Development and characterization of an inducible Tensin1 deficient transgenic murine model

Bernau, Ksenija; Holbert, Kelsey; McDermott, Ivy S.; Rahar, Babita; Coulter, Kade W.; Osterhaus, Madalyn A.; Harr, Thomas J.; Gehl, Carson; Oler, Angie Tebon; Huffman, Christopher; Gray, Beth; Langel, Trevor S.; Chan, Kenneth M.; Forati, Amir; BonDurant, Sandra Splinter; Berres, Mark E.; Krentz, Kathy J.; Rubinstein, C. Dustin; Mejia, Andres F.; Sandbo, Nathan

doi:10.1038/s41598-026-41319-3

Download PDF

Article
Open access
Published: 28 February 2026

Development and characterization of an inducible Tensin1 deficient transgenic murine model

Ksenija Bernau¹^na1,
Kelsey Holbert¹^na1^nAff5,
Ivy S. McDermott¹,
Babita Rahar¹,
Kade W. Coulter¹,
Madalyn A. Osterhaus¹,
Thomas J. Harr¹,
Carson Gehl¹,
Angie Tebon Oler¹,
Christopher Huffman²,
Beth Gray²,
Trevor S. Langel¹,
Kenneth M. Chan¹,
Amir Forati³,
Sandra Splinter BonDurant⁴,
Mark E. Berres⁴,
Kathy J. Krentz⁴,
C. Dustin Rubinstein⁴,
Andres F. Mejia² &
…
Nathan Sandbo¹

Scientific Reports volume 16, Article number: 8639 (2026) Cite this article

1429 Accesses
1 Altmetric
Metrics details

Subjects

Abstract

Tensin1 (TNS1) is a key component of focal and fibrillar adhesions, mediating fibrillogenesis, as well as the transduction of mechanical cues and adhesive signaling. To enable further TNS1 characterization, we have developed a novel transgenic mouse that allows for temporally controlled and lineage specific knockout of TNS1. We found no differentially observed effects of TNS1 knockout on mouse health, breeding capacity, or vital organ histopathology. In contrast, RNA sequencing analysis identified 171 differentially expressed genes with Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis demonstrating differential expression in osteoclast differentiation and a number of pathways involved in host immune response. Furthermore, STRING pathway analysis showed differential regulation of genes involved in B-cell and myeloid-related signaling pathways, a number of which were validated by reverse transcription-quantitative polymerase chain reaction (RT qPCR). Loss of TNS1 in THP-1 monocyte/macrophage cell line resulted in impaired migration and phagocytosis. We also observed a trend toward increased detection of lymphocytes in the bronchoalveolar lavage within days following TNS1 knockout. This study provides a novel understanding of the phenotypic and genotypic changes that occur following knockout of TNS1 that may lead to subsequent understanding of its role in disease.

Personalized health risk assessment based on single-cell RNA sequencing analysis of a male with 45, X/48, XYYY karyotype

Article Open access 02 December 2022

Transfection of hypoxia-inducible factor-1α mRNA upregulates the expression of genes encoding angiogenic growth factors

Article Open access 20 March 2024

Systemic inflammation, oxidative damage and neurocognition predict telomere length in a transdiagnostic sample stratified by global DNA methylation levels

Article Open access 07 June 2024

Introduction

Tensin 1 (TNS1) is a 220 kDa multidomain protein that is a component of focal and fibrillar adhesive structures of the cell. TNS1 links the actin cytoskeleton with the cytoplasmic tail of the extracellular matrix (ECM)-binding integrins and serves as a scaffold for adhesion-related signaling via several protein domains, including a phosphotyrosine-binding (PTB) domain, Src homology 2 (SH2) domain, and protein tyrosine phosphatase (PTP) domain¹. TNS1 is a key component of the specialized fibrillar adhesions that bind fibronectin and, via actomyosin-mediated translocation, facilitates fibronectin fibrillogenesis^2,3. In addition to playing a key role in mediating fibronectin fibrillogenesis, TNS1 binds to several adhesion-related kinases, enabling transduction of adhesive signaling⁴. Finally, given its localization to mature and enlarging focal adhesions, TNS1 is also involved in mechanotransduction in response to biophysical matrix cues, such as matrix viscoelasticity⁵. Several studies have found that Tns1 expression or single-nucleotide polymorphisms (SNPs) within the Tns1 gene locus are associated with a number of diseases, including cancers, obstructive lung disease, and lung function decline^6,7,8,9. We have previously shown that TNS1 plays a key role in myofibroblast differentiation and upregulation of fibronectin assembly¹⁰. However, germline deletion of TNS1 results in degenerative cystic kidney disease associated with hyperproliferative Madin-Darby canine kidney (MDCK) cells, while no obvious pathologic alterations in other organ systems were detected^11,12.

Due to the putative role of TNS1 in modifying adhesive signals and fibronectin fibrillogenesis, we sought to develop a transgenic mouse that enabled temporally controlled knockout of TNS1, thereby potentially avoiding the deleterious consequences of germline deletion on renal function. In this study, we describe the development of a novel transgenic mouse and characterize the gene expression changes that occur under global loss of TNS1 in adult mice. Through this work, we have unexpectedly identified differentially expressed genes involved in immune cell signaling by RNA sequencing analysis, which may indicate a role for TNS1 in immune cell function.

Results

Development of conditional and temporally controlled TNS1-null mouse

Previous studies utilizing a murine model with constitutive deletion of amino acids 110–180 of TNS1 in mice showed the presence of progressive cystic kidney disease and loss of focal adhesive structures in the proximal tubule, along with small litter sizes¹¹. To enable temporal control of TNS1 deletion and avoid the health-related issues of germline knockout, we set out to generate a novel, conditional TNS1 knockout mouse model. To accomplish this, we utilized the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) approach, enabling Cre-Lox recombination-mediated knockout of TNS1.

We created B6.Tns1^{lox, lox} mice by floxing exon 8 of Tns1 (ENSMUST00000169786.8), as it is the most 5’ exon present in all full-length Tns1 isoforms and its loss results in a frameshift (Fig. 1A, B, Supplementary Fig. S1), thereby disrupting the reading frame and eliminating protein translation. To enable whole-mouse conditional and temporally controlled TNS1 knockout, we bred the B6.Tns1^{lox, lox} mouse line to the tamoxifen-inducible ubiquitous Cre-reporter strain (B6.129-Gt(ROSA)26Sor^{tm1(cre/ERT2)Tyj/J}, Jackson Laboratories)¹³. The resulting mouse colony was termed Rosa^Cre/+;Tns1^lox/lox. Mice that were either homozygous negative for the Rosa driven Cre alleles (B6.Tns1^lox/lox) or did not carry floxed Tns1 (Rosa^Cre/+;Tns1^+/+) served as negative controls. In subsequent experiments, when Rosa^Cre/+;Tns1^lox/lox mice are treated with tamoxifen to induce TNS1 recombination, they are referred to as Tns1-/-. Tamoxifen-treated B6.Tns1^lox/lox and tamoxifen treated Rosa^Cre/+;Tns1^+/+ mice served as controls and are referred to as Tns1+/+ in our experiments.

As seen in Fig. 1C and Supplementary Fig. 2, the single 1516 bp PCR band from the genomic DNA indicates the intact floxed 8th exon in the tail samples of tamoxifen-treated B6.Tns1^lox/lox (Tns1+/+). In contrast, DNA samples from the tails of tamoxifen-treated Rosa^Cre/+;Tns1^lox/lox mouse line (Tns1-/-) showed the 648 bp PCR band indicating successful recombination and loss of exon eight in the newly generated transgenic mouse colony. We found that this recombination continued to be evident up to 12 months post-tamoxifen treatment (Supplementary Fig. S1). Whole lung mRNA analysis revealed a 95% loss of Tns1 mRNA expression in these mice (Fig. 1D). Importantly, we did not find substantial changes in mRNA expression of Tns2 and Tns3 (Fig. 1E, F), demonstrating specificity of Tns1 targeting. Furthermore, we detected a dramatic reduction in TNS1 protein expression in the lungs of Tns1-/- mice compared to Tns1+/+ controls (Fig. 1G, H and Supplementary Fig. S2). Taken together, we show that our novel transgenic Tns1-/- mouse line results in recombination of loxP sites under control of tamoxifen-inducible Cre-recombinase, allowing for successful disruption of transcription and subsequent protein expression of TNS1.

Rosa^Cre/+;Tns1^lox/lox mice have normal litter sizes and appear healthy

Constitutive knockout of TNS1 has previously resulted in small litter sizes¹¹. Since we seek to knockout TNS1 in adult mice, we analyzed pup count and health in TNS1-expressing Rosa^Cre/+;Tns1^lox/lox mice prior to tamoxifen treatment. We demonstrate no difference in the number of litters per mating pair nor the number of pups per litter between Rosa^Cre/+;Tns1^lox/lox and control mouse colonies, C57Bl/6J or B6.Tns1^lox/lox (Fig. 2A, B), suggesting that the genetically modified lines did not have abnormal fertility, fecundity, or pup survival.

Next, we sought to investigate the broad phenotypic consequences resulting from the global knockout of TNS1, given its importance in focal and fibrillar adhesion formation and the previously identified effect on kidney morphology and function¹¹. To induce global TNS1 knockout, we treated adult mice with intraperitoneal (IP) tamoxifen injections for seven consecutive days. We monitored mouse body weights daily starting at the point of tamoxifen administration until the endpoint three weeks later. We detected up to 10% weight-loss in both Tns1+/+ and the Tns1-/- groups (Fig. 2C), likely resulting from tamoxifen-administration and consistent with prior studies¹⁴. However, we found no change between the overall weights of the tamoxifen-treated Rosa^Cre/+;Tns1^lox/lox mice and controls, indicating that disruption of TNS1 expression did not have an impact on overall mouse weights (Fig. 2C).

We then analyzed potential pathologic changes resulting from disruption of TNS1 expression. For this, we treated 12–14-week-old Rosa^Cre/+;Tns1^lox/lox mice with tamoxifen for seven days to induce knockout of TNS1 (Tns1-/-), while tamoxifen-treated B6.Tns1^{lox, lox} (Tns1+/+ Tamoxifen) served as controls. As an additional control for tamoxifen-induced effects, we included tissue samples from one mouse not treated with tamoxifen (Tns1+/+ No treatment). On day 21, 14 days after termination of tamoxifen administration (or no treatment), mice were euthanized and vital mouse organs, including lungs, hearts, middle lobe of livers, spleens, and kidneys were fixed and submitted to a board-certified veterinary pathologist for Hematoxylin and Eosin (H&E) staining, and subsequent histopathologic analysis. Heart, spleen, and liver tissues remained within normal limits in all the mice (Supplementary Fig. S3). Unlike the kidneys from untreated animals (Fig. 3A), kidneys from tamoxifen-treated animals, regardless of the genotype, demonstrated variable minimal to moderate peritonitis and retroperitonitis (Fig. 3B, C). In addition, we detected the presence of plasma cells, lymphocytes, and minimal neutrophils, indicative of minimal subacute, multifocal inflammation in the retroperitoneum adjacent to the kidneys and the renal capsules, which may be a result of tamoxifen injections. In contrast to the untreated lungs (Fig. 3D), the lungs of tamoxifen-treated animals showed a few multifocal areas with minimal to mild interstitial infiltration of lymphocytes and plasma cells, histiocytosis, as well as perivascular cell infiltrates (Fig. 3E, F). In one mouse lacking TNS1 (out of n = 3 analyzed), we detected multiple variable sized areas compatible with microvacuolated and macrovacuolated macrophages, engulfing lipid-like material, mixed with mild numbers of plasma cells and lymphocytes (Fig. 3F). Importantly, this finding was not evident in any other mouse and was consistent with drug/vehicle-lipid artifact.

In contrast to the lung pathologic findings 14 days after TNS1 knockout, mice with a conditional knockout of TNS1 at three months revealed the presence of mild to moderate alveolar histiocytosis with mild to moderate numbers of hemosiderin-laden macrophages in both Tns1+/+ and Tns1-/- mice (Table 1, Supplementary Fig. S4). Six months after knockout, two out of four Tns1-/- mice had evidence of either alveolar histiocytosis or perivascular lymphocytosis. These findings were resolved by 12 months (Table 1, Supplementary Fig. S4). We also found evidence of lipid pneumonia in one Tns1-/- mouse at the 6-month time point, which was likely a consequence of the tamoxifen administration (Supplementary Fig. S5). Kidney analysis revealed the presence of moderate hydronephrosis with mild and rare multifocal renal tubular cystic dilations in one Tns1-/- mouse three months post-tamoxifen treatment (Supplementary Fig. S5). However, no other mice (out of n = 19 total and 13 Tns1-/-) at three, six or 12 months had evidence of cystic kidney disease (Supplementary Fig. S6). Mice had evidence of peritoneal inflammation and fibrosis, which was consistent between Tns1+/+ and Tns1-/- animals. The fibrosis became more organized over time with marked reduction in inflammation by the 12 month time-point, indicating that this finding was likely related to the previous tamoxifen administration (Supplementary Fig. S7). At all three long-term timepoints, we found signs of histiocytic and lymphoplasmacytic peritonitis and steatitis in the peritoneum of most mice, regardless of the genotype (Supplementary Fig. S5). Furthermore, we detected endometrial thickening, including hyperplasia of the endometrial epithelium and stroma, endometrial cystic dilations, adenomyosis, as well as paraovarian cysts in both Tns1+/+ and Tns1-/- female mice throughout the course of our sample collection (Table 1, Supplementary Fig. S5). Overall, considering that tamoxifen-treated animals, regardless of the genotype, shared consistent changes, our data suggests that tamoxifen treatment may have an independent effect on vital mouse organ findings and is unrelated to the conditional TNS1 knockout.

Table 1 Pathological findings from Tns1+/+ and Tns1−/− mice treated with tamoxifen three, six and twelve months prior to analysis.

Full size table

We additionally reviewed the effect of TNS1 knockout on blood counts and plasma indices of renal and hepatic health. In this study, mice underwent a seven-day treatment with tamoxifen. On day 21, we collected blood samples from Tns1-/- and Tns1+/+ mice. We found no differences in white blood cell count, including monocytes and lymphocytes, platelet count or hemoglobin concentration observed (Fig. 4A-E). In addition, we obtained metabolic indices that showed no differences in blood urea nitrogen (BUN), creatinine (Cr) concentrations, total protein levels, albumin concentration or the levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST) and alkaline phosphatase (Fig. 4F-L). We also collected blood from Tns1+/+ and Tns1-/- mice 3, 6 and 12 months post-tamoxifen. At the 3 and 6 month time-points, we found no differences between the groups. At the 12 month time-point, n = 1 Tns1+/+ prohibited statistical analyses but we found that most of the mice remained within normal limits for each parameter, corroborating our previous findings (Supplementary Fig. S8). Notably, one Tns1-/- mouse had elevated levels of ALT and AST, as well as moderate, focal extensive histiocytic and lymphoplasmacytic peritonitis with hepatic capsule to parietal diaphragm adhesion, as detected on histopathological examination. Overall, we found that conditional knockout of TNS1 globally results in normal mating potential and unchanged pathological and blood parameters.

With our initial experiments, we conclude that there are no considerable phenotypic changes in the vital organs of adult mice within three weeks following induced global loss of TNS1 expression. Subsequently and in contrast to previous studies that demonstrate that mice with a germline knockout of TNS1 exhibit progressive cystic kidney disease, we did not see evidence of these alterations intrinsic to the kidney histology out to 12 months after knockout in this TNS1 knockout model¹¹.

RNA sequencing reveals alteration in the lung B-cell and myeloid populations upon TNS1 knockout in adult mice

Given our previous report of a role for TNS1 in lung fibroblast gene expression¹⁰ and our observed pathological findings, we sought to determine the transcriptional impact resulting from Tns1 knockout in the lung. For this, mice were treated with tamoxifen as above, RNA was isolated from five Tns1+/+ and three Tns1-/- mouse lungs and first subjected to Quality Control (QC) metrics. Between Tns1-/- and Tns1+/+, we identified 171 differentially expressed genes using the requirements of more than 1.5-fold difference with a False Discovery Rate (FDR) of less than 0.05 after correction for multiple comparisons. We subsequently analyzed these data through Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis^15,16,17, a heatmap of the top 50 differentially expressed genes, a volcano plot, and the STRING database protein-protein interaction (PPI) network.

KEGG pathway analysis showed enrichment in genes associated with host immune response, including differentiation of immune system precursors (Hematopoietic cell lineage, Osteoclast differentiation), several infections (Leishmaniasis, Tuberculosis, Chagas Disease, Malaria) as well as immune signaling pathways (C-type lectin receptor signaling pathway, Cytokine-cytokine receptor signaling interaction)^15,16,17. The top eight pathways, as sorted by p value, are shown in Supplementary Table S1 and Fig. 5A. The volcano plot analysis also depicts several immune-related highly upregulated genes such as Spib and Ms4a1 and downregulated genes such as Nfkbia, Trem1, Bhlhe40 and Clec4e in Tns1-/- compared to Tns1+/+ (Fig. 5B). These findings are also evident in the heatmap (Fig. 5C), which shows the Z-scores for normalized expression in contrast of the 50 most differentially expressed genes with FDR < 0.05. Some of the upregulated genes in Tns1-/- compared to Tns1+/+ mice include Cd19, Cd22, Spib, and Bank1 and downregulated genes include Trem1, Treml4, Plaur, Cd300e, Acod1, and Clec4e.

For the final transcriptome pathway analysis, we subjected the 171 differentially expressed (68 upregulated and 103 downregulated) genes to STRING: functional protein association networks analysis. Seventeen genes were not recognized by the STRING database and ultimately, 154 gene names and their adjusted log(Fold Change) values were included in the analysis, which led to a network with a PPI enrichment p-value of < 1.0e-16, an average node degree of 7.7, and an average local clustering coefficient of 0.456. We performed supervised Markov Clustering (MCL) with an inflation parameter of 2.2 and found two predominant clusters. Across all clusters, the top Biological Processes by Gene Ontology as sorted by FDR was Regulation of immune system process (GO: 0002682), with an FDR of 1.02 × 10^− 27 and included 63 of the 154 genes in the network, underscoring the immune system signature that resulted from the knockout of TNS1.

While our results demonstrated that TNS1 knockout had an impact on cell membrane-related signaling (Supplementary Table S2), we were intrigued to find that the top two cluster sets were marked by changes in the immune compartment (Figs. 6 and 7). These two cluster sets are defined by medium confidence where a minimum required interaction score of 0.400 was required. Disconnected nodes were removed from analysis. The size and color of the ring correspond to the log(FC) and the weight and color of the lines connecting the node are a STRING feature, where a darker and thicker line indicates a stronger degree of confidence in the prediction of the interaction.

Cluster A (Fig. 6A) is a cluster of 71 predominantly downregulated genes, many of which are involved in macrophage signaling. The top five biological Gene Ontology molecular functions sorted by FDR include Signaling receptor binding (GO:0005102), Signaling receptor regulator activity (GO:0030545), Immunoglobin receptor binding (GO:0034987), Signaling receptor inhibitor activity (GO:0034987), and Protein binding (GO:0005515). The top five TISSUES database Tissue expression pathways sorted by FDR include Macrophage, Bone marrow-derived macrophage, Immune system, Spleen, and Microglia. Notably, TNS1 expression in myeloid/macrophage lineage is corroborated by publicly available databases, such as the Kaminski/Rosas data set from the IPF cell atlas (Supplementary Fig. S9)¹⁸.

Several of the myeloid markers in Cluster A such as Trem1, Treml4, Plaur, Cd300e, Acod1, and Clec4e are downregulated in Tns1-/- samples. Using combined mRNA from a validation cohort treated identically, we validated changes in expression of markers Trem1 (Fig. 6B) and Mmp12 (Fig. 6C) by RT qPCR. To understand the potential functional impact of these gene and mRNA expression changes, we utilized an in vitro model of TNS1 knockdown in the THP-1 immortalized monocyte/macrophage cell line (Supplemental Fig. S10). THP-1 cells transfected with TNS1-targeting siRNA are smaller than scramble controls as measured by phalloidin staining of adherent cells (Fig. 6D) and forward scatter-height (FSC-H) flow cytometry of non-attached THP-1 cells (Fig. 6E). Adherent THP-1 cells with TNS1 knockdown by siRNA also migrated a significantly shorter distance on fibronectin-coated plates over the 16 h compared to the scrambled siRNA controls (Fig. 6F). Lastly, we observed a decrease in phagocytosis in TNS1-knockdown adherent THP-1 cells compared to scrambled control in a flow cytometric phagocytosis assay, demonstrating impaired macrophage function (Fig. 6G, Supplemental Fig. S11). Functional enrichment analysis of RNA sequencing similarly highlighted several predicted proteins and pathways involved in phagocytosis and differential gene expression revealed several differentially expressed genes that are critical in phagocytosis, all of which were downregulated in TNS1 knockout mice compared to controls (Supplemental Fig. S12).

Beyond the changes in myeloid signaling, we also detected Cluster B, composed of 16 upregulated genes associated with a B-cell signature (Fig. 7A). The top five TISSUES Database Tissue expression pathways are B-lymphocyte (BTO:0000776), Spleen (BTO:0001281), DAUDI cell (BTO:0001561), Urinary bladder carcinoma cell line (BTO:0000792), and plasma cell (BTO:000392). Gene Ontology molecular functions were not reported for this cluster. In Cluster B, several B-cell signaling markers such as Cd19, Cd22, Spib, and Bank1 were upregulated. Using combined mRNA from a second cohort of mice, we validated the upregulation of Spib (Fig. 7B) and Cd19 (Fig. 7C) by RT qPCR.

Given these findings that suggest TNS1’s impact on the immune compartment, we sought to examine the cell differentials in the Tns1-/- bronchoalveolar lavage. We identified a trend toward increased numbers of lymphocytes in Tns1-/- mouse bronchoalveolar lavage (BAL) three days after knockout compared to Tns1+/+ controls (Fig. 7D-G), indicating that there may be a propensity for increased lymphocytic inflammation in Tns1-/- mouse lungs.

Discussion

TNS1 has an established role as an integrin-binding protein that associates with focal and fibrillar adhesions, mediating fibronectin fibrillogenesis, along with regulation of focal adhesion related signaling^1,3,10. However, despite its multifunctional structure and dispersed tissue/cell expression, the role of TNS1 in non-stromal cells is unknown. Here, we have developed and characterized a novel mouse model that enables temporal regulation and conditional knockout of TNS1. Through RNA sequencing analysis of these mouse lungs, we found differential TNS1-driven regulation of lung immune signaling.

This murine model of conditional TNS1 knockout allows improved characterization of TNS1 effects compared to previously available models¹¹. In contrast to the previous method of TNS1 knockout, these mice do not demonstrate any overall pathological changes as a result of conditional TNS1 knockout up to twelve months, including no evidence of cystic kidney lesions. We noted one case of hydronephrosis in the three-month TNS1 knockout cohort, something that has been previously reported in mice, especially on C57Bl/6 background^19,20 and was not evident at the later time points analyzed. Considering that kidney pathology differed in our conditional TNS1 knockout compared to the constitutive method, these findings suggest that TNS1 may play an important role during development of the kidney, although we cannot exclude the possibility that we may see emergent renal pathology in mice of advanced age. Furthermore, we observed evidence of peritoneal inflammation and fibrosis, which appears to result from intraperitoneal tamoxifen administration, subsiding over time and up to the 12-month time point that we analyzed. In the Tns1+/+ and Tns1-/- female mice, we noted the presence of endometrial hyperplasia and cystic structures surrounding the ovaries, which has also been previously reported in association with tamoxifen administration in both mice and humans^21,22,23. Importantly, these pathological abnormalities did not appear to associate with the TNS1 knockout cohorts.

Interestingly, we found that TNS1 knockout results in robust changes to the immune compartment of the lung. Specifically, we have identified a strongly downregulated myeloid RNA signature in the lungs of TNS1 knockout mice that occurs in the absence of lung injury. Functionally, loss of TNS1 corresponded to smaller cell area, decreased migration distance, and reduced phagocytosis efficiency in THP-1 cells compared to scrambled control cells, indicating significant functional impairment in the absence of TNS1. Additional analysis of RNA sequencing suggests that many of the differentially regulated genes are involved in membrane signaling and we hypothesize that TNS1 may play a role in signaling by immune receptors at the membrane given its known function in interacting with transmembrane integrins^24,25,26. Our data also suggests that these transmembrane interactions are dependent on TNS1, as we observe impaired migration in adherent THP-1 cells with TNS1 knockdown compared to controls. Together, this suggests a novel role for TNS1, which may be critical for homeostatic signaling in myeloid cells such as dendritic cells, monocytes, and macrophages.

However, we also noted induction of a B-cell signature in the TNS1 knockout mouse, in contrast to downregulation of a myeloid signature. This finding further substantiates the hypothesis that TNS1 may have a role in immune system regulation. Using the Human Protein Atlas, the IPF cell atlas and RNA sequencing of human immune cells^{18,27,28,29,30}, it is observed that TNS1 expression is abundant in the monocyte/macrophage and B-cell populations. Supporting an effect of loss of TNS1 on the immune compartment, we find a trend toward elevated numbers of lymphocytes in BAL fluid of Tns1-/- mice. Taken together, these findings suggest that TNS1 may modify the immune response to injury beyond what is expected in its regulation of fibronectin assembly and mesenchymal function and fate^10,31. Further studies will be needed to determine the mechanistic basis for these alterations in immune cell function.

Given our findings, it will be of interest to determine how TNS1 modifies the inflammatory response to lung injury and fibrosis using this transgenic approach, the development of immune cell phenotypes, homing of immune cells to the lung, as well as signaling and immune responses in individual immune cell types. While beyond the scope of this report, these studies are ongoing.

In conclusion, we have developed a mouse that enables conditional knockout of TNS1 and avoids the deleterious complications of germline deletion. We have unexpectedly found that global TNS1 knockout results in gene expression changes in myeloid and lymphoid immune compartments, suggesting a role for TNS1 in these cell lineages. Ongoing research will determine the mechanisms by which TNS1 modifies immune signaling and lung signatures.

Methods

Generation of Tns1^{lox, lox} and Tns1^−/− mice

Tns1^{lox, lox} mice were generated de novo in collaboration with the University of Wisconsin-Madison Genome Editing and Animal Model (GEAM) core, flanking Tns1 exon 8 (ENSMUST00000169786.8) with loxP cassettes. In order to minimally impact critical functional elements of the splice acceptor, the 5’ loxP cassette was targeted for insertion over 500 bp away from the exon splice acceptor. The 3’ loxP site was targeted for insertion over 100 bp away from the exon 8 splice donor. We first attempted to knockin both loxP cassettes in one round of microinjection, using a single sgRNA and single-stranded oligo (ssODN) donor for each loxP cassette (Supplementary Table S3). A mixture of both in vitro transcribed sgRNAs (50 ng/µl total), both ssODNs (50 ng/µl total), and Cas9 protein (40 ng/µl) was microinjected into C57Bl6/J mouse embryos before the embryos were implanted into recipient mothers. C57Bl6/J mice were purchased from Jackson Labs (Bar Harbor, ME). To identify loxP knockin integration, tail snips from resulting pups were sampled, the region amplified via polymerase chain reaction, subcloned, and Sanger sequenced (Fig. 1A-C, Supplementary Fig. S1, S2). A mouse line carrying the 3’ loxP cassette, but not the 5’ loxP cassette, was successfully recovered. This line was used as embryo donor to specifically introduce the 5’ loxP cassette (Supplementary Table 1) as describe above. An allele carrying both 5’ and 3’ loxP cassettes was identified, but this allele also carried a duplication of part of the 5’ single-stranded oligodeoxynucleotide (ssODN) homology arm (possibly due to mixed homology-directed repair (HDR) – non-homologous end joining (NHEJ) event whereby single-stranded invasion of the ssODN followed by synthesis beyond the knockin construct and the generation of a double-stranded end, which was then ligated to the other end of the double stranded break by NHEJ³². Thus, the net result is an 80 bp insertion, rather than the expected 34 bp loxP insertion.

The resultant Tns1^{lox, lox} mice were backcrossed for over ten generations onto C57Bl6/J background to create the B6.Tns1^lox/lox mice. Subsequently, B6.Tns1^lox/lox mice were crossed with the tamoxifen-inducible Cre reporter strain (B6.129-Gt(ROSA)26Sor^{tm1(cre/ERT2)Tyj/J}); strain 008463 from Jackson Labs, now referred to as “Rosa^Cre/+;Tns1^lox/lox”. Mating potential was assessed by comparing the number of litters/mating pair and number of pups/litter in n = 5 mating pairs from the following colonies: C57Bl6/J, B6.Tns1^lox/lox and Rosa^Cre/+;Tns1^lox/lox. One-Way ANOVA with Šídák’s post-hoc test was used for statistical analyses (p < 0.05 was considered statistically significant). In other experiments, when Rosa^Cre/+;Tns1^lox/lox mice are treated with tamoxifen to induce Tns1 recombination, they are referred to as Tns1-/- and when the negative controls, either B6.Tns1^{lox, lox} or Rosa^Cre/+:Tns1^+/+ mice, are given tamoxifen, they are referred to as Tns1+/+.

Animals

Mouse protocols were approved by the Institutional Animal Care and Use Committee (IACUC protocol number M005823) at the University of Wisconsin-Madison and adhered to the guidelines set by the National Institutes of Health and the Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC), as well as the Animal Research: Reporting of In Vivo Experiments (ARRIVE) guidelines. The mice, generated de novo as described above, were housed under controlled temperature (~ 74 °F), humidity (~ 30%), and illumination (12-hour light/12-hour dark cycle), and laboratory chow and water were provided ad libitum. Animals received daily care and health checks and weekly cage changes. For mating potential comparisons, in-house bred C57Bl6/J mice were used as controls, along with mice from the aforementioned B6.Tns1^lox/lox colony. For experiments, male and female mice aged 14.4 ± 5.2 (mean ± SD) weeks from Rosa^Cre/+;Tns1^lox/lox colony or negative controls expressing TNS1 as described above were housed in groups (five or less) whenever possible. Mice were treated with daily doses of tamoxifen (100 mg/kg/day, IP; carcinogen, reproductive hazard/teratogen) for seven days, followed by confirmation of exon eight deletion 14 days (Fig. 1C and Supplementary Fig. S2) as well as 12 months later (Supplementary Fig. S1). Mice were regularly weighed and the weights were compared using Two Way ANOVA (p < 0.05 was considered statistically significant). In some cases, mice were anesthetized with ketamine (100 mg/kg, Zoetis Inc., Parsippany-Troy Hills, NJ) and xylazine (15 mg/kg, Akorn Pharmaceuticals, Lake Forest, IL) before delivering a single dose of intratracheal 50 µl 0.9% normal saline (NS, B. Braun Medical Inc., Bethlehem, PA). At experimental endpoint, mice were anesthetized via intraperitoneal injection of ketamine (200 mg/kg, Zoetis Inc.) and xylazine (30 mg/kg, Akorn Pharmaceuticals), and euthanized by exsanguination through severing the carotid artery or cardiac puncture before tissue sample collection.

Bronchoalveolar lavage

Mice were treated with tamoxifen daily for seven days (100 mg/kg/day, IP). One or 15 days later, 0.9% NaCl was delivered intratracheally, followed by collection of BAL fluid three days later, as previously described³³. Following anesthesia, mice were exsanguinated and intubated with a catheter and lavaged five times with 0.8-1.0 mL of 0.9% NaCl. Cells were isolated from the collected BAL fluid, and total cells counted. A proportion of the cells was stained using Wright Giemsa stain (Fisher Scientific, Kalamazoo, MI), and counted to assess the ratio of neutrophils, macrophages, lymphocytes, and eosinophils out of a total of 200 cells. Kolmogorov-Smirnov test was used to test data normality. Data sets that did not pass normality test (lymphocyte and eosinophil counts), data was log-transformed. Unpaired, two-tailed Student’s t-test was utilized for statistical analyses (p < 0.05 was considered statistically significant).

Blood panel analysis

For complete blood count and complete metabolic panel, terminal blood collection was performed via cardiac puncture. Blood was aliquoted into one ethylenediaminetetraacetic acid (EDTA)-coated tube for complete blood count (CBC) and one Lithium Heparin-coated tube for chemistry analysis. Whole blood in EDTA at room temperature was used for CBC analysis on Zoetis Vetscan HM5 (Zoetis Services LLC, Parsippany, NJ) within eight hours of collection. Heparinized whole blood was centrifuged (4000 RPM for ten minutes at room temperature) to collect plasma. Plasma was loaded into the Preventative Care Profile Plus rotors (Zoetis #10023238) and subjected to analysis via Zoetis Vetscan VS2. Individual markers were compared between the two groups using unpaired, two-tailed Student’s t-test, adjusted with the Benjamini-Hochberg method to account for FDR (p < 0.05 was considered statistically significant).

Polymerase chain reaction

DNA was digested from mouse tail clips using Direct PCR (Tail) lysis reagent (Viagen Biotech Inc., Los Angeles, CA) supplemented with proteinase K (Thermo Fisher Scientific, Waltham, MA), and overnight shaking at 55 °C. Subsequently, the reaction was quenched by heating to 85 °C for 45 min before PCR in Taq buffer with KCl (Fermentas, Waltham, MA), 2 mM MgCl₂ (Fisher Scientific, Hampton, NH), 0.2 mM dNTP (Thermo Fisher Scientific), and Taq DNA Polymerase (Fisher Scientific). PCR cycling included 1 cycle at 94 °C (3 min), 35 cycles at 94 °C (45 s), 57 °C (60 s) then 72 °C (75 s), and 1 cycle at 72 ° (10 min). The resulting samples were mixed with 6X sample dye before being run on 2% agarose gels for 30 min at 100 V and read using GE LAS4000 chemiluminescence imager. One-Way ANOVA with Šídák’s post-hoc test was used to compare data (p < 0.05 was considered statistically significant).

Reverse transcription quantitative polymerase chain reaction (RT-qPCR)

Whole mouse lungs were used for isolation of RNA. Lungs were flash frozen and suspended in RNA STAT-60 (Amsbio, Abingdon, UK) and then bullet blended with RNase free 0.9–2.0 mm stainless steel beads SSB14B-RNA (Next Advance, Troy, NY) until homogenized. Additional RNA STAT-60 followed by chloroform were added prior to centrifugation. RNA was precipitated from the resulting colorless upper aqueous phase and the lower phenol phase containing protein was utilized for protein extraction (see below). RNA pellets were washed with 75% ethanol and resuspended in nuclease free water. cDNA was then synthesized using the iScript cDNA synthesis kit (170–8841 Bio-Rad, Hercules, CA). Primers were designed and purchased from Integrated DNA Technologies (Coralville, IA) or the University of Wisconsin-Madison Biotechnology Center (Madison, WI). Primer pairs are listed in Supplementary Tables S4 and S5 and were tested at different concentrations to determine optimal efficiency with satisfactory melting curves. Succinate dehydrogenase complex flavoprotein subunit A (Sdha) was used as a housekeeping gene control. iTaq Universal SYBR Green Supermix (172–5120 Bio-Rad) was used to for RT-qPCR following the manufacturer’s recommendations in an Applied Biosystems 7500 multi-color StepOne™ Real-Time PCR Detection System. Unpaired, two-tailed Student’s t-test (p < 0.05 was considered statistically significant) was applied to the ΔΔCt values to assess statistical significance.

Western blot

Protein from mouse whole lung lysates from the lower red phenol phase following RNA isolation (RNA STAT-60 protocol, as described above) was precipitated in acetone. The protein pellet was dispersed in 0.3 M guanidine hydrochloride (Sigma Aldrich, St. Louis, MO) in 95% ethanol + 2.5% glycerol (Fisherbrand, Pittsburg, PA), centrifuged, and washed according to the Amsbio protocol. The resulting pellet was solubilized in 5% sodium dodecyl sulfate (SDS, Sigma Aldrich)/urea buffer (EM Science, Cherry Hill, NJ) supplemented with 1% sodium pyrophosphate (Sigma Aldrich), 1% protease inhibitor cocktail (Thermo Fisher Scientific), 200 μm Na-orthovanadate (ICN, Biomedical Inc. Costa Mesa, CA), and 0.1% phenylmethanesufonyl fluoride (PMSF, Sigma Aldrich). The samples were heated for three minutes at 100 °C and 20 µL of sample were loaded and run with polyacrylamide gel electrophoresis and analyzed by Western blot, with primary and corresponding Horseradish Peroxidase (HRP)-conjugated secondary antibodies, before being developed by enhanced chemiluminescence (ECL) (GE, Boston, MA). Antibodies included Tensin1 Polyclonal Antibody (rabbit from Invitrogen # PA5-116023), β-actin monoclonal antibody (mouse from Sigma, #A1978), Goat Anti-Rabbit IgG H & L Chain Specific Peroxidase Conjugate (EMD Millipore # 401393), and Goat Anti-Mouse IgG (H + L) Secondary Antibody HRP (Invitrogen # 32430). Images were obtained using GE LAS4000 chemiluminescence imager. Densitometry of selected blots was analyzed via ImageJ and unpaired, two-tailed Student’s t-test was applied to compared samples (p < 0.05 was considered statistically significant).

Immunohistochemistry and veterinary pathologist review

Mouse whole lungs were inflated with 10% neutral buffered formalin (Fisherbrand), while the remaining vital organs, including the heart, medial lobe of the liver, spleen, and kidneys, were removed. All tissues were fixed in 10% neutral buffered formalin for 24 h before being submerged in 70% EtOH and subjected to H&E or trichrome staining (HistoWiz, Brooklyn, NY, USA or University of Wisconsin-Madison Comparative Pathology Laboratory). Microscopic tissue assessment was performed by a board-certified veterinary pathologist on tissues from Tns1-/- mice (n = 2 males, 1 female) compared to the tamoxifen-treated B6.Tns1^{lox, lox} mouse (n = 1 male) and the untreated B6.Tns1^{lox, lox} mouse (n = 1 male) to assess any changes in the overall tissue histopathology as a result of TNS1 knockout 14 days post-tamoxifen administration. At select time points, post-tamoxifen delivery the mouse organs were also examined, including the lung, aorta, heart, kidneys, adrenal glands, pancreas, spleen, liver, ovaries, and fallopian and uterine tubes (in female mice only). This was done at three month (n = 1 Tns1+/+ male, 1 Tns1-/- male, and 3 Tns1-/- females), six month (n = 3 Tns1+/+ males, 2 Tns1-/- males, and 2 Tns1-/- females), and 12 month (n = 1 Tns1+/+ male, 1 Tns1-/- male, and 3 Tns1-/- females) time points. Select organs were analyzed from additional mice at three months post-tamoxifen, including ovaries, fallopian and uterine tubes (n = 1 Tns1+/+ female and 1 Tns1-/- female), lungs (n = 1 Tns1+/+ male), and kidneys (n = 1 Tns1-/- male).

RNA preparation for sequencing

Whole lung RNA lysates from the Tns1-/- mouse cohort (n = 1 male, 2 females) were compared to age-matched tamoxifen-treated B6.Tns1^{lox, lox} littermate controls (n = 2 males, 3 females). All mice were treated with tamoxifen (100 mg/kg/day, IP) for seven days, followed by a one-time dose of intratracheal 50 µl 0.9% normal saline (NS, B. Braun Medical Inc.). Fourteen days later, the left lung was flash frozen for RNA extraction and sequencing. RNA was processed as described above under RT-qPCR with the addition of the Ambion (Austin, TX) AM1907 Turbo DNA-free kit to remove any remaining DNA prior to synthesis of cDNA.

RNA sequencing with Bioinformatics Resource Core (BRC) within the UW Biotechnology Center (UWBC) and quality control

Samples were submitted to the University of Wisconsin-Madison Biotechnology Center Gene Expression Center for RNA sequencing and to the Bioinformatics Resource Core for RNA sequencing analysis. RNA was analyzed for quality control (QC) (Nanodrop and Agilent Bioanalyzer). All samples met QC metrics by 28 S/18S rRNA ratio and RNA Integrity Number (RIN). Bulk RNA sequencing analysis was then performed using the Illumina NovaSeq6000 S4 System (2 × 150 bp, ~ 66 M reads/sample) with the Illumina TruSeq Stranded mRNA (polyA enrichment) Library. Sequencing reads were first demultiplexed. Next, low-abundance genes with an average read count below a threshold of 1.0 in two or more samples were filtered and then reads were trimmed using the trimming software Skewer.

Bioinformatic analysis of transcriptomic data adhered to recommended ENCODE guidelines and best practices for RNA-Seq ³⁴. Alignment of adapter-trimmed (Skewer v0.1.123 ³⁵), 2 × 150 (paired-end, PE) base pair strand-specific Illumina reads to the Mus musculus GRCm38.p5 genome (assembly accession NCBI GCA 000001635.7) was achieved with the Spliced Transcripts Alignment to a Reference (STAR v2.5.3a) software³⁶, a splice-junction aware aligner, using annotation provided by Ensembl release 91. Expression estimation was performed with RNASeq by Expectation Maximization (RSEM v1.3.0, ³⁷). To test for differential gene expression among individual group contrasts, expected read counts obtained from RSEM were used as input into edgeR (v3.16.5, ³⁸). Inter-sample normalization was achieved with the trimmed mean of M-values (TMM, ³⁹) method. Statistical significance of the negative-binomial regression test was adjusted with a Benjamini-Hochberg FDR correction at the 5% level⁴⁰. Prior to statistical analysis with edgeR, independent filtering was applied and required genes to have a count-per-million (CPM) above k in n samples, where k is determined by minimum read count (10 reads) and by the sample library sizes where n is determined by the number of biological replicates in each group. The validity of the Benjamini-Hochberg FDR multiple testing procedure was evaluated by inspection of the uncorrected p-value distribution.

STRING database pathway analysis

Differential gene expression analysis of the Tns1-/- mouse cohort compared to tamoxifen treated Tns1+/+ controls was reported using the ‘edgeR glm approach’. Log fold of control (log(FC)), log counts per million (log(CPM)), the likelihood ratio (LR), unadjusted p value (p), and adjusted p value or FDR were reported. Data was sorted by FDR. The STRING online database (String-db.org) was used to construct PPI networks^41,42,43. For all differentially expressed genes with an FDR < 0.05 (N = 171 genes), the gene name and log(FC) values were entered into the ‘Proteins with Values/Ranks - Functional Enrichment Analysis’ function of the STRING database with the option ‘Submit data to normal geneset analysis’. The STRING database recognized 154 of these genes, with the majority of unrecognized genes being predicted sequences. Supervised MCL clustering with an inflation parameter of 2.2 was applied. Clusters were exported to Cytoscape and formatted such that a darker and wider gene outline indicates a higher level of differential gene expression.

Functional enrichment analyses

Functional enrichment analyses were identified using the top five Molecular Function and Cellular Component (Gene Ontology) and Tissue Expression (TISSUE), sorted by FDR. The enrichment of biological pathways supplied by KEGG was also reported^15,16,17. For heatmap analysis, the Z-score of a given expression value is the number of standard deviations away from the mean of all the expression values for that gene. The Z-score was scaled across rows of genes normalized by TMM to determine gradation of color. Genes and samples were clustered using Euclidean distances and an elbow function was applied to estimate the number of gene clusters present. Calculated relationships were depicted by dendrograms drawn at the top (samples) and to the left (genes) of the heatmap.

Cell culture

THP-1 cells (TIB-202, ATCC, Manassas, VA) passages 13–22 were seeded in appropriate densities (see below) and treated with 100 nM phorbol 12-myristate 13-acetate (PMA, Sigma Aldrich) for 24 h in RPMI 1640 growth medium (Corning, Corning, NY), containing 10% fetal bovine serum (Cytiva, Wilmington, DE), 1% penicillin-streptomycin with amphotericin B (Corning), and 2% sodium pyruvate (Corning) to induce differentiation and attachment. Cells were then transfected with 25nM TNS1 or scrambled siRNA in Opti-MEM™ reduced-serum medium (Thermo Fisher Scientific) for 24 h. siRNA were from Qiagen, including human TNS1-1 sequence AGCGGTATGTTCCGCTCTCAA (Allstars SI00134092)¹⁰ and scrambled control (1027310). Following transfection, cells were incubated with starvation RPMI medium containing 0.1% bovine serum albumin (BSA, Sigma Aldrich). Cells were then used for subsequent experiments.

Phagocytosis assay

THP-1 cells were plated at a density of 2.0 × 10⁵ cells/well in a 96-well plate and manipulated as described above. After TNS1 was knocked down, cells were subsequently treated with 100 µg/mL pHrodo™ (Thermo Fisher Scientific) at 37 °C for 1 h. Control cells were incubated with 10 µM cytochalasin D (Sigma-Aldrich) at 37 °C both before and during pHrodo™ treatment. After treatment, cells were detached using TrypLE™ Express (Thermo Fisher Scientific), and resuspended in FA3 buffer, composed of 1X DPBS (Ca2 + Mg2+ free, Corning) with 10mM HEPES (Corning), 2mM EDTA (Millipore-Sigma) and 1% FBS (Cytiva). The cells were then plated into a 96-well plate (Corning) for flow cytometry analysis. Flow cytometric analysis was performed on Cytek Aurora Spectral Flow Cytometer at the University of Wisconsin Carbone Cancer Center Flow Cytometry Laboratory. Forward scatter (FSC) files were down sampled to start with the same number of events in each sample ahead of analysis. Cells were gated for singlets using Side scatter height vs. Side scatter area (SSC-H vs. SSC-A). Samples were then analyzed for expression of pHrodo™ Deep Red. One way ANOVA with Šídák’s post-hoc test was utilized for statistical analysis (p < 0.025 was considered statistically significant).

THP-1 cell size estimation

THP-1 cells were seeded onto FN-coated (Millipore-Sigma) 8-well chamber µ-slides (Ibidi, Munich, Germany) slides at a density of 6.25 × 10⁴ cells/well and treated with PMA (as above). After TNS1 knockdown, cells were fixed for 20 min in 4% PFA and stained with Rhodamine Phalloidin Reagent (Abcam) for 1 h at room temperature. Images were obtained on a Nikon Ti2 Eclipse Microscope. Three 40X images (n = 15–55 cells/image) for each condition were analyzed for area using the CellPose plugin for ImageJ, while manually excluding incorrect segmentation⁴⁴. FSC-Height (FSC-H) was assessed from phagocytosis flow cytometry experiments, above. Duplicate singlet gates were utilized to ensure doublets were excluded and the mean of the FSC-H was analyzed. Data is presented as mean ± SD and was analyzed via Unpaired Student’s t-test (* p < 0.05).

Migration assay

THP-1 cells were plated at a density of 1.0 × 10⁶ cells in a 6-well plate and treated with PMA (as above). Following TNS1 knockdown, cells were detached using TrypLE™ Express and then re-seeded onto fibronectin-coated 8-well µ-slides at a density of 6.25 × 10⁴ cells/well. Cells were allowed to reattach for 20 min at 37 °C before imaging. Cells were placed in Tokai Hit chamber and 10X brightfield images were taken every 15 min for 16 h on a Nikon Ti-E Inverted Microscope. Two 10X hyperstacks (n = 2–11 cells/hyperstack) for each condition were analyzed using TrackMate package on ImageJ with manual exclusion of improperly identified cells to provide migration distance^45,46. Data is presented as mean ± SD and was analyzed via Unpaired Student’s t-test (* p < 0.05).

Data availability

The datasets generated and/or analyzed during the current study are available in the NCBI GEO and FigShare repositories: https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE319060. https://figshare.com/s/13185ff2a8505951f1f2.

References

Lo, S. H. & Tensin Int. J. Biochem. Cell. Biol. 36, 31–34, doi:https://doi.org/10.1016/s1357-2725(03)00171-7 (2004).
Article CAS PubMed Google Scholar
Zamir, E. et al. Molecular diversity of cell-matrix adhesions. J. Cell. Sci. 112 (Pt 11), 1655–1669 (1999).
Article CAS PubMed Google Scholar
Pankov, R. et al. Integrin dynamics and matrix assembly: tensin-dependent translocation of alpha(5)beta(1) integrins promotes early fibronectin fibrillogenesis. J. Cell. Biol. 148, 1075–1090 (2000).
Article CAS PubMed PubMed Central Google Scholar
Davis, S. et al. Presence of an SH2 domain in the actin-binding protein tensin. Science 252, 712–715. https://doi.org/10.1126/science.1708917 (1991).
Article ADS CAS PubMed Google Scholar
Fan, W. et al. Matrix viscoelasticity promotes liver cancer progression in the pre-cirrhotic liver. Nature 626, 635–642. https://doi.org/10.1038/s41586-023-06991-9 (2024).
Article ADS CAS PubMed PubMed Central Google Scholar
Repapi, E. et al. Genome-wide association study identifies five loci associated with lung function. Nat. Genet. 42, 36–44. https://doi.org/10.1038/ng.501 (2010).
Article CAS PubMed Google Scholar
Soler Artigas, M. et al. Effect of five genetic variants associated with lung function on the risk of chronic obstructive lung disease, and their joint effects on lung function. Am. J. Respir Crit. Care Med. 184, 786–795. https://doi.org/10.1164/rccm.201102-0192OC (2011).
Article CAS PubMed PubMed Central Google Scholar
Ferreira, M. A. et al. Genome-wide association analysis identifies 11 risk variants associated with the asthma with hay fever phenotype. J. Allergy Clin. Immunol. 133, 1564–1571. https://doi.org/10.1016/j.jaci.2013.10.030 (2014).
Article CAS PubMed Google Scholar
Duan, J. et al. miR-152/TNS1 axis inhibits non-small cell lung cancer progression through Akt/mTOR/RhoA pathway. Biosci. Rep. 41 https://doi.org/10.1042/BSR20201539 (2021).
Bernau, K. et al. Tensin 1 Is Essential for Myofibroblast Differentiation and Extracellular Matrix Formation. Am. J. Respir Cell. Mol. Biol. 56, 465–476. https://doi.org/10.1165/rcmb.2016-0104OC (2017).
Article CAS PubMed PubMed Central Google Scholar
Lo, S. H., Yu, Q. C., Degenstein, L., Chen, L. B. & Fuchs, E. Progressive kidney degeneration in mice lacking tensin. J. Cell. Biol. 136, 1349–1361 (1997).
Article CAS PubMed PubMed Central Google Scholar
Wu, Z. Y. et al. Hyperactivity of Mek in TNS1 knockouts leads to potential treatments for cystic kidney diseases. Cell. Death Dis. 10, 871. https://doi.org/10.1038/s41419-019-2119-7 (2019).
Article CAS PubMed PubMed Central Google Scholar
Ventura, A. et al. Restoration of p53 function leads to tumour regression in vivo. Nature 445, 661–665. https://doi.org/10.1038/nature05541 (2007).
Article CAS PubMed Google Scholar
Liu, Z. et al. Short-term tamoxifen treatment has long-term effects on metabolism in high-fat diet-fed mice with involvement of Nmnat2 in POMC neurons. FEBS Lett. 592, 3305–3316. https://doi.org/10.1002/1873-3468.13240 (2018).
Article CAS PubMed Google Scholar
Kanehisa, M. & Goto, S. KEGG: kyoto encyclopedia of genes and genomes. Nucleic Acids Res. 28, 27–30. https://doi.org/10.1093/nar/28.1.27 (2000).
Article CAS PubMed PubMed Central Google Scholar
Kanehisa, M. Toward understanding the origin and evolution of cellular organisms. Protein Sci. 28, 1947–1951. https://doi.org/10.1002/pro.3715 (2019).
Article CAS PubMed PubMed Central Google Scholar
Kanehisa, M., Furumichi, M., Sato, Y., Kawashima, M. & Ishiguro-Watanabe, M. KEGG for taxonomy-based analysis of pathways and genomes. Nucleic Acids Res. 51, D587–D592. https://doi.org/10.1093/nar/gkac963 (2023).
Article CAS PubMed PubMed Central Google Scholar
Adams, T. S. et al. Single-cell RNA-seq reveals ectopic and aberrant lung-resident cell populations in idiopathic pulmonary fibrosis. Sci Adv 6, eaba (1983). https://doi.org/10.1126/sciadv.aba1983 (2020).
Nemoto, S., Uchida, K. & Ohno, H. Implications of Genetic Factors Underlying Mouse Hydronephrosis: Cautionary Considerations on Phenotypic Interpretation in Genetically Engineered Mice. Int. J. Mol. Sci. 25 https://doi.org/10.3390/ijms25137203 (2024).
Brayton, C. F., Treuting, P. M. & Ward, J. M. Pathobiology of aging mice and GEM: background strains and experimental design. Vet. Pathol. 49, 85–105. https://doi.org/10.1177/0300985811430696 (2012).
Article CAS PubMed Google Scholar
Diwan, B. A., Anderson, L. M. & Ward, J. M. Proliferative lesions of oviduct and uterus in CD-1 mice exposed prenatally to tamoxifen. Carcinogenesis 18, 2009–2014. https://doi.org/10.1093/carcin/18.10.2009 (1997).
Article CAS PubMed Google Scholar
Zik, B., Kurnaz, H., Guler, S. & Asmaz, E. D. Effect of tamoxifen on the Notch signaling pathway in ovarian follicles of mice. Biotech. Histochem. 94, 410–419. https://doi.org/10.1080/10520295.2019.1580387 (2019).
Article CAS PubMed Google Scholar
Inal, M. M. et al. Ovarian cysts in tamoxifen-treated women with breast cancer. Eur. J. Obstet. Gynecol. Reprod. Biol. 120, 104–106. https://doi.org/10.1016/j.ejogrb.2004.09.006 (2005).
Article CAS PubMed Google Scholar
McCleverty, C. J., Lin, D. C. & Liddington, R. C. Structure of the PTB domain of tensin1 and a model for its recruitment to fibrillar adhesions. Protein Sci. 16, 1223–1229. https://doi.org/10.1110/ps.072798707 (2007).
Article CAS PubMed PubMed Central Google Scholar
Calderwood, D. A. et al. Integrin beta cytoplasmic domain interactions with phosphotyrosine-binding domains: a structural prototype for diversity in integrin signaling. Proc. Natl. Acad. Sci. U. S. A. 100, 2272–2277, (2003). https://doi.org/10.1073/pnas.262791999
Bockholt, S. M. & Burridge, K. Cell spreading on extracellular matrix proteins induces tyrosine phosphorylation of tensin. J. Biol. Chem. 268, 14565–14567 (1993).
Article CAS PubMed Google Scholar
Monaco, G. et al. RNA-Seq Signatures Normalized by mRNA Abundance Allow Absolute Deconvolution of Human Immune Cell Types. Cell Rep 26, 1627–1640 e1627, (2019). https://doi.org/10.1016/j.celrep.2019.01.041
Uhlen, M. et al. Proteomics. Tissue-based map of the human proteome. Science 347, 1260419. https://doi.org/10.1126/science.1260419 (2015).
Article CAS PubMed Google Scholar
Karlsson, M. et al. A single-cell type transcriptomics map of human tissues. Sci. Adv. 7 https://doi.org/10.1126/sciadv.abh2169 (2021).
Uhlen, M. et al. A genome-wide transcriptomic analysis of protein-coding genes in human blood cells. Science 366 https://doi.org/10.1126/science.aax9198 (2019).
Hinz, B., Dugina, V., Ballestrem, C., Wehrle-Haller, B. & Chaponnier, C. Alpha-smooth muscle actin is crucial for focal adhesion maturation in myofibroblasts. Mol. Biol. Cell. 14, 2508–2519. https://doi.org/10.1091/mbc.E02-11-0729 (2003).
Article CAS PubMed PubMed Central Google Scholar
Fritsche, S., Reinfurt, A., Fronek, F. & Steiger, M. G. NHEJ and HDR can occur simultaneously during gene integration into the genome of Aspergillus niger. Fungal Biol. Biotechnol. 11, 10. https://doi.org/10.1186/s40694-024-00180-7 (2024).
Article CAS PubMed PubMed Central Google Scholar
Bernau, K. et al. Megakaryoblastic leukemia-1 is required for the development of bleomycin-induced pulmonary fibrosis. Respir Res. 16 https://doi.org/10.1186/S12931-015-0206-6 (2015). doi:Artn 45.
Consortium, E. E. N. C. O. D. E. Guidelines and Best Practices for RNA-Seq. (2016).
Jiang, H., Lei, R., Ding, S. W. & Zhu, S. Skewer: a fast and accurate adapter trimmer for next-generation sequencing paired-end reads. BMC Bioinform. 15, 182. https://doi.org/10.1186/1471-2105-15-182 (2014).
Article Google Scholar
Dobin, A. et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29, 15–21. https://doi.org/10.1093/bioinformatics/bts635 (2013).
Article CAS PubMed Google Scholar
Li, B. & Dewey, C. N. RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinform. 12, 323. https://doi.org/10.1186/1471-2105-12-323 (2011).
Article CAS Google Scholar
Robinson, M. D., McCarthy, D. J. & Smyth, G. K. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 26, 139–140. https://doi.org/10.1093/bioinformatics/btp616 (2010).
Article CAS PubMed Google Scholar
Robinson, M. D. & Oshlack, A. A scaling normalization method for differential expression analysis of RNA-seq data. Genome Biol. 11 (R25). https://doi.org/10.1186/gb-2010-11-3-r25 (2010).
Reiner, A., Yekutieli, D. & Benjamini, Y. Identifying differentially expressed genes using false discovery rate controlling procedures. Bioinformatics 19, 368–375. https://doi.org/10.1093/bioinformatics/btf877 (2003).
Article CAS PubMed Google Scholar
Snel, B., Lehmann, G., Bork, P. & Huynen, M. A. STRING: a web-server to retrieve and display the repeatedly occurring neighbourhood of a gene. Nucleic Acids Res. 28, 3442–3444. https://doi.org/10.1093/nar/28.18.3442 (2000).
Article CAS PubMed PubMed Central Google Scholar
von Mering, C. et al. STRING: a database of predicted functional associations between proteins. Nucleic Acids Res. 31, 258–261. https://doi.org/10.1093/nar/gkg034 (2003).
Article CAS Google Scholar
Szklarczyk, D. et al. The STRING database in 2023: protein-protein association networks and functional enrichment analyses for any sequenced genome of interest. Nucleic Acids Res. 51, D638–D646. https://doi.org/10.1093/nar/gkac1000 (2023).
Article CAS PubMed PubMed Central Google Scholar
Stringer, C., Wang, T., Michaelos, M. & Pachitariu, M. Cellpose: a generalist algorithm for cellular segmentation. Nat. Methods. 18, 100–106. https://doi.org/10.1038/s41592-020-01018-x (2021).
Article CAS PubMed Google Scholar
Tinevez, J. Y. et al. TrackMate: An open and extensible platform for single-particle tracking. Methods 115, 80–90. https://doi.org/10.1016/j.ymeth.2016.09.016 (2017).
Article CAS PubMed Google Scholar
Ershov, D. et al. TrackMate 7: integrating state-of-the-art segmentation algorithms into tracking pipelines. Nat. Methods. 19, 829–832. https://doi.org/10.1038/s41592-022-01507-1 (2022).
Article CAS PubMed Google Scholar

Download references

Acknowledgements

We acknowledge the Carbone Cancer Center Support Grant: NCI P30 CA014520 that supports the University of Wisconsin-Madison (UW-Madison) SAIRF, GEAM and Translational Research Initiatives in Pathology (TRIP) laboratory. We thank the SAIRF for use of their facilities, and services, and the TRIP lab, further supported by the Department of Pathology and Laboratory Medicine and the Office of The Director-NIH (S10 OD023526) for the use of its services. We want to thank the Genome Editing (RRID: SCR_021070) and Animal Models (GEAM) Core (RRID: SCR_024797), Gene Expression Center (RRID: SCR_017757) and Bioinformatics Resource Center (RRID: SCR_017799) of the UW-Madison Biotechnology Center, as well as the UW-Madison Research Animal Resources Center Comparative Pathology Laboratory and Histowiz for their support in generating and characterizing the novel mouse model. We thank the University of Wisconsin Carbone Cancer Center Flow Cytometry Laboratory, supported by P30 CA014520, for use of its facilities and services. We are also grateful for the support of the UW-Madison Department of Medicine Biostatistics Group. This work is supported in part by the George and Julie Mosher family. This work was made possible by the Pulmonary Fibrosis Foundation, by an independent grant from the Boehringer Ingelheim Pharmaceuticals Inc. who provided the financial support. The authors meet criteria for authorship as recommended by the International Committee of Medical Journal Editors (ICMJE) and were fully responsible for all aspects of the trial and publication development (K.B.). All figures and images were generated by authors (K.B., K.H., A.F.M., K.W.C., M.A.O.).

Funding

This work was supported by Department of Defense grants W81XWH-22-1-0692 (N.S.) and HT94252410543 (N.S.), National Institutes of Health grant R01HL146402 (N.S.), National Institutes of Health grant K01HL171464 (K.B.), National Institutes of Health grant P30CA014520 (University of Wisconsin Carbone Cancer Center–Small Animal Imaging and Radiotherapy Facility (SAIRF) and GEAM), National Institutes of Health grant S10OD023526 (University of Wisconsin–TRIP Lab), Falk Transformational Award (N.S.), University of Wisconsin-Madison Wisconsin Partnership Program–Clinical Health Sciences Program (N.S.), University of Wisconsin-Madison Department of Medicine Pilot Grant (N.S.), Pulmonary Fibrosis Foundation Scholars Award (1053163, K.B.), American Heart Association Career Development Award (24CDA1272732, K.B.).

Author information

Kelsey Holbert
Present address: Division of Pulmonary, Critical Care, Sleep and Allergy, Department of Medicine, College of Medicine, University of Illinois Chicago, 840 South Wood Street, Chicago, IL, 60612, USA
These authors contributed equally: Ksenija Bernau and Kelsey Holbert.

Authors and Affiliations

Division of Allergy, Pulmonary and Critical Care Medicine, Department of Medicine, School of Medicine and Public Health, University of Wisconsin-Madison, 600 Highland Avenue, Madison, WI, 53792, USA
Ksenija Bernau, Kelsey Holbert, Ivy S. McDermott, Babita Rahar, Kade W. Coulter, Madalyn A. Osterhaus, Thomas J. Harr, Carson Gehl, Angie Tebon Oler, Trevor S. Langel, Kenneth M. Chan & Nathan Sandbo
Comparative Pathology Laboratory, Research Animal Resources and Compliance, University of Wisconsin-Madison, 1710 University Avenue, Madison, WI, 53726, USA
Christopher Huffman, Beth Gray & Andres F. Mejia
Department of Medicine, School of Medicine and Public Health, University of Wisconsin-Madison, 600 Highland Avenue, Madison, WI, 53792, USA
Amir Forati
Biotechnology Center, University of Wisconsin-Madison, 425 Henry Mall, Madison, WI, 53706, USA
Sandra Splinter BonDurant, Mark E. Berres, Kathy J. Krentz & C. Dustin Rubinstein

Authors

Ksenija Bernau
View author publications
Search author on:PubMed Google Scholar
Kelsey Holbert
View author publications
Search author on:PubMed Google Scholar
Ivy S. McDermott
View author publications
Search author on:PubMed Google Scholar
Babita Rahar
View author publications
Search author on:PubMed Google Scholar
Kade W. Coulter
View author publications
Search author on:PubMed Google Scholar
Madalyn A. Osterhaus
View author publications
Search author on:PubMed Google Scholar
Thomas J. Harr
View author publications
Search author on:PubMed Google Scholar
Carson Gehl
View author publications
Search author on:PubMed Google Scholar
Angie Tebon Oler
View author publications
Search author on:PubMed Google Scholar
Christopher Huffman
View author publications
Search author on:PubMed Google Scholar
Beth Gray
View author publications
Search author on:PubMed Google Scholar
Trevor S. Langel
View author publications
Search author on:PubMed Google Scholar
Kenneth M. Chan
View author publications
Search author on:PubMed Google Scholar
Amir Forati
View author publications
Search author on:PubMed Google Scholar
Sandra Splinter BonDurant
View author publications
Search author on:PubMed Google Scholar
Mark E. Berres
View author publications
Search author on:PubMed Google Scholar
Kathy J. Krentz
View author publications
Search author on:PubMed Google Scholar
C. Dustin Rubinstein
View author publications
Search author on:PubMed Google Scholar
Andres F. Mejia
View author publications
Search author on:PubMed Google Scholar
Nathan Sandbo
View author publications
Search author on:PubMed Google Scholar

Contributions

Conceptualization: NS, KB; Methodology: KB, KH, CDR, KJK, MEB, AFM, NS, SSB, ISM, KWC, MAO; Validation: KB, KH, BR, CG, CDR, BG, AFM, SSB; Formal analysis: KB, KH, AF, MEB, AFM, NS, KWC, MAO, ISM; Investigation: KB, KH, ISM, BR, TJH, CG, ATO, CH, BG, AFM, NS, SSB, TSL, KMC, KWC, MAO; Resources: NS, KB, KH, ISM, BR, TJH, ATO, CDR, KJK; Writing – original draft: KB, KH, AFM, NS, CDR, MEB, KWC, MAO, ISM; Writing – review and editing: KB, KH, ISM, NS, AFM, KJK, CDR, MEB, ATO, CG, KWC, MAO, BR, SSB, TJH, CH, BG, TSL, KMC, AF; Visualization: KB, KH, AFM, MAO, KWC; Supervision: KB, NS, CDR, KJK, AFM.

Corresponding author

Correspondence to Ksenija Bernau.

Ethics declarations

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Below is the link to the electronic supplementary material.

Supplementary Material 1 (download DOCX )

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Bernau, K., Holbert, K., McDermott, I.S. et al. Development and characterization of an inducible Tensin1 deficient transgenic murine model. Sci Rep 16, 8639 (2026). https://doi.org/10.1038/s41598-026-41319-3

Download citation

Received: 11 April 2025
Accepted: 19 February 2026
Published: 28 February 2026
Version of record: 11 March 2026
DOI: https://doi.org/10.1038/s41598-026-41319-3