo− patients were without evidence of myocardial inflammation (SUVmax < 1.5; n = 3); (2) Myo+ patients had evidence of myocardial inflammation (SUVmax ≥ 1.5; n = 8). At the time of 18F-FDG–PET/CT, serum samples were collected, and echocardiograms were obtained to distinguish between Myo+ patients with SD (Myo+SD+, n = 4, with EF < 50%) and Myo+ patients with preserved systolic function (Myo+SD−, n = 4, EF ≥ 50%). No patients in either group had elevated serum troponin. Notably, at the time of the study, all Myo+SD+ patients had recent-onset SD that had not been documented previously in their medical records. Additionally, no patients in either group had histories of ischemic heart disease, and no significant differences were observed in cardiovascular risk factors between groups. Detailed clinical data are summarized in Table 1.

Table 1 Patient cohort clinical characteristics

Engineering human cardiac tissues with advanced properties

Cardiac tissues were engineered by resuspending hiPSC-CMs and primary human cardiac fibroblasts at a 3:1 ratio in fibrin hydrogels, stretched between two flexible pillars and electromechanically stimulated using our previously published milliPillar platform28. Electromechanical stimulation frequency was increased from 2 Hz to 6 Hz over 2 weeks (intensity training regimen), followed by an additional week of stimulation at 2 Hz, as previously described27. To further enhance tissue performance, tissues were cultured in maturation medium (MM) previously reported to shift cardiomyocyte metabolism from glycolysis toward fatty acid oxidation, increase mitochondrial content and optimize cardiomyocyte function34 (detailed in Methods; Fig. 2a, top panel). Tissues exhibited enhanced compaction, α-actinin striations and calcium handling as compared to those cultured in standard medium (Extended Data Fig. 1a–c). No effect on tissue contractility was observed (Extended Data Fig. 1d). Tissue stimulation at 6 Hz resulted in significantly increased release of lactate dehydrogenase (LDH), indicative of cellular stress (Extended Data Fig. 1e).

Fig. 2: Distinct patient IgG reactivity with engineered cardiac tissues and hiPSC-CMs corresponds with specific clinical outcomes.
Fig. 2: Distinct patient IgG reactivity with engineered cardiac tissues and hiPSC-CMs corresponds with specific clinical outcomes.The alternative text for this image may have been generated using AI.
Full size image

a, Overview of tissue formation, stimulation and treatment with purified patient sera-derived IgG. Each tissue was cultured with IgG from one specific patient. b, Immunofluorescence staining of human IgG (yellow) derived from patient sera and bound to engineered cardiac tissues (scale bar, 500 μm). c, Linear correlation between patient IgG binding levels to engineered cardiac tissues (MFI) and clinical measurements of myocardial inflammation (18F-FDG uptake quantified as SUVs). Each dot represents a patient (n = 9), and dots with SUVmax > 10 represent patients with elevated myocardial inflammation. P value and r2 were calculated by two-tailed Pearson’s correlation analysis. d,e, Immunofluorescence staining of engineered cardiac tissues showing strong sera-derived IgG binding to condensed nuclei (d; scale bar, 20 μm; bottom panels are higher magnification of region of interest in top panels; top panel is confocal maximum intensity projection; bottom panel is single confocal plane) and apoptotic blebs on the cell surface (e; scale bar, 20 μm; bottom panels are higher magnification of region of interest in top panels; both panels are single confocal planes). f, Linear correlation between patient IgG binding levels to the cell surface of live hiPSC-CMs (MFI) and corresponding patient EF. Each dot represents a patient (n = 11). P value and r2 were calculated by two-tailed Pearson’s correlation analysis. g, Quantification using flow cytometry of patient IgG binding to live hiPSC-CMs based on clinical subgroupings. MFI indicates median fluorescence intensity. Data are represented as mean ± s.e.m. n = 3 healthy control patients, n = 3 Myo− patients, n = 4 Myo+SD− patients and n = 4 Myo+SD+ patients (n = 2–3 independent replicate wells per patient sample; exact replicate values are included in Supplementary Table 1). Symbol shapes represent different patients within each group; one-way ANOVA with Tukey’s test for multiple comparisons; ****P < 0.0001. Ctrl, control.

IgG binding to stressed cardiac tissues

IgG fractions were purified and quantified from each patient’s serum sample. At day 14 of cardiac tissue culture, IgG fractions from individual patients were added to the culture media, and tissues were cultured for 14 additional days in which tissues were subjected to stress as part of the intensity training regimen (Fig. 2a, bottom panel). To evaluate the extent of patient IgG binding to tissue antigens accessible to them during culture, the tissues were fixed at day 28 and subsequently stained with secondary anti-human IgG. Patient IgG binding levels were measured as mean fluorescence intensity (MFI). Tissues cultured with IgG from all Myo− patients exhibited low MFI levels. Within the Myo+ group, tissues cultured with IgG from a subset of patients exhibited low MFI levels, whereas substantially higher MFI levels were observed for a different subset of patients who had elevated levels of myocardial inflammation (Fig. 2b and Extended Data Fig. 2a). MFI levels of tissues cultured with IgG from an additional Myo+ patient with high levels of myocardial 18F-FDG uptake (SUVmax = 12.4) confirmed this trend (Extended Data Table 1 and Extended Data Fig. 2b). Linear regression analysis (inclusive of all patients with 18F-FDG uptake quantification, n = 9) revealed a significant positive correlation between MFI and levels of myocardial inflammation measured by SUV (r2 = 0.88, P = 0.0002; Fig. 2c). MFI correlated more strongly with myocardial inflammation than did any clinical metric of myocardial health or SLE severity (Extended Data Fig. 3a).

Further studies comparing the extent of IgG binding to stressed and non-stressed hiPSC-CMs revealed that stress led to a significant increase in IgG binding across all patients. Notably, a significant difference in IgG binding levels between patients with SLE with low myocardial inflammation levels (SUVmax < 10) and elevated myocardial inflammation (SUVmax > 10) was observed only in the stressed hiPSC-CMs, further highlighting the contribution of stress to differential IgG binding patterns among patients with SLE (Extended Data Fig. 3b). IgG binding to healthy left ventricle (LV) human tissue samples revealed similar patterns of IgG binding to non-stressed cardiac tissues, with no significant difference in MFI between patients with high and low levels of myocardial inflammation (Extended Data Fig. 3c).

To further probe the cellular targets of patient IgG, tissues were co-stained with secondary anti-human IgG and α-actinin to evaluate cardiomyocyte integrity and IgG localization. The extent of IgG binding within the stressed tissues varied from cell to cell (Fig. 2d). A subset of cells with patient IgG staining were cardiomyocytes with disrupted α-actinin striations and condensed nuclei, with IgG binding primarily to the nuclei, indicating late cell apoptosis with loss of cell membrane integrity that allowed IgG penetration (Fig. 2d). Additionally, we identified another subset of cells with high levels of localized IgG binding to presumptive apoptotic blebs on surfaces of cardiomyocytes with minimal nuclear condensation (Fig. 2e). Flow cytometric analysis revealed significantly higher IgG binding levels to the apoptotic cell population (Apo+) when compared to live, non-apoptotic cells (Apo−) for IgG from patients with elevated myocardial inflammation. Furthermore, for IgG from two of these patients with elevated myocardial inflammation, no significant differences were observed in IgG binding to stressed Apo− cells and non-stressed Apo− cells, and, for IgG from another patient with elevated myocardial inflammation, stress reduced IgG binding levels to Apo− cells (Extended Data Fig. 3d–g). These data suggest that for IgG from patients with SLE with elevated myocardial inflammation, the heightened IgG binding to cardiac tissues is primarily attributed to increased binding to stress-induced apoptotic cells.

IgG binding to the surface of live cardiomyocytes

As previous studies have reported that autoantibodies bound to plasma membrane targets can directly exert biological effects11,16,17,18,19,20, we investigated the patterns of IgG binding to the surfaces of the live cardiomyocyte populations. Live hiPSC-CMs were incubated with patient IgG fractions, followed by incubation with secondary anti-human IgG, and then sorted using flow cytometry to exclude dead and apoptotic cells. A significant correlation between IgG binding levels (MFI) to live hiPSC-CMs and EF was observed (r2 = 0.54, P = 0.0095; Fig. 2f). Consistently, IgG from Myo+SD+ patients with SLE exhibited significantly higher binding levels to the surface of live hiPSC-CMs compared to IgG binding from all other patient groups and healthy controls (Fig. 2g and Extended Data Fig. 3h).

Myo+SD+ IgGs alter cardiac tissue composition and function

We next sought to investigate whether direct IgG binding to the surface of hiPSC-CMs exerted functional effects on cardiac tissues. After 14 days of tissue incubation with IgG from individual patients with SLE or healthy controls (Fig. 3a), tissues were studied by immunofluorescence staining for α-actinin and vimentin. A higher level of vimentin staining, indicative of fibroblast content, was observed in cardiac tissues cultured with IgG from Myo+SD+ patients. To confirm this effect, we treated fibroblasts in monolayers with IgG from Myo+SD+ patients and observed a significant increase in Ki-67-positive cells, indicating increased fibroblast proliferation (Fig. 3c).

Fig. 3: IgGs from Myo+SD+ patients alter engineered cardiac tissue function and composition.
Fig. 3: IgGs from Myo+SD+ patients alter engineered cardiac tissue function and composition.The alternative text for this image may have been generated using AI.
Full size image

a, Representative bright-field images of engineered cardiac tissues after 14 days of culture with patient-specific purified IgG showing overall tissue morphology for each subgroup (scale bar, 500 μm). b, Representative immunofluorescence images of engineered cardiac tissue stained to show cardiomyocytes (α-actinin, red) and fibroblasts (vimentin, yellow) after 14 day culture with patient-specific IgG (scale bar, 50 μm). c, Quantification of the percentage of Ki-67-positive human cardiac fibroblasts after treatment with patient IgG; n = 3 healthy controls, n = 3 Myo− patients, n = 4 Myo+SD− patients and n = 4 Myo+SD+ patients (n = 8–12 independent replicate wells per patient sample; exact replicate values are included in Supplementary Table 1). d, Representative traces of calcium flux in engineered cardiac tissues after treatment with patient IgG. Values for each curve were normalized to the maximum value. e,f, Quantification of the percent change of the parameters tau (e) and FWHM (f) extracted from engineered cardiac tissue calcium transients after treatment with patient IgG compared to baseline. n = 3 healthy controls, n = 3 Myo− patients, n = 4 Myo+SD− patients and n = 4 Myo+SD+ patients (n = 4–6 independent replicate tissues per patient sample; exact replicate values are included in Supplementary Table 1). Data are represented as mean ± s.e.m. Symbol shapes represent different patients within each group. Statistical significance was determined by ordinary one-way ANOVA with Tukey’s test for multiple comparisons. CF, cardiac fibroblast; Ctrl, control; MFI, mean fluorescence intensity.

As autoantibodies can alter cardiomyocyte calcium homeostasis and activate β-adrenergic stimulation17,20,22,23, we assessed cardiac tissue calcium handling and contractile function using non-invasive data acquisition and analysis modalities (Extended Data Fig. 4a–d). In comparison to baseline, before IgG addition, calcium transient decay constant (tau, τ) and transient amplitude width (full width at half maximum (FWHM)) after 7 days were significantly higher in tissues cultured with IgG from Myo+SD+ patients compared to all other groups, indicating impaired calcium handling (Fig. 3d–f). These results were further supported by dose-dependent increases in tau and FWHM in hiPSC-CM monolayers cultured with increasing concentrations of IgG from Myo+SD+ patients (Extended Data Fig. 5a,b). In addition, a dose-dependent decrease in beating frequency was observed in hiPSC-CMs after 24 hours, which was also significantly lower in hiPSC-CMs cultured with IgG from Myo+SD+ patients when compared to hiPSC-CMs cultured with IgG from Myo− and Myo+SD− patients at the highest IgG concentration (Extended Data Fig. 5c). This trend was also observed in hiPSC-CMs 1 hour after the addition of patient IgG (Extended Data Fig. 5d), suggesting that Myo+SD+ IgG did not act as agonists to β-adrenergic receptors. Finally, no significant differences were observed in cardiac tissue force generation in response to patient IgG.

Myo+SD+ IgG binding alters cardiac tissue transcriptomics

Bulk RNA sequencing (RNA-seq) identified 707 differentially expressed genes (DEGs; false discovery rate (FDR) < 0.05) between Myo+SD+ IgG-treated tissues and Myo− IgG-treated tissues and 1,035 DEGs between Myo+SD+ IgG-treated tissues and Myo+SD− IgG-treated tissues, with an overlap of 244 DEGs (Fig. 4a,b and Supplementary Table 2a,b). No DEGs were found between tissues treated with IgG from Myo+SD− and Myo− patients or between tissues treated with IgG from Myo− patients and healthy controls (Fig. 4a and Extended Data Fig. 6a). Consistent with the observed impairment in calcium handling, tissues cultured with IgG from Myo+SD+ patients exhibited reduced expression levels of genes encoding voltage-gated calcium channel subunits (CACNB2 and CACNA2D1). Moreover, the expression of genes encoding cardiomyocyte transcription factors (MEF2A and MEF2C) were significantly downregulated (Extended Data Fig. 6b,c).

Fig. 4: IgGs isolated from Myo+SD+ patients alter tissue transcriptomics, mitochondrial content and respiration.
Fig. 4: IgGs isolated from Myo+SD+ patients alter tissue transcriptomics, mitochondrial content and respiration.The alternative text for this image may have been generated using AI.
Full size image

a, Volcano plots depicting the DEGs between tissues cultured with patient IgG from different clinical subgroups. Statistical significance was determined by two-sided Student’s t-test with Benjamini–Hochberg correction for multiple comparisons. Genes that were significantly upregulated (FDR < 0.05) are shown in red, and genes that were significantly downregulated (FDR < 0.05) are shown in blue. b, Venn diagram describing the number of DEGs between tissues treated with IgG from Myo+SD+ patients and IgG from either Myo− patients or Myo+SD− patients and the overlapping DEGs. c, PCA plot of global gene expression profiles for tissues treated with IgG from different patients with SLE and healthy controls. Each point represents the average expression of n = 3 independent tissues treated with IgG from the same patient. d, KEGG analysis of DEGs between tissues treated with IgG from Myo+SD+ patients and IgG from Myo+SD− patients. e, KEGG analysis of cardiomyocyte population DEGs between tissues treated with IgG from Myo+SD+ patients and IgG from Myo+SD− patients. f, Changes in hiPSC-CM mitochondrial quantity in response to patient IgG and measured by the MitoTracker Green probe. Ordinary one-way ANOVA with Dunn’s post hoc comparisons test. g, Changes in SDH activity in hiPSC-CMs in response to patient IgG. Ordinary one-way ANOVA with Tukey’s test for multiple comparisons. h, Characterization of IgG effect on mitochondrial respiration in hiPSC-CMs by Seahorse metabolic flux assay. OCR values were normalized to SDH activity. Ordinary two-way ANOVA with Tukey’s test for multiple comparisons. i, Changes in hiPSC-CM RCR in response to patient IgG. Ordinary one-way ANOVA with Tukey’s test for multiple comparisons. j, Changes in hiPSC-CM mitochondrial membrane potential in response to IgG, measured with the TMRM probe. Ordinary one-way ANOVA with Tukey’s test for multiple comparisons; #P < 0.0001 for comparison of the FCCP group to each other patient group. Data are represented as mean ± s.e.m. n = 3 healthy controls, n = 3 Myo− patients, n = 4 Myo+SD− patients and n = 4 Myo+SD+ patients, with n = 3 independent tissues per patient (a), n = 3 wells per patient (f) or n = 4–6 independent replicate wells per patient sample (gj). Exact replicate values are included in Supplementary Table 1. Symbol shapes represent different patients within each group. Ctrl, control; FC, fold change; PC, principal component; PV, P value.

Principal component analysis (PCA) and hierarchical clustering analysis of gene expression of tissues cultured with patient IgG, delineated Myo+SD+ IgG-treated tissues from tissues treated with IgG from other patients with SLE and healthy controls (Fig. 4c and Extended Data Fig. 6d). Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis and Gene Ontology (GO) of DEGs between tissues treated with IgG from Myo+SD+ patients and Myo+SD− patients revealed terms related to cardiomyopathies, cardiac muscle contraction and morphogenesis, adrenergic signaling, apoptosis and sarcomeric proteins (Fig. 4d and Extended Data Fig. 6e). Furthermore, we investigated cardiomyocyte-specific gene expression profiles from bulk RNA-seq data predicted by CIBERSORTx35. Among the DEGs between the cardiomyocyte population within tissues treated with Myo+SD+ IgG and tissues treated with Myo+SD- IgG were genes associated with mitochondria and oxidative stress. KEGG analysis of these DEGs identified pathways associated with oxidative phosphorylation, ROS and cardiomyopathy (Fig. 4e, Extended Data Fig. 7a and Supplementary Table 3). Additionally, CIBERSORTx analysis of cardiac fibroblast abundance within patient IgG-treated tissues revealed significantly larger fibroblast fraction in Myo+ IgG-treated tissues than in those treated with Myo− IgG (Extended Data Fig. 6f), consistent with the observed effects of Myo+SD+ and Myo+SD− IgG on cardiac fibroblast proliferation.

IgGs from Myo+SD+ patients alter hiPSC-CM respiration

Based on the cardiomyocyte population transcriptomic analysis, the high metabolic demand of cardiomyocytes and the association between mitochondrial impairment and cardiac dysfunction36,37,38, we sought to further investigate the effect of patient IgG on mitochondrial function. We took an orthogonal approach to quantify mitochondrial mass. First, MitoTracker analysis showed significantly lower mitochondrial mass in hiPSC-CMs cultured with IgG from Myo+SD+ patients compared to hiPSC-CMs cultured with IgG from other patient subgroups (Fig. 4f and Extended Data Fig. 7b–d). In contrast, we found that succinate dehydrogenase (SDH) activity normalized to cell number, a metric used for indirect measurement of mitochondrial mass and/or mitochondrial biogenesis, was significantly higher in hiPSC-CMs cultured with IgG from Myo+SD+ patients (Fig. 4g). Next, oxygen consumption rate (OCR) was evaluated using the Seahorse extracellular flux assay and normalized to SDH activity to account for the differences in SDH observed across groups. Maximal respiration and spare respiratory capacity were significantly lower in the hiPSC-CMs cultured with Myo+SD+ IgG compared to hiPSC-CMs cultured with IgG from healthy controls and Myo− patients (Fig. 4h). This trend was further observed in respiratory control ratio (RCR) measurements, indicating that Myo+SD+ IgG reduced mitochondrial respiratory efficiency (Fig. 4i). Finally, using the tetramethylrhodamine methyl ester (TMRM) probe to measure mitochondrial membrane potential (Δψm), Myo+SD+ IgG-treated hiPSC-CMs showed a significant reduction in Δψm. In addition, when compared to Δψm after the addition of carbonyl cyanide-p-trifluoromethoxyphenylhydrazone (FCCP) as a positive control that induces Δψm depolarization, a similar trend was observed, although the effect was more pronounced with FCCP (Fig. 4j). All together, these results suggest that Myo+SD+ IgG led to reduced mitochondrial mass, respiration and respiratory efficiency, which was followed by a compensatory biogenesis mechanism as indicated by the increased SDH activity.

Cardiomyocyte metabolic dysfunction has not been previously reported in SLE, but previous studies reported that immune cells in SLE display altered metabolism39. Therefore, we sought to investigate whether the effect of Myo+SD+ IgG on cellular respiration would extend to peripheral blood mononuclear cells (PBMCs). Interestingly, IgGs from all SLE subgroups led to significantly lower PBMC mitochondrial content measured by MitoTracker and significantly lower maximal respiration when compared to PBMCs cultured with IgG from healthy controls (Extended Data Fig. 8a,b). Furthermore, a significant increase in SDH activity and a decrease in mitochondrial membrane potential was observed only in PBMCs cultured with IgG from the Myo+SD− and Myo+SD+ patients when compared to healthy controls (Extended Data Fig. 8c,d). Overall, similar to our findings in hiPSC-CMs, we showed that Myo+SD+ IgG altered mitochondrial content and function in PBMCs; however, in PBMCs, this effect was further extended to IgG from other SLE patient groups.

Myo+SD+ patients exhibit unique autoantibody repertoires

Next, we sought to investigate whether the observed phenotypic and clinical variation between patients was associated with unique autoantibody signatures. We used PhIP-seq, a high-throughput unbiased technique that incorporates phage display of synthetic peptides covering the entire human proteome to characterize autoantibody reactivities at scale40. This method enables profiling of the full repertoire of autoantibody targets in a patient-specific manner, including both intracellular and extracellular human heart proteins. We initially validated PhIP-seq target detection by finding a linear correlation between read counts for Ro52 peptides and clinical measurements of anti-SSA/Ro autoantibodies by ELISA (Extended Data Fig. 9a). PCA of differentially detected antigen targets clearly delineated all patients with SLE from healthy controls with tight clustering among SLE patient subgroups (Fig. 5a). Thirty proteins were uniquely detected by autoantibodies present in the Myo+SD+ patients, 26 of which are expressed in the human heart at varying levels41 (Fig. 5b, Extended Data Fig. 9b and Supplementary Table 4a). Interestingly, numerous antigens that have been reported in the literature to be targets of autoantibodies in the human heart22,23 were identified as reactive with the IgG fractions from patients in the current study (Supplementary Table 4b). IgG from the Myo+ patients, and specifically Myo+SD+ patients, however, did not have significantly different reactivities with these antigens when compared to the other patient subgroups or healthy controls.

Fig. 5: Identification of unique and potentially pathogenic autoantibody populations in Myo+SD+ patient serum.
Fig. 5: Identification of unique and potentially pathogenic autoantibody populations in Myo+SD+ patient serum.The alternative text for this image may have been generated using AI.
Full size image

a, PCA plot of differential antigen targets. b, Venn diagram describing the number of antigen targets in each SLE patient subgroup and their overlap. c, Venn diagrams describing the number of cardiomyocytes and cardiac fibroblast-specific surface proteins and their overlap, representing shared surface proteins. d, Heatmap of potential Myo+SD+ pathogenic autoantibodies targeting cardiac cell surface antigens. e, Linear correlation between patient EF and corresponding read counts of LMO7. P value and r2 were calculated by two-tailed Pearson’s correlation analysis. Ctrl, control; PC, principal component.

Identification of candidate pathogenic autoantibodies

Based on the enhanced Myo+SD+ IgG binding to the cell surface, we sought to identify those specific surface targets. First, we characterized the cell surface proteome (surfaceome) of hiPSC-CMs and primary cardiac fibroblasts by surface biotinylation, immunoprecipitation and LC–MS/MS analysis. After data pre-processing and quality control filtering to omit intracellular proteins, we identified surface proteins unique to cardiomyocytes (n = 27), cardiac fibroblasts (n = 72) and shared by both cell types (n = 143) (Fig. 5c, Extended Data Fig. 9c and Supplementary Table 5). By overlapping the identified surface proteins with the 30 Myo+SD+ IgG-targeted antigens, we identified four candidate pathogenic autoantibodies. These autoantibodies targeted DIP2A, a cardiomyocyte-specific receptor associated with cardioprotection42; LMO7, a cardiac fibroblast-specific multifunctional regulator of protein–protein interactions43,44; and two surface antigens present in both cell types: PVR, associated with cell adhesion42, and PLAUR45, associated with extracellular matrix (ECM) degradation (Fig. 5d). Linear correlation analyses between these autoantibody read counts and EF indicated that autoantibodies to LMO7 had the strongest correlation with EF (r2 = 0.67, P = 0.002; Fig. 5e).

Discussion

We report a human cardiac tissue model to study autoantibody-mediated myocardial injury in SLE. Using hiPSC-CMs, cardiac fibroblasts, engineered human cardiac tissues and patient-specific autoantibody repertoires, we identified two distinct signatures of autoantibody binding patterns that correlated with clinical phenotypes. First, IgG fractions from patients with SLE with elevated myocardial inflammation demonstrated increased binding to stressed cells within tissues subjected to electromechanical stimulation. Second, IgG from patients with SLE with myocardial inflammation and SD (Myo+SD+) exhibited enhanced binding to the surface of live cardiomyocytes. We showed that, by binding to live cardiac cells, IgG exerted potent biological effects independent of complement and immune cell involvement. Overall, these findings indicate that SLE autoantibodies may evoke a range of biological processes that contribute to clinical heterogeneity in cardiac disease manifestations and outcomes.

These experiments expanded upon our previously reported engineered cardiac tissue model28 by using metabolic maturation medium in combination with an electromechanical stimulation regimen. Using hiPSCs derived from a healthy control enabled robustness and scalability but did not account for the diverse genetic backgrounds of patients with SLE, an aspect worthy of further studies. Additionally, true autoreactivity was not demonstrated in this allogeneic model. However, the lack of binding of IgG from healthy controls to the engineered cardiac tissues suggests that the contribution of alloantibodies was minimal.

The intensity training regimen resulted in LDH release and some apoptosis likely due to oxidative stress46. This rendered the stressed tissues immunologically distinct from non-stressed tissues, resulting in increased IgG binding to the surface of apoptotic cells. Conversely, stress did not result in enhanced IgG binding to live cells for IgG from patients with elevated myocardial inflammation, indicating that it did not induce the presentation of newly expressed SLE antigens on their surface. Further studies are required to determine whether the increased IgG binding to the surface of apoptotic cells was due to exposed phospholipid or redistribution of intracellular antigens to the cell surface. Notably, the increased binding to apoptotic cells was consistent with previously reported SLE autoantibody binding patterns in the fetal heart and UV-damaged keratinocytes31,47. The correlation between enhanced autoantibody binding to stressed cardiac cells and elevated levels of myocardial inflammation suggests that such binding may evoke immune cell infiltration and activation that subsequently exacerbates myocardial inflammation. Furthermore, the similarity in patient IgG binding patterns to non-stressed cardiac tissues and healthy human heart samples underscores the advantage of our platform to model cardiac stress in vitro and identify previously unknown associations between cardiac stress and SLE-mediated myocardial inflammation.

The lack of correlation between myocardial inflammation and SD suggests that autoantibody binding may directly influence cardiac tissue function beyond contributing to immune cell-mediated inflammation. Building upon this observation and previous studies reporting that autoantibodies can directly influence cell function in the absence of immune cells22,25, we hypothesized that autoantibodies from patients with SD bind to the surface of cardiac cells and initiate downstream signaling or modulate physiological processes. The collected experimental evidence in this study supports this hypothesis. IgG purified from Myo+SD+ patients demonstrated enhanced binding to the surface of live cardiomyocytes, exerting potent biological effects, including altered cellular composition, respiration and tissue calcium handling and transcriptomics.

Transcriptomic analysis of cardiac tissues cultured with Myo+SD+ IgG indicated downregulation of calcium channels, supporting the observed prolonged calcium transients in those tissues. Impaired calcium handling, cytosolic calcium overload and oxidative stress in the myocardium have all been linked to dysregulation of mitochondrial function, increased mitochondrial biogenesis and the development of clinical SD48,49,50. Consistently, we found that Myo+SD+ IgG altered the expression of genes in cardiomyocytes that are associated with oxidative phosphorylation, and we further confirmed this in cellular assays. hiPSC-CMs cultured with Myo+SD+ IgG exhibited a significant decrease in mitochondrial mass, respiration and, more importantly, respiratory efficiency. Conversely, SDH activity that is classically associated with a compensatory mitochondrial biogenesis in conditions of mitochondrial dysfunction, including primary mitochondrial disorders, was increased. It remains to be established how these autoantibodies affect the different respiratory chain complexes. Importantly, considering the abundant mitochondrial content in cardiomyocytes and the heart’s high metabolic demand, the perturbation in respiration potentially renders the heart more vulnerable to IgG-induced injury compared to other organs and potentially leads to the development of SD.

Moreover, consistent with previous reports in SLE indicating altered immune cell metabolism, we found that IgG from Myo+SD+ patients altered PBMC mitochondrial content, membrane potential and respiration39. These findings suggest a common IgG-induced mitochondrial injury mechanism in both cell populations and indicate that impaired immune cell metabolism may further contribute to the clinical phenotype in patients with SD. Deciphering whether pharmacological interventions to modulate cardiomyocyte and immune cell metabolism would aid in the prevention of SD would be of particular interest.

The enhanced fibroblast proliferation and increased abundance within tissues cultured with Myo+ IgG and, particularly, Myo+SD+ IgG suggests that this cellular response could contribute to collagen deposition and pathological remodeling in the heart and ultimately contribute to the development of SD in (1) neonatal patients with SLE-mediated congenital heart block51 and/or (2) adult patients with SLE. Furthermore, these data indicate that IgG-mediated injury in the heart affects multiple cell types, emphasizing the advantage of the reported tissue model. As the observed fibroblast phenotype was induced by IgG obtained from all Myo+ patients and does not fully explain the development of clinical SD, further studies looking into the effect of autoantibodies on a combined model of cardiac tissues and immune cells may uncover valuable insights into disease pathogenesis.

PhIP-seq is a powerful method for the discovery of autoantibody targets in a patient-specific manner. Despite the highly heterogenous nature of SLE and the wide array of autoantibodies in patients, we found several shared autoantibodies across all Myo+SD+ patients. By combining PhIP-seq and cell surfaceome analyses, we uncovered four new potential pathogenic autoantibodies targeting the surface of cardiomyocytes and cardiac fibroblasts, previously unlinked to autoimmune-mediated heart disease. The cardiomyocyte-enriched IgG target DIP2A is a cell surface receptor for follistatin-like 1 (FSTL1), a protein that increases cardiomyocyte survival and decreases cardiomyocyte apoptosis and hypertrophy42,52,53,54,55,56. Thus, an autoantibody to the FSTL1 receptor may interfere with its cardioprotective role and potentially contribute to the SD in Myo+SD+ patients. The cardiac fibroblast-specific protein LMO7 participates in the regulation of transforming growth factor beta (TGF-β) and fibrotic remodeling57. Autoantibody-mediated inhibition of LMO7 could increase fibroblast activation and proliferation, accounting for our findings in IgG-treated tissues. PLAUR, a urokinase plasminogen activator surface receptor, has established roles in ECM proteolysis, a key process in fibrotic remodeling58, further connecting specific autoantibody targeting with fibrosis. Knockdown of PLAUR also impairs mitochondrial function, promotes immature biogenesis of mitochondria and alters cell metabolism59,60,61, possibly contributing to the observed metabolic dysfunction. Given the biology of SLE, it is likely that these autoantibodies work in concert to induce injury. Further investigation of the mechanisms by which they collectively contribute to SD is required.

Although our patient IgG fractions did include some autoantibodies previously reported to be cardiac disease associated, these autoantibodies were not specifically enriched in any of the patient groups studied here, suggesting that myocardial injury in SLE is mediated by different autoantibodies than in other conditions affecting the heart. Notably, although the PhIP-seq method is limited by its ability to inform on autoantibody cross-reactivity, we used cellular assays to rule out IgG cross-reactivity with β-adrenergic receptors as a possible mechanism of injury in our study. Studies of larger patient cohorts are required to advance autoantibody–phenotype associations. Notably, anti-phospholipid autoantibodies were present in certain patients in the cohort, and it is possible that they led to valve damage that subsequently contributed to myocardial damage. Finally, exploring the effect of whole sera on cardiac tissue phenotype would be valuable to discover additional components that may lead to cardiac damage in SLE.

In conclusion, our study demonstrates the utility of an engineered model of the human myocardium for elucidating the heterogeneity and pathophysiology of autoantibody-mediated myocardial injury in patients with SLE. We envision that this model will improve myocardial risk stratification in SLE, facilitate the identification of new therapeutic targets and be extended to other diseases associated with complex autoantibody-mediated tissue damage.

Methods

Patient cohort

All study participants signed an informed consent form and were not compensated. The study was approved by the Columbia University Institutional Review Board (IRB). Patients were recruited from the Columbia University Lupus Center in two groups: one investigating the presence of myocardial inflammation (defined by 18F-FDG myocardial uptake) in non-hospitalized patients with SLE without active cardiac symptoms and the other investigating hospitalized patients with SLE evaluated with 18F-FDG PET/CT after active cardiac symptoms. Patients were 18 years of age or older and met the 1997 ACR classification criteria for SLE32. Patients with SLE with both myocardial inflammation and SD were included in the study only if review of previous EF measurements revealed an acute decline in EF at the time of enrollment and serum collection. Patients did not undergo endomyocardial biopsies.

Clinical covariates

SLE disease duration was defined as the duration in years from the date of physician diagnosis. SLE disease activity was calculated using the Systemic Lupus Erythematosus Disease Activity Index 2000 (SLEDAI-2K)62. Traditional cardiovascular risk factors, history of lupus nephritis and antiphospholipid antibody syndrome, as well as use of immunosuppressants, were ascertained by patient questionnaire and medical record review.

Laboratory covariates

Autoantibodies, including antinuclear antibodies, anti-SSA/Ro, anti-SSB/La, anti-dsDNA, anti-Smith and antiphospholipid antibodies, and other pertinent laboratory values, such as complement levels (C3 and C4), erythrocyte sedimentation rate (ESR) and high-sensitivity C-reactive protein, troponin and pro-beta-natriuretic peptide (pro-BNP) levels, were assessed at the clinical laboratory at New York Presbyterian Hospital and the Core Laboratory of the Columbia University Irving Institute for Clinical and Translation Research.

18F-FDG PET/CT

Myocardial uptake imaging was performed on an MCT 64 PET/CT scanner (Siemens Medical Solutions). A low-dose CT transmission scan (120 kV, 25 mA) was obtained for attenuation correction of PET data. All patients were on a carbohydrate-free diet for 24 h. Patients were injected with 10 ± 0.1 mCi of 18F-FDG intravenously using an antecubital or dorsal forearm catheter. A list mode three-dimensional PET scan was acquired for 10 min after a 90-min uptake period after 18F-FDG injection. Non-gated attenuation-corrected images were reconstructed yielding 3-mm effective resolution. Corridor 4DM software was used to visually assess myocardial 18F-FDG uptake and to semi-automatically quantify mean radiotracer uptake in the myocardium. Quantification of inflammation by 18F-FDG PET/CT involved measurement of SUV in the myocardium. SUV was determined for 17 myocardial segments, and the maximum of these values was determined as SUVmax. SUVmax > 1.5 was the threshold used to define the presence of myocardial inflammation. Uptake of myocardial 18F-FDG was not quantified in three patients within the cohort; instead, the presence of myocardial inflammation was assessed qualitatively by a nuclear cardiologist and determined to be either positive or negative.

Isolation of patient IgG fractions

Samples of serum were collected from patients at the time of 18F-FDG PET/CT scans and stored at −80 °C until IgG purification. The IgG antibody fractions were isolated from patient sera by affinity purification with immobilized protein A/G using a NAb Protein A/G Spin Kit (Thermo Fisher Scientific, 89950) according to the manufacturer’s protocol. Next, Zeba spin desalting columns (Thermo Fisher Scientific, 87766) were used to further purify IgG from contaminates. Notably, IgG purification from the patients’ sera was performed to eliminate confounding effects of sera components, such as cytokines, growth factors and drugs. Purified IgG fractions were stored at −80 °C until experimental use.

hiPSC sourcing

The experiments were performed using the WTC11-GCaMP6f hiPSC line, obtained through an institutional material transfer agreement with the Gladstone Institutes in San Francisco, California (Bruce Conklin)63. The line contains a constitutively expressed GCaMP6f calcium-responsive fluorescent protein64 inserted into a single allele of the AAVS1 safe harbor locus, which enables real-time and label-free visualization of calcium handling. The parental hiPSC line WTC11 (GM25256 at the Coriell Institute) was generated from a healthy donor with no history of cardiovascular or autoimmune diseases65.

hiPSC culture

hiPSCs were cultured in mTeSR Plus medium (STEMCELL Technologies, 100-0276) on tissue culture plates coated with Matrigel (Corning, 354230; diluted 1:100 in RPMI 1640 medium) and passaged every 3–4 d with 0.5 mM EDTA (Thermo Fisher Scientific, 15575). For the first 24 h after passaging, 5 μM Y-27632 dihydrochloride (Tocris Bioscience, 1254), a rho-associated protein kinase (ROCK) inhibitor, was added to the culture medium. hiPSCs were karyotyped and regularly tested for mycoplasma contamination.

Cardiomyocyte differentiation from hiPSCs

Cardiomyocytes were differentiated as previously described66. In brief, hiPSCs were plated at a density of 155,000 cells per cm2 2 d before the start of differentiation. Culture medium was replaced with cardiomyocyte differentiation medium (CDM), consisting of RPMI 1640 medium (Thermo Fisher Scientific, A4192302), 500 μg ml−1 recombinant human albumin (Sigma-Aldrich, A9731) and 213 μg ml−1 L-ascorbic acid 2-phosphate (Sigma-Aldrich, A8960). From day 0 to day 2, CDM was supplemented with 4 μM CHIR99021 (Tocris Bioscience, 4423), and, from day 2 to day 4, CDM was supplemented with 2 μM Wnt-C59 (Tocris Bioscience, 5148). After this, CDM was changed every 2 days. On day 10, CDM was replaced with purification medium, consisting of RPMI 1640 without glucose (Thermo Fisher Scientific, 11879020), B27 Supplement (Thermo Fisher Scientific, 17504044, 1×) and 213 μg ml−1 L-ascorbic acid 2-phosphate, to purify the hiPSC-CM population and eliminate potential contaminating cell populations. On day 13, the medium was replaced with RPMI-B27 medium, consisting of RPMI 1640 medium, B27 Supplement 1× and 213 μg ml−1 L-ascorbic acid 2-phosphate. On day 17, cells were pre-treated with 5 μM Y-27632 dihydrochloride for 4 hours to prepare for dissociation. Cells were dissociated by enzyme digestion with 95 U ml−1 collagenase type II (Worthington, LS004176) and 0.6 mg ml−1 pancreatin (Sigma-Aldrich, P7545) in a dissociation buffer consisting of 5.5 mM glucose, 1.8 mM CaCl2, 5.4 mM KCl, 0.81 mM MgSO4, 100 mM NaCl, 44 mM NaHCO3 and 0.9 mM NaH2PO4. Cells were incubated at 37 °C on a shaker for approximately 30 min. Flow cytometry for cardiac troponin T (cTnT; BD Biosciences, 565744) was performed before cell use for tissue fabrication to ensure cell purity (>90% cTnT+).

Cardiac fibroblasts

Primary human ventricular cardiac fibroblasts (NHCF-V; Lonza, CC-2904) were cultured according to the manufacturer’s protocol with Fibroblast Growth Medium 3 (PromoCell, C-23130). Fibroblasts were used between passage 3 and passage 5. Cells were generated from healthy donors with no history of autoimmune or cardiovascular disease.

PBMCs

Human PBMCs (STEMCELL Technologies, 70025.2) were cultured in RPMI 1640 with 10% heat-inactivated FBS according to the manufacturer’s protocol.

Human LV tissue samples

De-identified human LV tissue samples were obtained from the Columbia University Biobank for Translational Studies under IRB protocol number AAAR6796.

milliPillar platform fabrication

The platform, termed milliPillar, was assembled as previously described28. In brief, the platform was fabricated by casting polydimethylsiloxane (PDMS; Dow Chemical Company, 02065622; 1:10 curing agent-to-elastomer ratio) into custom molds containing carbon electrodes and curing overnight at 65 °C. The platform was then detached from the mold and plasma bonded to a glass slide. After completion, each well contained a set of horizontal flexible pillars upon which fibrin hydrogel containing cells can be suspended, as described below. Each well also contained a set of carbon electrodes for electrical field stimulation. A custom microcontroller-based electrical stimulator was used for electrical pacing during culture and video acquisition, as previously described28.

Human engineered cardiac tissues

Engineered cardiac tissues were fabricated as previously described28. In brief, dissociated hiPSC-CMs and primary cardiac fibroblasts were mixed in a 3:1 ratio and resuspended in fibrinogen by mixing the cell solution with 33 mg ml−1 human fibrinogen (Sigma-Aldrich, F3879) and RPMI-B27 (described above) to a final fibrinogen concentration of 5 mg ml−1 and cell concentration of 37,000 cells per microliter. A 3-μl drop of 2.5 U ml−1 human thrombin (Sigma-Aldrich, T6884) was added to each platform well, followed by addition of 12 μl of the cell–fibrinogen solution. The two solutions were mixed, spread evenly across the well and incubated at 37 °C for 15 min, allowing the fibrin hydrogel to polymerize within the well. After polymerization, each well was filled with 400 µl of RPMI-B27 supplemented with 10 µM Y-27632 and 5 mg ml−1 6-aminocaproic acid (Sigma-Aldrich, A7824). On day 1, RPMI-B27 medium was replaced without Y-27632.

Optimization of engineered cardiac tissue culture medium

On day 2, platforms were randomized into two different culture medium groups: RPMI-B27 and a previously reported metabolic MM34. Medium also contained 6-aminocaproic acid and was changed every other day. On day 6, 6-aminocaproic acid was removed from the culture medium. On day 7, electrical stimulation was initiated at a frequency of 2 Hz until day 14. Tissue functionality was assessed by calcium and bright-field imaging on day 14. Force generation, contraction and relaxation velocities and calcium transient amplitude and kinetics were measured (Extended Data Fig. 4). Tissues cultured in MM displayed enhanced structural and functional properties; therefore, MM was chosen as the culture medium for subsequent experiments with patient IgG.

Engineered cardiac tissue incubation with autoantibodies

Engineered cardiac tissues cultured in MM were fabricated as described above, and, at day 7, a 14 day gradually increasing electromechanical stimulation regimen (2 Hz to 6 Hz, ‘intensity training’) was initiated. Patient-specific serum purified IgG was added 7 d after the initiation of the electromechanical stimulation regimen when frequency reached 4 Hz and was maintained for an additional 14 days. To ensure that the functional effect on cardiac tissue performance is not associated to titer levels and only to distinct autoantibody patterns, the same concentration of purified patient autoantibodies, 0.5 μg ml−1, was added to all tissues. To assess the effect of purified IgG on cardiac tissue functionality, we evaluated the tissue contractility and calcium handling (the full list of metrics and their descriptions is provided in Extended Data Fig. 4) at baseline (day 14) and after the addition of IgG, on days 21 and 28. To reduce noise from tissue-to-tissue variability, measurements were normalized to the baseline.

Indirect immunostaining to visualize IgG targets

Cardiac tissues and hiPSC-CMs cultured with patient IgG were fixed in 4% paraformaldehyde, blocked for 1 hour at room temperature in PBS with 2% FBS and subsequently incubated with secondary anti-human IgG (1:500, Thermo Fisher Scientific, A21090, or Sigma Aldrich, SAB4600181). This method enabled visualization of cellular antigens accessible to autoantibodies only in live tissues or cells. Samples were visualized using a scanning laser confocal microscope (A1 confocal system with Eclipse Ti inverted microscope, Nikon Instruments). Binding intensity was measured by image analysis in ImageJ. IgG binding levels were quantified as MFI.

Immunostaining

Whole-mount engineered cardiac tissues and cells were fixed and permeabilized in 100% ice-cold methanol for 10 min, washed three times in PBS and then blocked for 1 hour at room temperature in PBS with 2% FBS. After blocking, the tissues were incubated with primary mouse anti-α-actinin (sarcomeric) antibody (1:750, Sigma-Aldrich, A7811) and vimentin (1:2,500, Abcam, ab24525), washed three times and incubated for 1 hour with secondary antibodies (Thermo Fisher Scientific, A-11039, A11041, A31571 and A11030). For nuclei detection, the tissues were washed and incubated with NucBlue (Thermo Fisher, Scientific, R37606). Whole tissues were placed in incubation chambers (Grace Bio-Labs, 645501) and mounted with ProLong Diamond antifade mountant (Invitrogen, 36961). Tissues were visualized using a scanning laser confocal microscope (A1 confocal system with Eclipse Ti inverted microscope, Nikon Instruments).

Flow cytometry to assess autoantibody binding

hiPSC-CMs were differentiated and dissociated as described above. Individual patient IgG samples were diluted 1:500 in cell staining buffer (BioLegend, 420201) and incubated with hiPSC-CMs for 1 hour at room temperature, followed by incubation with CF-647 conjugated anti-human IgG (Sigma-Aldrich, SAB4600181) diluted 1:500 in cell staining buffer for 30 min at room temperature. hiPSC-CMs were then stained with Apotracker Green (BioLegend, 427401) and propidium iodide (Thermo Fisher Scientific, R37169) according to the manufacturers’ protocols. Flow cytometry was conducted with a ZE5 Cell Analyzer (Bio-Rad) to identify live cardiomyocytes and quantify IgG binding. FlowJo software (BD Biosciences) was used for analysis. Live cardiomyocytes were defined as those with negative staining for propidium iodide, a marker of dead cells, and Apotracker Green, a marker of apoptotic cells. An example of the gating strategy is provided in Extended Data Fig. 3b. IgG binding levels were quantified as median fluorescent intensity for all cells within the viable cardiomyocyte population.

Fibroblast imaging assays

Cardiac fibroblasts were cultured with patient IgG for 72 hours and immunostained as previously described in the Methods section to evaluate the number of Ki67-positive cells. Primary antibody against Ki-67 was used (1:100, Abcam, ab15580). Primary cells were stained with DAPI and then imaged with a high-throughput imaging system (BioTek Cytation 5, Agilent). Image fields with more than 200 or fewer than 95 cells were excluded from analysis.

Calcium imaging and analysis

To decrease tissue-to-tissue variability, all metrics were measured as percent change from baseline. Tissues were imaged in a live-cell chamber (STX Temp & CO2 Stage Top Incubator, Tokai Hit) using a sCMOS camera (Zyla 4.2, Andor Technology) connected to an inverted fluorescence microscope with a standard GFP filter set (IX-81, Olympus). Tissues were then electrically stimulated at 1 Hz, and videos were acquired at 100 frames per second (fps) for 300 frames to measure calcium transients. Calcium signals were analyzed using a previously published script28. In brief, the script was developed to average the pixel intensities for each frame, and this transient was then corrected for fluorescent decay. Further analysis by the script then extracted the metrics of calcium handling, including calcium amplitude, FWHM, contract 50 and the exponential decay constant (τ). A description of these metrics is provided in Extended Data Fig. 4.

MitoTracker Green assay

hiPSC-CMs were dissociated after differentiation and replated in Matrigel-coated 96-well plates at 200,000 cells per cm2. After 2 weeks in culture in MM, cells were cultured with patient IgG (0.5 μg ml−1) for 1 week and then assayed. For PBMC analysis, cells were thawed and cultured with patient IgG (0.5 μg ml−1) for 1 week and then assayed. Cells were stained with MitoTracker Green (Thermo Fisher Scientific, M46750) according to the manufacturer’s protocol, and fluorescence was measured using a ZE5 Cell Analyzer (Bio-Rad). MitoTracker Green was quantified as median fluorescence intensity.

Measurement of mitochondrial membrane potential

hiPSC-CMs were dissociated after differentiation and replated in Matrigel-coated 96-well plates at 200,000 cells per cm2. After 2 weeks in culture in MM, cells were cultured with patient IgG (0.5 μg ml−1) for 1 week and then assayed. For PBMC analysis, cells were thawed and cultured with patient IgG (0.5 μg ml−1) for 1 week and then assayed. Cells were incubated with 20 nM TMRM in culture medium for 30 min at 37 °C and then washed two times with PBS. For hiPSC-CMs, fluorescence was measured using a plate reader (BioTek Synergy, Agilent) with excitation and emission filters for 530 nm and 590 nm, respectively. For PBMCs, fluorescence was measured with a ZE5 Cell Analyzer (Bio-Rad). For a positive control, cells were then treated with 10 μM FCCP for 5 min, and then fluorescence was measured again.

Metabolic analysis

An extracellular flux analyzer (Seahorse XF96, Agilent) was used with the Seahorse XF Cell Mito Stress Test assay (Agilent, 103015-100) to evaluate mitochondrial function. One week before the hiPSC-CM assay, 33,000 cardiomyocytes (GCAMP) were plated onto a Matrigel-coated Seahorse XFe96 Pro cell culture microplate (Agilent, 103794-100) in B27 + 10 µM ROCK inhibitor and, the next day, changed to MM with patient-specific IgG and then cultured for 1 week. Media were changed every other day until the day of the assay. For PBMC analysis, PBMCs were cultured for 1 week in RPMI 1640 with 1% penicillin–streptomycin, 10% heat-inactivated FBS and patient IgG. On the day of the assay, PBMCs were transferred to a Seahorse XFe96 Pro cell culture microplate coated with 0.1 mg ml−1 poly-d-lysine plate and briefly centrifuged to adhere cells to the surface of each well. For both studies, 1 h before the assay, the culture medium was exchanged to assay medium (XF RPMI Medium, pH 7.4, supplemented with 1 mM pyruvate, 2 mM glutamine and 10 mM glucose), and the culture plate was placed in a non-CO2 incubator. During the Mito Stress Test, electron transport chain modulators oligomycin (1.5 µM), FCCP (0.5 µM) and rotenone and antimycin A (0.5 µM) were injected serially into each well. The key parameters of mitochondrial function determined by the Mito Stress Test, including basal respiration, ATP-linked respiration, proton leak, maximal respiration, spare capacity and non-mitochondrial oxygen consumption, were generated using the Seahorse XF Mito Stress Test Report Generator. After Seahorse assay, cells were stained with NucBlue live ready probes (Invitrogen, R37605) and imaged with an inverted fluorescence microscope with a standard GFP filter set (IX-81, Olympus) as well as in bright-field. Cell number was quantified using FIJI. After Seahorse assay, an SDH activity assay (Abcam, ab228560) was performed according to the manufacturer’s protocol.

Contractile function

For force generation measurements, videos were acquired at 20 fps for 4,800 frames using a custom program to stimulate cardiac tissues from 0.5 Hz to 4 Hz as previously described, and force generation was analyzed from bright-field videos as previously described28. In brief, a custom Python script was developed to track the motion of the pillar heads and to calculate the force by multiplying the displacement of the pillars with the coefficient determined from the force-displacement calibration curve generated for the pillars. The script used the location of the pillar heads to determine the total deflection of the pillar from their equilibrium position without any force applied. Further analysis of the deflection trace extracted metrics of contractility, including the following: force, passive force, active force, contraction velocity and relaxation velocity. A description of these metrics is provided in Extended Data Fig. 4. To decrease tissue-to-tissue variability, all metrics were measured as percent change from baseline.

Analysis of tissue function

After feature extraction, tissues that did not capture at 1-Hz stimulation based on both calcium and contractility analysis at baseline were removed from further analysis. The data were then processed to remove outliers greater than or less than ±1.5× the interquartile range for each group. Outliers were removed from each metric independently. The metrics for each tissue were internally normalized to baseline values and presented as percent change from baseline.

RNA isolation

Tissues were snap frozen in liquid nitrogen and stored at −80 °C until use. To isolate RNA, snap-frozen tissues were added to 300 μl of RNA lysis buffer with a stainless steel bead (BioSpec, 11079123) and homogenized with a Mini-BeadBeater (BioSpec, C321001) for 5–10 s or until tissue samples were not visible. RNA was then isolated using a Qiagen RNeasy Micro Kit (Qiagen, 74004) according to the manufacturer’s instructions. RNA for each sample was then analyzed for quality/quantity using an Agilent Bioanalyzer, Qubit 2.0, at Columbia’s Molecular Pathology Core.

RNA-seq

The SMART-Seq version 4 Ultra Low Input RNA Kit for Sequencing (TaKaRa) was used for cDNA amplification according to the manufacturer’s instructions. The sequencing library was prepared using the Nextera XT DNA Library Preparation Kit (Illumina) with 100–150 pg of starting material and according to the manufacturer’s instructions. Libraries were sequenced to a targeted depth of approximately 40 M 100-bp paired-end reads on a NovaSeq 6000. RTA (Illumina) was used for base calling and bcl2fastq2 (version 2.19) for converting BCL to FASTQ format, coupled with adaptor trimming.

RNA-seq analysis

RNA-seq reads were quantified with Kallisto67, using the Ensembl v96 Human:GRCh38.p12 transcriptome as a reference. Data were deposited in the Gene Expression Omnibus (GSE227571). Multidimensional scaling68, PCA69 and hierarchical clustering70 were used to check for outliers. Samples were normalized by the Trimmed Mean Method71. Differential expression was analyzed with limma-voom with sample weighting72,73,74 and duplicate correlation75, which models the effect of three tissue samples per patient IgG sample. Differential expression results were analyzed with KEGG76 and GO Biological Process77, using a significance cutoff of P < 0.001 and |log2fold change| > 0.6. iPathwayGuide78 was used to perform the KEGG analysis, using the Signal Interaction Pathway (SIP) analysis79,80 method, as well as GO analysis, using the high-specificity pruning method, which is based on the elim method81. CIBERSORTx was used to infer hiPSC-CM-specific gene expression profiles from bulk RNA-seq and provide an estimation of the cellular fraction of cardiomyocytes and cardiac fibroblasts within the tissues35.

Surface protein analysis

Human primary cardiac fibroblasts were seeded in 10-cm dishes, and hiPSC-CMs were plated in six-well plates. Two wells were used per pulldown reaction. A Pierce Cell Surface Biotinylation and Isolation Kit (Thermo Fisher Scientific, A44390) was used per the manufacturer’s protocol to biotinylate and pull down cell surface proteins with minor alterations. Before biotinylation, cells were washed four times with PBS. Biotinylation reaction was conducted for 30 min at room temperature, after which the cells were washed four times with PBS and lysed on the plate in the provided lysis buffer with 1× Halt Protease and Phosphatase Inhibitor Cocktail (Thermo Fisher Scientific, 78442). Protein concentrations were determined with a BCA assay. An equivalent amount of 1,000 µg of protein was used per pulldown reaction, and cell lysate was incubated with streptavidin beads for 2 h at room temperature. The surface proteins were eluted in 40 μl of custom elution buffer (12.5 mM biotin, 7.5 mM HEPES (pH 7.5), 75 mM NaCl, 1.5 mM EDTA, 0.15% (w/v) SDS, 0.075% (w/v) sarkosyl and 0.02% (w/v) Na-deoxycholate) at room temperature for 30 min and an addition of 40 μl of custom elution buffer at 65 °C for 20 min. Subsequently, 30 μl was used for western blot confirmation, and the remaining 50 μl was analyzed with mass spectrometry.

Global surface protein quantitative analysis

For global surface protein quantitative analysis of cardiac fibroblasts and cardiomyocytes, the diaPASEF-based method was used82. In brief, the eluted proteins from streptavidin beads were denatured in SDC buffer (1% SDC, 100 mM Tris-HCl, pH 8.5) and boiled for 20 min at 60 °C and 1,000 r.p.m. Protein reduction and alkylation of cysteines were performed with 10 mM TCEP and 40 mM CAA at 45 °C for 20 min, followed by sonication in a water bath and cooled down to room temperature. Proteins were precipitated with the SP3 method, as previously described83, and SP3 beads were resuspended in SDC buffer (1% SDC/100 mM Tris, pH 8.5). Protein digestion was processed overnight by adding LysC:trypsin mix in a 1:50 ratio (µg of enzyme to µg of protein) at 37 °C and 1,400 r.p.m. Peptides were acidified by adding 1% TFA, vortexed, subjected to StageTip cleanup via SDB-RPS2 and dried in a speed-vac. Peptides were resuspended in 10 μl of LC buffer (3% acetonitrile (ACN)/0.1% formic acid (FA)). Peptide concentrations were determined using NanoDrop, and 200 ng of each sample was used for diaPASEF analysis on a timsTOF Pro.

LC–MS/MS for surface protein characterization

Peptides were separated within 87 min at a flow rate of 400 nl min−1 on a reversed-phase C18 column with an integrated CaptiveSpray emitter (25 cm × 75 μm, 1.6 μm, IonOpticks). Mobile phases A and B were with 0.1% FA in water and 0.1% FA in ACN. The fraction of B was linearly increased from 2% to 23% within 70 min, followed by an increase to 35% within 10 min and a further increase to 80% before re-equilibration. The timsTOF Pro was operated in diaPASEF mode, and data were acquired at defined 22 × 50 Th isolation windows from m/z 440 to 1,440. Two IM windows per diaPASEF scan were set. The collision energy was ramped linearly as a function of the mobility from 59 eV at 1/K0 = 1.6 Vs/cm2 to 20 eV at 1/K0 = 0.6 Vs/cm2. The acquired diaPASEF raw files were searched with the UniProt Human proteome database (UP000005640) in the DIA-NN search engine with default settings of the library-free search algorithm84. DIA-NN performed the search trypsin digestion with up to two missed cleavages. The following modifications were used for protein identification and quantification: carbamidomethylation of cysteine residues (+57.021 Da) was set as static modifications, and acetylation of the protein N-terminus (+42.010) and oxidation of methionine residues (+15.995 Da) was set as a variable modification. The FDR was set to 1% at the peptide precursor and protein level. Results obtained from DIA-NN were further analyzed using Perseus software85. Significantly changed protein candidates were determined by t-test with a threshold for significance of P < 0.05 (permutation-based FDR correction) and 0.58 log2fold change. Because isolation procedures may yield some contaminating cells with compromised plasma membranes, a further validation step of the significant proteins was performed, and data were compared to three subcellular localization data sources—Human Protein Atlas86, Jensen Lab Compartment Repository87 and CellSurfer88—for further quality control (Extended Data Fig. 7a).

PhIP-seq analysis

PhIP-seq analysis and sequencing were performed according to previous publications40,89, with a few modifications. Sera containing approximately 100 µg of IgG (quantified using a Human IgG ELISA Quantification Set, Bethyl Laboratories) were added to each well, in duplicate, combined with 1 ml of Human PhIP-seq library40 diluted to approximately 2 × 105 fold representation in phage extraction buffer (20 mM Tris-HCl, pH 8.0, 100 mM NaCl, 6 mM MgSO4). After incubation, phages were pulled down using anti-FLAG magnetic beads. IgGs that did not bind to phages were discarded, and, after washing and releasing of complex phage IgG from beads, IgGs bound to phages were pulled down using anti-protein A and protein G magnetic beads. Phage DNA was extracted by incubation at 95 °C for 10 min.

The DNA for multiplexed Illumina sequencing was prepared after two rounds of amplification using Q5 Hot Star Polymerase (New England Biolabs). For the first round of polymerase chain reaction (PCR), we used the primers IS7 (ACACTCTTTCCCTACACGACTCCAGTCAGGTGTGATGCTC) and IS8 (GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCCGAGCTTATCGTCGTCATCC), and, for the second round, we used primer IS4 (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACTCCAGT) and a different unique indexing primer for each sample to be multiplexed for sequencing. Equimolar amounts of all samples were pooled, gel purified and sequenced by the Harvard Medical School Biopolymers Facility using a 50-bp read cycle on an Illumina NextSeq.

PhIP-Seq data analysis

Read counts were normalized by z-score, and a t-test was applied to compare each pair of groups (SLE versus Control, Myo− versus Myo+SD−, Myo− versus Myo+SD+ and Myo+SD- versus Myo+SD+). To compare more than two pairs, one-way ANOVA test was applied. Peptides for which the comparison resulted in a P value lower than 0.05 were considered different for following analyses.

Statistical analysis and reproducibility

Statistical analyses were performed with GraphPad Prism 10.0 using unpaired two-tailed Student’s t-test or Mann–Whitney U-test. Longitudinal comparison between different groups was performed by one-way or two-way ANOVA with Tukey’s post test or with ordinary one-way ANOVA with Dunnett’s test for multiple comparisons. For cardiac tissue functional analysis, individual beats with parameters outside of 1.5× the interquartile range were excluded as outliers. For other assays, Tukey’s test for outlier exclusion was used with GraphPad Prism 10.0. For representative immunofluorescence images presented in the manuscript, a minimum of three biological replicates (individual experiments) and three technical replicates (images) were used to select a reproducible and representative image.

Reporting Summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.